ID: 1079080602

View in Genome Browser
Species Human (GRCh38)
Location 11:17411053-17411075
Sequence TCCTGAGCTGTTCCTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 310}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079080592_1079080602 26 Left 1079080592 11:17411004-17411026 CCAGCACTCTGCATTCCAGGTTC 0: 1
1: 0
2: 2
3: 29
4: 360
Right 1079080602 11:17411053-17411075 TCCTGAGCTGTTCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 310
1079080598_1079080602 3 Left 1079080598 11:17411027-17411049 CCAGGAAGCCTGCCGTCTGGGCC 0: 1
1: 0
2: 1
3: 16
4: 218
Right 1079080602 11:17411053-17411075 TCCTGAGCTGTTCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 310
1079080599_1079080602 -5 Left 1079080599 11:17411035-17411057 CCTGCCGTCTGGGCCTTCTCCTG 0: 1
1: 0
2: 1
3: 18
4: 252
Right 1079080602 11:17411053-17411075 TCCTGAGCTGTTCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 310
1079080591_1079080602 27 Left 1079080591 11:17411003-17411025 CCCAGCACTCTGCATTCCAGGTT 0: 1
1: 0
2: 0
3: 21
4: 256
Right 1079080602 11:17411053-17411075 TCCTGAGCTGTTCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 310
1079080597_1079080602 4 Left 1079080597 11:17411026-17411048 CCCAGGAAGCCTGCCGTCTGGGC 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1079080602 11:17411053-17411075 TCCTGAGCTGTTCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 310
1079080594_1079080602 11 Left 1079080594 11:17411019-17411041 CCAGGTTCCCAGGAAGCCTGCCG 0: 1
1: 0
2: 0
3: 24
4: 208
Right 1079080602 11:17411053-17411075 TCCTGAGCTGTTCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 310
1079080600_1079080602 -9 Left 1079080600 11:17411039-17411061 CCGTCTGGGCCTTCTCCTGAGCT 0: 1
1: 0
2: 2
3: 27
4: 307
Right 1079080602 11:17411053-17411075 TCCTGAGCTGTTCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079080602 Original CRISPR TCCTGAGCTGTTCCTCTGCC TGG Intronic
900547152 1:3235542-3235564 TCCAGAGCCCTTTCTCTGCCAGG - Intronic
902637986 1:17747631-17747653 TCCTGAGTTTTGCCTCTGCCTGG + Intergenic
902786092 1:18733634-18733656 TCTTGAGCAGAGCCTCTGCCTGG - Intronic
902820797 1:18942033-18942055 TTCTGAGCACTTCCTCTCCCCGG - Intronic
903004593 1:20290456-20290478 TCATGGGCAGGTCCTCTGCCGGG - Intergenic
903066563 1:20702955-20702977 CCCTGAGCTGCTCCTCTGTGTGG - Intronic
903446283 1:23424606-23424628 TCCTCAGCAGCTCCTCTTCCTGG + Exonic
904314002 1:29648282-29648304 GCATGTGCTGTTCCTCTGCCTGG - Intergenic
904541800 1:31238703-31238725 ACCAGAGCAGCTCCTCTGCCGGG - Intronic
905646490 1:39628143-39628165 AGCTGAGCTGTTCCTCTGTGGGG - Intronic
906104581 1:43284271-43284293 GCCCTAGCTGTTCGTCTGCCAGG - Intronic
906265784 1:44428250-44428272 TCCTGTTCTATGCCTCTGCCTGG + Intronic
907045617 1:51298436-51298458 GCCTGTGCTGCTCCTCGGCCCGG + Intronic
907774273 1:57498150-57498172 TCATGATCTGGTCCTCTTCCAGG - Intronic
908028126 1:59972280-59972302 TTCAGAGCTGCACCTCTGCCAGG + Intergenic
908112247 1:60909084-60909106 CCCTGGGCTGTTCCCCTGCTGGG - Intronic
909679646 1:78277598-78277620 TCCTCAGCTTCTCCTCTACCTGG + Intergenic
912877807 1:113379939-113379961 GCCTAAGCTCTCCCTCTGCCTGG - Intergenic
914343842 1:146781543-146781565 TTTTGGGCTGTCCCTCTGCCTGG - Intergenic
