ID: 1079081393

View in Genome Browser
Species Human (GRCh38)
Location 11:17415723-17415745
Sequence CTGCACAAACAGCTGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079081386_1079081393 27 Left 1079081386 11:17415673-17415695 CCTCTGCATTCAGGTTGGAATGA 0: 1
1: 0
2: 0
3: 17
4: 189
Right 1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG 0: 1
1: 0
2: 1
3: 25
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079081393 Original CRISPR CTGCACAAACAGCTGGGGCA AGG Intronic
900151756 1:1181980-1182002 GTGCACACAGAGCTGGGGCAGGG + Intronic
900471254 1:2856149-2856171 CTGCAGGCACAGCCGGGGCAGGG - Intergenic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900653029 1:3740277-3740299 CTGCACAGACAGCTGCGACCAGG - Intergenic
900805046 1:4762215-4762237 CTGCACACACAGCTAAGACATGG - Intronic
902391056 1:16106762-16106784 CAGCACTACCAGCTGTGGCAGGG + Intergenic
902437403 1:16407383-16407405 CTGCTCAAGGAGGTGGGGCAGGG + Intronic
903577820 1:24350139-24350161 CTGAGCAACCAGCTGGGGGAGGG - Intronic
903792497 1:25904710-25904732 CTGCACAATCAACTGGGATAAGG + Exonic
904430353 1:30460228-30460250 CTGCACACCCAGCTGGGAGAAGG + Intergenic
905402904 1:37716296-37716318 CTGCAGAAACAGCTGGGGTAGGG + Exonic
908024539 1:59936716-59936738 CTGCACAAACATCAAGGGCCAGG + Intergenic
908490798 1:64642233-64642255 CTGAAAAAAAAGGTGGGGCAGGG - Intronic
911102334 1:94104584-94104606 CTGTCCATGCAGCTGGGGCAGGG + Intronic
911136511 1:94446258-94446280 CGGCACTACCAGCTGTGGCAGGG - Intronic
911371945 1:97004367-97004389 CTGCATGAATAGCTGGGGCTGGG + Intergenic
912241538 1:107915321-107915343 TTGCATTAAAAGCTGGGGCAAGG - Intronic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
913616537 1:120565612-120565634 TTGCACAAACAGGTGGGGGCTGG - Intergenic
914069659 1:144276195-144276217 CTGTACCAGCAGCTGGCGCAGGG - Intergenic
914109496 1:144690159-144690181 CTGTACCAGCAGCTGGCGCAGGG + Intergenic
914573740 1:148945299-148945321 TTGCACAAACAGGTGGGGGCTGG + Intronic
914878650 1:151530735-151530757 CTGAACAAGGAGGTGGGGCATGG + Exonic
915111221 1:153565708-153565730 CTCCACCACCAGCTGGGGGAGGG + Exonic
915197331 1:154199493-154199515 CTTTTCAAACAGCTGGTGCAGGG + Exonic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
916477315 1:165182790-165182812 CTCCACAAATATCTAGGGCAGGG - Intergenic
916573647 1:166048597-166048619 CTGCAGCATGAGCTGGGGCAAGG + Intergenic
917036263 1:170750458-170750480 TTGCACAAACAGCAGGGAGAGGG - Intergenic
918116795 1:181504675-181504697 AAGCACAGAAAGCTGGGGCAAGG - Intronic
919186842 1:194161937-194161959 TTGCACTAACAGCTAGGCCATGG + Intergenic
919631407 1:199963568-199963590 CTACTCAAAAGGCTGGGGCACGG - Intergenic
920691933 1:208153840-208153862 CAGAACAGACAGCTGGGGGAGGG + Intronic
923255871 1:232220942-232220964 AGGCACACACAGCTGGGCCATGG + Intergenic
924706296 1:246505533-246505555 CTGCAAAAGTAGCTGGGGCTGGG - Intronic
1063345372 10:5307054-5307076 CTTCCCAAGCAGCTGGGGCTAGG - Intergenic
1063370948 10:5522976-5522998 CTGCACACACAGCTTGCTCAAGG - Intergenic
1063535265 10:6876832-6876854 CTGCGCACACACCTGGGGCTGGG + Intergenic
1064719247 10:18212044-18212066 CTGTACAAACACCTGAGGCCTGG - Intronic
1064771028 10:18722981-18723003 CTCCACACACAGGTGGGACAAGG + Intergenic