915291633 1:154888104-154888126 CCTTGTGATGTTCCTCTGCCTGG + Intergenic
916060646 1:161096420-161096442 TCCTAGGCAGTTCCTCTCCCAGG + Intergenic
916457811 1:164988912-164988934 TCCTAATATCTTCCTCTGCCTGG + Intergenic
916477832 1:165186577-165186599 TCCTGAGCAGAGCCTCTGCTGGG + Intergenic
918427594 1:184426268-184426290 TCATGATCAGTTCGTCTGCCAGG + Intronic
918439912 1:184556425-184556447 TCCTGTTCTTCTCCTCTGCCTGG - Intronic
919417974 1:197335100-197335122 GCATCTGCTGTTCCTCTGCCTGG - Intronic
920256750 1:204660619-204660641 TCTTGGGCTGCTCTTCTGCCTGG + Intronic
921811280 1:219517267-219517289 AAGTGAGCTGTTCCCCTGCCTGG + Intergenic
922804188 1:228377262-228377284 GCCCGAGCTGCTCCCCTGCCTGG + Exonic
924510201 1:244723797-244723819 TACTCCGCTGTTCCTCTGACTGG + Intergenic
924741288 1:246795486-246795508 TCCCCAGCTGCTGCTCTGCCTGG + Intergenic
1063737471 10:8776363-8776385 CTCTGAGCTGTCCCTTTGCCTGG + Intergenic
1064332713 10:14408802-14408824 TTCTGAGCTCTGCCTCAGCCAGG + Intronic
1064418398 10:15169139-15169161 GCCTGCGCGGTGCCTCTGCCTGG + Intergenic
1064789665 10:18942430-18942452 TCCTCATCTGTTCTTCTGCTTGG + Intergenic
1067142618 10:43669457-43669479 CCCTGAACTGATCCCCTGCCTGG - Intergenic
1067469202 10:46523796-46523818 ACCTCTGCTGCTCCTCTGCCAGG + Intergenic
1067828767 10:49597988-49598010 GCCTGGGCCCTTCCTCTGCCTGG - Intergenic
1068739072 10:60448433-60448455 TGCTTTTCTGTTCCTCTGCCAGG - Intronic
1069949618 10:72009937-72009959 TCCTGTCCTCTCCCTCTGCCAGG - Exonic
1070845839 10:79522246-79522268 CCCAGATCTGTTTCTCTGCCTGG - Intergenic
1070927955 10:80238072-80238094 CCCAGATCTGTTTCTCTGCCTGG + Intergenic
1072096687 10:92188491-92188513 TCCTGACCTTGTCATCTGCCAGG - Intronic
1073173652 10:101535620-101535642 TGCTGTGCTGCTTCTCTGCCTGG - Intronic
1073472377 10:103730955-103730977 GCCTGTGCTGGTCCCCTGCCTGG - Intronic
1073772029 10:106745183-106745205 TCCTGACCTCTTGGTCTGCCCGG - Intronic
1074363298 10:112839414-112839436 TCCTGGCCTTTCCCTCTGCCTGG - Intergenic
1075343796 10:121667595-121667617 TCCTGAGCTGGTCATGTGACTGG + Intergenic
1075909137 10:126108243-126108265 TCCTGAGCCGGGCCTCTCCCAGG - Intronic
1077159101 11:1104565-1104587 CCCTGAGCTGTCCCCCTGGCTGG + Intergenic
1078316983 11:10302696-10302718 ACTTGAGCTGTGGCTCTGCCAGG - Intergenic
1079019089 11:16894346-16894368 TCCTGCTCTGTTCCTCTAACTGG - Intronic
1079080602 11:17411053-17411075 TCCTGAGCTGTTCCTCTGCCTGG + Intronic
1080873887 11:36259725-36259747 GCATGCGCTGTCCCTCTGCCTGG + Intergenic
1081741402 11:45443478-45443500 TCCTGATGTGTTCATCTGCTAGG + Intergenic
1082017083 11:47497902-47497924 TCCTGTGCTTTGCCACTGCCTGG - Intronic
1084725421 11:70938737-70938759 GCATATGCTGTTCCTCTGCCTGG - Intronic
1084854970 11:71977713-71977735 TCCAGAGCTCTGCCTCTTCCAGG + Intronic
1086545331 11:87961211-87961233 TCCTCAGCTTTTACTCTGGCTGG - Intergenic
1088645015 11:111911108-111911130 TCCTGAGCTGTTCATCCCCATGG - Intronic
1089187686 11:116631335-116631357 TTCTGCGCTGTTCCTCTAACAGG + Intergenic
1089587441 11:119519480-119519502 AGCTGAGCTGTTCCCCTGCTGGG + Intergenic
1090385288 11:126354965-126354987 TTCTGAACTGTTCTTCAGCCTGG + Intergenic
1091683676 12:2545811-2545833 GCATGAGCTGTGCCTCTGCGAGG - Intronic
1091993790 12:4977149-4977171 TCCCGTGCTGTTCCTCAGCATGG + Intergenic
1092946977 12:13465725-13465747 TCCAGAGCTGTTCCTCAGTCTGG - Intergenic
1097521676 12:60678799-60678821 GCCAGAGCTGTTACTCTGGCTGG + Intergenic
1100175803 12:92029615-92029637 TCCTGGGATGTTCGTCTGCATGG - Intronic
1100616343 12:96234509-96234531 GCCTCAGCTGCTCCTCTGCACGG + Intronic
1102396289 12:112589031-112589053 GCATATGCTGTTCCTCTGCCTGG - Intronic
1102961351 12:117095453-117095475 ACAAAAGCTGTTCCTCTGCCTGG - Intronic
1105304958 13:19161783-19161805 GCCTTATCTGTTCCCCTGCCAGG + Intergenic
1108694724 13:52892986-52893008 GCCTGAGCTGGTCCTGGGCCAGG + Intergenic
1111718795 13:91915567-91915589 ACTTGAGCTGTTTTTCTGCCGGG + Intronic
1111897946 13:94164632-94164654 TACTGAGATCTTCCTCTTCCTGG + Intronic
1112594621 13:100796609-100796631 TCCTGGGATGTTCCTCCCCCTGG + Intergenic
1112726077 13:102306315-102306337 TCATGAGCTGCTCCACAGCCAGG - Intronic
1112991400 13:105517938-105517960 TCCTTAGCTTTTCCTCTCACTGG - Intergenic
1113795548 13:113055715-113055737 TCGTGAGCTGAGCATCTGCCAGG - Intronic
1113798622 13:113074965-113074987 GCCTGAGCTGGTCCTCTGGGTGG + Intronic
1114225585 14:20735174-20735196 GCCTGTGTTGTTTCTCTGCCTGG + Intronic
1114229833 14:20770759-20770781 GCCTGTGTTGTTTCTCTGCCTGG + Exonic
1115176625 14:30569428-30569450 TTCTGCCATGTTCCTCTGCCTGG + Intronic
1115256187 14:31404990-31405012 GCCTCAGCAGTTCTTCTGCCTGG - Intronic
1116806116 14:49495346-49495368 TCCTGAGCTGTGTTTCTCCCAGG + Intergenic
1116866785 14:50037933-50037955 CCCTGAGCTGTGCACCTGCCGGG + Intergenic
1119140325 14:72261529-72261551 TCCTGAGCTGTCCAGCTGCAGGG + Intronic
1121240938 14:92429668-92429690 TCCTGAGATGTGCATCTGCTGGG + Intronic
1121275774 14:92666699-92666721 TTCGGAGCTGGTCCTCTGCTGGG + Intronic
1121694982 14:95904850-95904872 TCCTGCGCAGGTCCTCAGCCAGG - Intergenic
1122635584 14:103128183-103128205 TCCTGAGCATGTCCTCTTCCAGG + Intronic
1122977077 14:105175166-105175188 GCCTGTGCGGTCCCTCTGCCAGG + Intronic
1124880703 15:33640016-33640038 TCCTGTGCTGCCTCTCTGCCAGG + Intronic
1126903910 15:53344017-53344039 TCCTGAGCTGTTGCCCCGTCTGG + Intergenic
1129682120 15:77663863-77663885 GCCTGAGCATTTCCTCTGCCAGG - Intronic
1130571154 15:85045059-85045081 GCACTAGCTGTTCCTCTGCCTGG + Intronic
1132584994 16:702233-702255 TCCTCCCCTGCTCCTCTGCCTGG + Intronic
1134752421 16:16636543-16636565 TCCTGAAATGTACCTTTGCCTGG + Intergenic
1134778520 16:16873911-16873933 TCCTGAGCTGTCACTTGGCCAGG - Intergenic
1136708037 16:32205911-32205933 ACCTGAGCTGTTTATCTGCTGGG - Intergenic
1136759873 16:32723501-32723523 ACCTGAGCTGTTTATCTGCTGGG + Intergenic
1136808231 16:33146885-33146907 ACCTGAGCTGTTTATCTGCTGGG - Intergenic
1138301389 16:55932671-55932693 GCCTGTGCATTTCCTCTGCCTGG - Intronic
1138767924 16:59626194-59626216 TACTGAGCTCTCTCTCTGCCTGG + Intergenic
1138803670 16:60066261-60066283 TCCTGAGCTCTGCCTATGGCTGG - Intergenic
1139990151 16:70933792-70933814 TTTTGGGCTGTCCCTCTGCCTGG + Intronic
1140215001 16:73000140-73000162 GCCTGCTCTGTTCTTCTGCCCGG - Intronic
1141029190 16:80572961-80572983 TTCTGGGCTGTTTCTCTTCCAGG + Intergenic
1141033271 16:80607859-80607881 TCCTGTGAGGTTTCTCTGCCTGG + Intronic