1065033259 10:21610189-21610211 CTCTACTAAAAGCTGGGGCAGGG + Intronic
1067966939 10:50923632-50923654 CTGCACAAACAGCAAGGCCCTGG + Intergenic
1068566234 10:58578789-58578811 CTGCACACACAGGTGGGAGAGGG - Intronic
1069411103 10:68154336-68154358 CTGCTGAAGCAGCTGGGGCCAGG - Intronic
1071510532 10:86259700-86259722 CTGCACAAATGGCAGGGGCAGGG + Intronic
1072796697 10:98361520-98361542 CTGCTCAGAGAGCTGGGGTAAGG + Intergenic
1072807584 10:98434206-98434228 CTGCCCACACAGCTGGGAAAGGG + Intronic
1073206032 10:101769925-101769947 CTGCACCCCCAGGTGGGGCAGGG - Intergenic
1074980229 10:118613690-118613712 CGGCACTACCAGCTGTGGCAGGG + Intergenic
1075099264 10:119494444-119494466 CTTCACACACAGCTGGAGCCAGG - Intergenic
1075173129 10:120134373-120134395 CTGAACATGCAGCAGGGGCATGG + Intergenic
1075461380 10:122618674-122618696 CAGCACAGATAGCAGGGGCAGGG + Intronic
1075712857 10:124540123-124540145 CTGCATGAACGGCTGGGCCAGGG - Intronic
1075815193 10:125259736-125259758 CTGCACCCACAGGAGGGGCAGGG + Intergenic
1076115107 10:127890033-127890055 CTGCACTCACTGCTGGAGCATGG - Intronic
1077110028 11:858269-858291 ATGCACCAGCAGCTGGGGGATGG - Intronic
1077288524 11:1778249-1778271 CTGCACCAAGACATGGGGCAAGG - Intergenic
1078545510 11:12244183-12244205 CTGCACAAACATCTTGAGCCTGG + Intronic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1079369904 11:19842665-19842687 CTCCAGGGACAGCTGGGGCAAGG - Intronic
1080735792 11:35012562-35012584 CTTCTCAACCTGCTGGGGCATGG - Intronic
1081032179 11:38098084-38098106 CTGCACAAACAGCAAGGCCCTGG + Intergenic
1082825173 11:57572270-57572292 CTGCACAAGCACCTGAGGAAAGG - Intergenic
1083679067 11:64342960-64342982 CTGCACAAAGGGCGGGGCCAGGG + Intronic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1084033324 11:66493589-66493611 CTGCACGAGCTGCTGGGCCATGG + Exonic
1084155874 11:67312201-67312223 CTGCACACTCACCTGTGGCACGG + Exonic
1084294905 11:68206560-68206582 CTGCTCACACTGCTGGGGTAAGG - Intronic
1084978661 11:72816875-72816897 CAGCACAGGCAGCAGGGGCAGGG - Intronic
1089033697 11:115361846-115361868 CTGCCCAAGTAGCTGGGACATGG + Intronic
1093973862 12:25400253-25400275 CTCCACAAATCGCTAGGGCAGGG - Intergenic
1094571425 12:31644554-31644576 CTGCACATACAGCGGTGCCAGGG + Intergenic
1102199656 12:111048561-111048583 CTGGACATAGAGCTGGTGCAAGG + Intronic
1103150615 12:118635508-118635530 CAGCACAAACACCTGGCACATGG - Intergenic
1103806472 12:123577546-123577568 CAGGACAAACAGCTGGCACATGG - Intergenic
1104989631 12:132618553-132618575 CTGGACCAAGAGCTGGGGCTGGG + Intergenic
1105450168 13:20492576-20492598 TGGCAGAAACAGGTGGGGCAGGG - Intronic
1107561252 13:41559277-41559299 CTGAACAAATAGCTGTGGGATGG - Intergenic
1107862414 13:44673462-44673484 GTGCACCAACTGCTGGGGCTTGG - Intergenic
1108279787 13:48849997-48850019 CTGCAAAATCATCTGCGGCATGG + Intergenic
1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG + Intergenic
1111474097 13:88724271-88724293 CTGCACAAAGCACTGGGCCAAGG - Intergenic
1111559891 13:89931315-89931337 CATCTCAAACAGCTGGGGGAAGG + Intergenic
1114661588 14:24349356-24349378 CTCCACAAACAGCTGTGGTGTGG + Intergenic
1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG + Intergenic
1117715344 14:58574460-58574482 CTGCAAAAACTGCTGAGACAAGG + Intergenic