1141280187 16:82624336-82624358 TCCTGGGCTGTTCTGCTGGCAGG - Intergenic
1141309785 16:82902480-82902502 TGCTGAGCTGTGGCACTGCCAGG - Intronic
1141712747 16:85709550-85709572 TACTGAGCTGGGCCTATGCCGGG - Intronic
1141986850 16:87585719-87585741 TGCTGAGCTGTGCCCGTGCCAGG - Intergenic
1142230895 16:88899823-88899845 TCCTGAGCGTTTCCTCCCCCGGG + Intronic
1203062026 16_KI270728v1_random:983820-983842 ACCTGAGCTGTTTATCTGCTGGG + Intergenic
1143564403 17:7712667-7712689 GTCTGTGCTGTTCCTCTCCCTGG - Intergenic
1143887226 17:10073899-10073921 TCCTGAGATGTTACTCTGCCAGG - Intronic
1143954304 17:10656863-10656885 ACCTGGGCTGTACATCTGCCAGG - Intronic
1144179582 17:12739441-12739463 TAGTGAGCTGAACCTCTGCCTGG - Intronic
1144647785 17:16987279-16987301 CTCTGTGCTGTTCCGCTGCCTGG + Intergenic
1145260509 17:21351948-21351970 GCCTGTGCTGTTCCATTGCCTGG - Intergenic
1145270193 17:21400691-21400713 TGCTGAGCTGTTCGTGTGCTAGG + Intronic
1145308422 17:21688142-21688164 TCCTGAGCTGTTCATGTGCTAGG + Intergenic
1145813946 17:27782074-27782096 CCCGCAGCTGTTCCACTGCCCGG - Exonic
1145823982 17:27862708-27862730 GCTTGTGCTGTTCCCCTGCCTGG - Intronic
1145890873 17:28414776-28414798 TCCTGTGCTGTGCTGCTGCCTGG + Intergenic
1146073552 17:29706696-29706718 TCCAAAGCTGTTACTTTGCCTGG - Intronic
1146541993 17:33704030-33704052 TCCTGAACTTTGCCTGTGCCTGG + Intronic
1146989672 17:37257835-37257857 TCCTGAACTGTTCCTGAGCTGGG + Exonic
1147218323 17:38913612-38913634 TCCTGAGCTCTTACTGCGCCAGG - Intronic
1147424176 17:40337898-40337920 GCCTGGGCTGTCCCTCCGCCTGG - Intronic
1147424181 17:40337915-40337937 ACCTGGGCTGTCCCTCTGCCTGG - Intronic
1148678023 17:49456307-49456329 TCTTAGGCTGTTCCTCTGTCTGG - Intronic
1149467216 17:56889634-56889656 TCCTGAGCTGCACATTTGCCAGG + Exonic
1150005165 17:61464553-61464575 CACTGAGCTGTGCCACTGCCCGG - Intronic
1151546903 17:74798828-74798850 TCCTGAGATGTTCCCTAGCCTGG - Intronic
1151578115 17:74963000-74963022 TGCTGACCTGCTCTTCTGCCCGG - Exonic
1152830759 17:82495837-82495859 TCCCCAGCTCTTTCTCTGCCTGG - Intergenic
1154334128 18:13452396-13452418 TGCTGAGCTATCCCTCTGCCAGG - Intronic
1155036461 18:22028914-22028936 TCCTGACCTCGTCATCTGCCCGG - Intergenic
1156740979 18:40327394-40327416 TCTTAAGCTGTACCTCTGCATGG + Intergenic
1157275937 18:46311234-46311256 CCCAAAGCTCTTCCTCTGCCTGG + Intergenic
1158172752 18:54617754-54617776 TCCTGAGCTGTTTGGCTGCTGGG + Intergenic
1160836512 19:1127134-1127156 ACAGGTGCTGTTCCTCTGCCTGG + Intronic
1161505748 19:4642613-4642635 GCCTGAGCTGCTCTTCTCCCAGG - Intronic
1161742870 19:6034733-6034755 TCATGAGCTGTGCCACTGCGTGG + Intronic
1162029009 19:7909444-7909466 ACCTGAGGTGTCCCTCGGCCAGG - Intronic
1163099326 19:15084329-15084351 TCCTGACCTCATCATCTGCCCGG - Intergenic
1163266918 19:16227274-16227296 TCCTGAGCAGGTCCCCTGGCTGG + Intronic
1164766609 19:30777287-30777309 TCCTGAGCTGCACCCCTGCTGGG - Intergenic
1165257647 19:34589382-34589404 TCCTGAGCAAAACCTCTGCCAGG - Intergenic
1166084883 19:40467717-40467739 GCCAGAGCTGATCCTCGGCCTGG + Intronic
1166294517 19:41882610-41882632 TCCCCAGCTGTTGCTGTGCCTGG - Intergenic
1167859808 19:52273548-52273570 ACCTGGGCTGTCCCTCTGCCTGG + Intronic
1167868042 19:52344211-52344233 ATCTGGGCTGTTCCTCTGCCTGG + Intronic
1167922498 19:52793433-52793455 ACTTGAGCTGTCCCTCTGCCTGG - Intronic
924962660 2:47327-47349 TCCTAGGCTGATCCACTGCCTGG - Intergenic
924986555 2:276144-276166 GCACGTGCTGTTCCTCTGCCTGG + Intronic
924993885 2:339915-339937 ACCTCTGCTGTTCCACTGCCTGG - Intergenic
925999592 2:9319501-9319523 ACCTGCGCCTTTCCTCTGCCTGG - Intronic
926158966 2:10474833-10474855 TCCTGAGAGGCTCCTCAGCCAGG - Intergenic
926315570 2:11707333-11707355 GCATGAGCTGTTCCTCTGCCTGG - Intronic
928692255 2:33812088-33812110 TCCTGTGCTTTTCCTATGACTGG - Intergenic
931090077 2:58876316-58876338 TCCCCAGCTGTGCCTCTTCCAGG + Intergenic
932281175 2:70493313-70493335 ACCTGGGCTGTTCCACTGCATGG + Intronic
932431128 2:71674170-71674192 TCCTTCTCTGTTCCTCTTCCGGG + Intronic
933172698 2:79141248-79141270 AGCTGAGCTGTTCCTGGGCCGGG + Intergenic
935110388 2:100088524-100088546 TCCAGAGCTGTGCATCTGCCAGG - Intronic
936124587 2:109776680-109776702 TCCAGAGCTGTGCATCTGCCAGG + Intergenic
936220101 2:110594776-110594798 TCCAGAGCTGTGCATCTGCCAGG - Intergenic
936502599 2:113078039-113078061 TCCTGAGCAGTTTTTCTGCCTGG - Intergenic
937550047 2:123076851-123076873 TTCTGAGCTGTTTATTTGCCTGG + Intergenic
938693429 2:133813878-133813900 TCCTAATCTGTTCCTTTCCCTGG + Intergenic
939046695 2:137258410-137258432 ACCTGTGCTGTTGCTCTGTCTGG + Intronic
942910944 2:181243918-181243940 TCCAGAGTTATTCCTCAGCCTGG + Intergenic
942971301 2:181961403-181961425 TCTGGTGCTGTCCCTCTGCCCGG + Intronic
946388975 2:219404373-219404395 TGCTGAGCTTTTCCTGTGCCTGG - Intergenic
947105304 2:226662526-226662548 ACCTGTGTTTTTCCTCTGCCTGG + Intergenic
947237554 2:227958593-227958615 ACATAAGCTGTTTCTCTGCCTGG - Intergenic
948061548 2:235046124-235046146 TGCTATGCTGTTCCTCTTCCTGG + Intronic
948196616 2:236101541-236101563 GCCTTGGCTGTTCCTCTCCCTGG + Intronic
948308013 2:236964012-236964034 TCCTGAGCTCTCCCACTTCCAGG + Intergenic
1169368996 20:5014200-5014222 TCCTGAAATGTTCTTCTCCCAGG - Intergenic
1169489279 20:6057470-6057492 ACTGTAGCTGTTCCTCTGCCTGG + Intergenic
1170059504 20:12244601-12244623 TCCTGAGCTTCTCCTCTTCTTGG + Intergenic
1170683479 20:18547611-18547633 TCATCTGCTGTTCCTGTGCCTGG + Intronic
1170902101 20:20474222-20474244 GCCTGTGCTGTTACTCTGCCTGG - Intronic
1171026185 20:21632611-21632633 TCCTGAGCTGGGCCTTGGCCAGG + Intergenic
1172162027 20:32875421-32875443 TCCTCAGCTGGTCCACTGCAGGG - Intronic
1172774885 20:37401552-37401574 TCCTGCCCTGTCCCTCTGCCAGG - Intronic
1172863616 20:38077542-38077564 TCCTCTGCTATGCCTCTGCCAGG + Intronic
1173217034 20:41094606-41094628 TTCTCAGCTGGTCCTCTGCTGGG + Intronic
1173523427 20:43715399-43715421 GCATAGGCTGTTCCTCTGCCTGG + Intronic
1173700665 20:45068257-45068279 ACCTGAGCTGCTTCTCTGACAGG + Intronic
1173726078 20:45298693-45298715 TCCTGAGTCCTTCCTGTGCCAGG + Intronic
1175142035 20:56867824-56867846 GCATGTGCTGTTCCCCTGCCTGG - Intergenic
1175269737 20:57725403-57725425 GCCTTTGCTGTTCCCCTGCCTGG + Intergenic
1175319393 20:58074644-58074666 TCCCAAGCTGTTTCTCTGCAGGG - Intergenic
1175524400 20:59623706-59623728 ACATCCGCTGTTCCTCTGCCAGG - Intronic
1175749728 20:61486991-61487013 TCCAGGGCCCTTCCTCTGCCAGG - Intronic
1175953754 20:62597511-62597533 TCCTGAGCTTCGCCTATGCCAGG - Intergenic
1176025508 20:62983339-62983361 GCATGTGCTGTTCCCCTGCCTGG + Intergenic
1176262944 20:64192580-64192602 TCCTGAGCTGTCCACATGCCTGG - Intronic
1177362551 21:20091873-20091895 TCCTGACCTGGTGATCTGCCCGG + Intergenic
1178486931 21:33025388-33025410 TCCCTAGCTCTTCCTCTGTCTGG - Intergenic
1179597696 21:42453886-42453908 TCCCGAGCTGTGTCTCTTCCGGG + Intergenic
1181489681 22:23253842-23253864 GCCGGCGCTGCTCCTCTGCCCGG - Exonic
1182085270 22:27556916-27556938 TCCTGAGCTCTCCCTCCACCTGG + Intergenic
1182517404 22:30866926-30866948 TGTTCAGCTGTGCCTCTGCCTGG + Intronic
1183189624 22:36313484-36313506 GCCTGAGCTGTTCCTGTGTCTGG - Intronic
1184688780 22:46108202-46108224 CCCTGGCCTGTCCCTCTGCCAGG - Intronic
1184742350 22:46436298-46436320 TCCTGTGATGTGCCTCTGCTTGG - Intronic
949410006 3:3753540-3753562 TCCAGGGCTTTTCCTCTGGCTGG - Intronic
950003838 3:9678617-9678639 CCATGTCCTGTTCCTCTGCCTGG + Intronic
950206466 3:11084792-11084814 TCGGGAGCTGTCCCTCTGCCTGG + Intergenic
952413320 3:33068647-33068669 CCCTGGCCTGTTTCTCTGCCTGG + Intronic
953418841 3:42739452-42739474 CCCTGAGCTGCTCCTGTCCCTGG + Intronic
954188066 3:48935191-48935213 TCCTGTTATGTTCCTGTGCCAGG + Intronic
954928219 3:54256231-54256253 TCCTGAGGACTTCCTCTTCCAGG - Intronic
955745891 3:62140158-62140180 GCCTGCACTGTTCCCCTGCCGGG + Intronic
957162286 3:76625648-76625670 TCTGGAGCTTTTGCTCTGCCAGG - Intronic
961002793 3:123385142-123385164 TCCAGAGCTGTGCTTCTGCCTGG - Intronic
961038672 3:123661714-123661736 TCTTGCTCTGTTCCTCTCCCTGG - Intronic
961397308 3:126604304-126604326 TCCTGAGCTGTGGCTGTGACAGG - Intronic
961611684 3:128144679-128144701 TCCAGAGCTCTTCCCCTTCCTGG - Intronic
961792785 3:129388620-129388642 CCCTGACCTGTTCCTCTTCTTGG + Intergenic
962481062 3:135799243-135799265 TCCTTAGATGTTCATCAGCCTGG - Intergenic
964058817 3:152495510-152495532 TCCTTTCCTGTTCCTCTGGCCGG - Intergenic
964510522 3:157445392-157445414 TCCTGAGCTTCTGATCTGCCTGG - Intronic
964639579 3:158894323-158894345 TCCTGTGCTGTTCTTCTGATAGG - Intergenic
966152000 3:176875606-176875628 ACCTGAGCAGCTGCTCTGCCAGG + Intergenic
966851611 3:184168339-184168361 TCCTGAGCTGGGCCTCTGGGAGG - Intronic
967603978 3:191422308-191422330 CCCTGAGCTTTGCCTCTTCCTGG + Intergenic
969326507 4:6447402-6447424 TCCGGAGCTCTTCCTCCGCAGGG - Intronic
969392598 4:6901373-6901395 CCCTGTCCTGTTCCCCTGCCCGG - Intergenic
969596673 4:8152965-8152987 CCCTTGGCTGTGCCTCTGCCTGG - Intronic
969876465 4:10139288-10139310 TCCTTAGCTGTTCCTAAGCCTGG + Intergenic
971854181 4:32022907-32022929 TCCTTTGCTGTGCCTCTGCAAGG + Intergenic
972863572 4:43202271-43202293 TCCTGACCGCTTCATCTGCCTGG - Intergenic
973290770 4:48468166-48468188 CCAGGTGCTGTTCCTCTGCCTGG + Intergenic
973707775 4:53597224-53597246 TCCTGATCAGTCCCTCTTCCTGG + Intronic
973796707 4:54434636-54434658 CCCTGAGCTCGTCATCTGCCTGG + Intergenic
975437082 4:74365353-74365375 CCCTGCGCTGCTGCTCTGCCTGG + Exonic
976118164 4:81750608-81750630 TCACAAGCTGTTGCTCTGCCAGG - Intronic
976402742 4:84625551-84625573 TGCACAGCTGTTCCTCCGCCTGG - Intronic
976526795 4:86101545-86101567 CCCTGATCTGTTCTTCTGTCAGG - Intronic
979670332 4:123354551-123354573 TCCTGAACTCTTCCTGTGTCTGG + Intergenic
984108198 4:175576507-175576529 TCATGAGCTGTGCCTTTGCTTGG - Intergenic
985926889 5:3026114-3026136 TGCTGAGCTGACCCTCGGCCTGG - Intergenic
985969226 5:3362120-3362142 TCCTGAGCTCTTCTCCTCCCAGG - Intergenic
986253373 5:6081493-6081515 TCCTCTGCTGCTCCTTTGCCAGG + Intergenic
989559424 5:42834324-42834346 TCTTGACCTGTTGATCTGCCTGG - Intronic
990732264 5:58822423-58822445 ACCTGCGCTTTTTCTCTGCCTGG + Intronic
993398472 5:87420031-87420053 CCCTGAGCTGGTTCTCTACCTGG + Intergenic
994335101 5:98555513-98555535 TACTGAGCTATTCCTCAGACAGG + Intergenic
994748354 5:103707276-103707298 ACCTGAGCTGTTCCTTTCTCTGG + Intergenic
997792761 5:136776676-136776698 TTCTCAGTTGTTCCTCTGCTGGG + Intergenic
998443566 5:142181415-142181437 CCCTGAGCTGGACCCCTGCCAGG + Intergenic
999143260 5:149376813-149376835 CTCTGAGCTGTTCCTCAGCTGGG + Exonic
999315201 5:150579150-150579172 TCCAGAGCTGTGGCTGTGCCTGG - Intergenic
999420419 5:151437043-151437065 TCCAGAGCTCTTCATCCGCCTGG + Intronic
999716891 5:154368257-154368279 TCCTGAGCTCCTGCTGTGCCAGG - Intronic
1000299203 5:159940029-159940051 TACTGAGTTGTCCCTGTGCCAGG - Intronic
1000306105 5:159996055-159996077 TCATAAACTGTTCCTCTCCCTGG + Intergenic
1002400027 5:178986499-178986521 GCCTGAGCTGGTCCTCCCCCTGG - Exonic
1004843531 6:19613796-19613818 TGGAGAGCTGTCCCTCTGCCCGG - Intergenic
1005871213 6:29975438-29975460 TCCTGGGCTGTTCCTGTGAATGG - Intergenic
1006337342 6:33427679-33427701 TCCTGGGCTCCTCCTCTGCTGGG + Intronic
1006835130 6:36993846-36993868 TCCTGACCTGGTGATCTGCCTGG + Intergenic
1007782308 6:44261655-44261677 GAGTGAGATGTTCCTCTGCCTGG + Exonic
1008960433 6:57260716-57260738 TCCTGGGATGTTTGTCTGCCCGG - Intergenic
1009797645 6:68492543-68492565 TCATGAGCTGTTCCATTGACTGG - Intergenic
1012547310 6:100434247-100434269 TCCTGAGCTGTAACCCTGCAAGG + Intronic
1012622247 6:101359893-101359915 TCCTTAGCTGTTCCTCTTCAAGG - Intergenic
1013595971 6:111661633-111661655 TCCTGGGCGGTTCCGCTGCTGGG + Exonic
1014635315 6:123839038-123839060 TCTTGAGCTGTTCTGCTTCCTGG - Intronic
1015912138 6:138179506-138179528 TCCCTAGCTGACCCTCTGCCTGG + Intronic
1017114100 6:150960674-150960696 TCCTGATCTCTGCTTCTGCCTGG + Intronic
1017873327 6:158503890-158503912 GCCTGAGCTGTTCATCAGCGGGG + Exonic
1019215974 6:170444107-170444129 TTCTGAGCTGCTCCTTGGCCAGG - Intergenic
1019311681 7:364961-364983 TCCTGAGCTGTACATCAGCTGGG + Intergenic
1019751701 7:2734855-2734877 TGCAGAGCTGGGCCTCTGCCTGG - Intronic
1021253225 7:18357725-18357747 TCATACTCTGTTCCTCTGCCTGG - Intronic
1022200075 7:28108172-28108194 TCCTCAGCCCTTGCTCTGCCAGG + Intronic
1022494194 7:30843094-30843116 TCCTGAGCTGGTTCACAGCCAGG + Intronic
1023551306 7:41372695-41372717 TGCTTTGCAGTTCCTCTGCCTGG + Intergenic
1024548069 7:50538903-50538925 GTCTGTGCTGCTCCTCTGCCAGG - Intronic
1026191632 7:68133721-68133743 TCTTGCTCTGTTCCTCTGGCTGG - Intergenic
1026370670 7:69695297-69695319 TCTTGATCTGTTGCTCAGCCTGG - Intronic
1026933301 7:74237319-74237341 AAGTGAGCGGTTCCTCTGCCAGG + Intronic
1029126855 7:98300663-98300685 TCCTGAGCAGTGCCTGTGCTGGG - Intronic
1029365619 7:100114268-100114290 GCCTGCCCCGTTCCTCTGCCAGG - Exonic
1029689392 7:102170939-102170961 TCCTGAACTGTTCCTCATCTTGG - Intronic
1030569173 7:111200745-111200767 CCATGAACTGTTTCTCTGCCAGG - Intronic
1035514609 8:221981-222003 TCTTGTGCTGTTCCTCAGGCTGG - Intergenic
1036617182 8:10397429-10397451 TGCAGACCTCTTCCTCTGCCAGG - Intronic
1038664149 8:29522908-29522930 CCCTGAGCGGTGCCTCTGCCAGG + Intergenic
1040598506 8:48862523-48862545 TCCCAAGCTGTTTCTCTACCTGG - Intergenic
1040963517 8:53061054-53061076 ACATGTGCTGTTCCTCTGCCTGG - Intergenic
1042178381 8:66059994-66060016 TGCTGGGCTGTACCTCTGGCAGG + Intronic
1042778274 8:72460190-72460212 TCCTGAGGTTTTTCTTTGCCAGG + Intergenic
1043558631 8:81464162-81464184 TCCTGACCTGGTCCTATGACAGG + Intergenic
1044967230 8:97585339-97585361 TCATTAGCTGGTCCTCTGCTGGG - Intergenic
1045460250 8:102419184-102419206 GCCTGTGTTGTTTCTCTGCCTGG + Intergenic
1046029247 8:108763783-108763805 TCCAGAGTTATTCCTCAGCCTGG + Intronic
1046360736 8:113151915-113151937 TTCTGAGCTGTTCTTCAGACTGG - Intronic
1046662473 8:116963053-116963075 TCCTGACCTCTTCCACTCCCAGG - Intronic
1047216323 8:122879046-122879068 TCCTAAGCTGTTTCCCTGCAGGG + Intronic
1047628968 8:126684968-126684990 TCAGGAGCTATTCCTATGCCTGG - Intergenic
1047692742 8:127372959-127372981 GCCTTTGCTTTTCCTCTGCCTGG - Intergenic
1048863389 8:138740568-138740590 TCAGGAGGTGTTCCTGTGCCAGG + Intronic
1052062500 9:23978014-23978036 TCCTGGGTTGTTACTCTTCCAGG + Intergenic
1053131328 9:35617393-35617415 TCCTGAGTTCCTCCTCTGCCCGG + Intronic
1055804144 9:80074357-80074379 TACTGAACTGCTTCTCTGCCAGG - Intergenic
1057016988 9:91660734-91660756 CCCAAAGCTGTTTCTCTGCCTGG + Intronic
1057095227 9:92300969-92300991 ACCTGACCTGTTCCTCACCCAGG - Intronic
1057490419 9:95516157-95516179 CCCGGAGCCGTTCCTCAGCCGGG + Intronic
1057719966 9:97524251-97524273 TCCTCAGCTCTTCCTCTGTTAGG - Exonic
1059399443 9:114059632-114059654 GCCTCAGCTGTTTCTCTGCATGG - Intergenic
1059727329 9:117022082-117022104 TCCTGCTCTGGTCCTCAGCCAGG + Intronic
1060198766 9:121639895-121639917 TCCTGGGCTGTTCCCCAGACTGG + Intronic
1061204661 9:129156080-129156102 TACTGAGCACTTGCTCTGCCAGG + Intergenic
1061661652 9:132134184-132134206 ACCTGAGCTCTTCCTCTGAAAGG + Intergenic
1061782903 9:133006330-133006352 ACCTGCTCTGTTTCTCTGCCTGG - Intergenic
1061993757 9:134173824-134173846 TGCTGGGCTCTTCCTCTGGCCGG - Intergenic
1062059749 9:134488778-134488800 TCCTGCCCTGTTGCCCTGCCTGG + Intergenic
1185828870 X:3279567-3279589 TCTTGCTCTGTTCCTCTGGCTGG + Intronic
1187309988 X:18132756-18132778 TCTTGAGCTGTTCCTCCAGCTGG - Intergenic
1187818139 X:23255856-23255878 GCCTGAGCAGCTGCTCTGCCAGG - Intergenic
1188797280 X:34482018-34482040 TCATGAGCTATCCTTCTGCCAGG + Intergenic
1192505176 X:71676758-71676780 TAGTGAGGTGTGCCTCTGCCCGG + Intergenic
1193112468 X:77743453-77743475 TCCTGCACTGTTTCTCAGCCAGG - Intronic
1194983572 X:100465877-100465899 TCCTGACCCTTTCCCCTGCCTGG + Intergenic
1195975181 X:110519244-110519266 TCCTGTGCTGTTTCTCTACTTGG - Intergenic
1196970479 X:121102610-121102632 TGCTCAGCTTTTCCTCTGCTTGG - Intergenic
1200247352 X:154533250-154533272 CCCTGAGCTGGGCCTCTGGCAGG - Intronic
1202369168 Y:24185726-24185748 TCCTGTTCTGTGCCTTTGCCAGG + Intergenic
1202501617 Y:25484391-25484413 TCCTGTTCTGTGCCTTTGCCAGG - Intergenic