1118648753 14:67867745-67867767 GTCCAGAAACAGCTGGGGCTGGG - Intronic
1119193860 14:72702627-72702649 CTGCAGAACCATCTGGGGGATGG + Intronic
1121230449 14:92353866-92353888 CGGCACAGGCAGCTGGGACAGGG - Intronic
1122075089 14:99230712-99230734 CGGCACAAACAGCTGTGTCTGGG + Intronic
1122137545 14:99643658-99643680 CTGCACAGACAGCTGGGAATAGG - Intergenic
1122169770 14:99862779-99862801 CAGCACGTACGGCTGGGGCAGGG - Intronic
1122347920 14:101071860-101071882 CTGTACAAACAGTTGGGGAGGGG + Intergenic
1123132339 14:105998964-105998986 CTGCACAAACAGCCGATGAAAGG + Intergenic
1123582556 15:21730076-21730098 CTGCACAAACAGCCGATGAAAGG + Intergenic
1124107600 15:26754776-26754798 CTGCACACACCTCTGGGGTAAGG - Intronic
1125674619 15:41495438-41495460 CCGCACAATCGGCTGGGACAAGG + Intronic
1127956504 15:63858501-63858523 CTTCACAACCACCTTGGGCAAGG + Intergenic
1128483052 15:68055477-68055499 CTACACAAGCAGTTGGGGGAGGG + Intronic
1129454428 15:75669191-75669213 CTGGACAAGCAACTGGGGCAAGG - Intergenic
1130801570 15:87269200-87269222 CTCCACAAATAGCTGGAGTATGG + Intergenic
1131735511 15:95327100-95327122 CTGCACAAAAGGATGGGGCTTGG + Intergenic
1132700722 16:1220958-1220980 CTGCACCACCCCCTGGGGCAGGG - Exonic
1134270797 16:12731416-12731438 CAGCAGAGACTGCTGGGGCATGG + Intronic
1136275390 16:29176759-29176781 CTGCACATCCAGGTGGGGCTGGG - Intergenic
1137467687 16:48725803-48725825 CTGCAGAAACTGCTGGGACCAGG + Intergenic
1139424285 16:66869534-66869556 GTGAACACACAGCTGGGGGAGGG + Intronic
1139706950 16:68747343-68747365 CTGCAGAGGCAGCTGGGCCAGGG + Intronic
1140094626 16:71864292-71864314 CTGTTTAAAAAGCTGGGGCAGGG - Intronic
1141769327 16:86079696-86079718 CCCCACAAACAGCTGAGACAAGG + Intergenic
1141770968 16:86089472-86089494 CTGCACACGGAGCTGGGGTATGG - Intergenic
1142079750 16:88142824-88142846 CTGCACATCCAGGTGGGGCTGGG - Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1143348767 17:6271260-6271282 CAGCACCTACAGCTGGGGCCAGG - Intergenic
1147243716 17:39107370-39107392 CTGCAGAGACAGCTGGGTCTTGG - Intronic
1147601861 17:41751662-41751684 CTGCAAAGACAGCTGGGAAATGG - Intergenic
1150602365 17:66661902-66661924 CTGCAGAAAAAGCTGCCGCAGGG - Intronic
1150650740 17:67008464-67008486 CTGGGCAAAGAGCTGAGGCATGG + Intronic
1150665419 17:67131376-67131398 CTTCACAAAAAGCTGGAGCTTGG + Intronic
1151665539 17:75543316-75543338 CGGCCCAAACAGGTGGAGCAGGG - Intronic
1151678547 17:75612379-75612401 CTGCACATACAGGTTGGACATGG + Intergenic
1151807733 17:76417024-76417046 CAGCACACACAGCTGGGGAGTGG - Intronic
1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG + Intronic
1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG + Intronic
1153234926 18:2976909-2976931 AATCACAAACAGCTGGGGCTGGG + Intronic
1153263836 18:3248266-3248288 CTGCAACAACAGCTGCAGCAGGG - Intronic
1154428877 18:14293286-14293308 CTGCACACAGAGGTGGGTCATGG - Intergenic
1155163157 18:23211701-23211723 ATGCACCAGCAGGTGGGGCAGGG - Intronic
1156488789 18:37484374-37484396 CTGAAAAAACAACTGGGGAATGG + Intronic
1157430320 18:47619407-47619429 CTGCAGAAACAACAAGGGCACGG - Intergenic
1158457623 18:57621955-57621977 CTGCACAAACGCGTGGGGCGGGG - Exonic
1159314596 18:66755421-66755443 CTGCACAAACAGCTGATGAGCGG + Intergenic
1160538726 18:79609242-79609264 CTGCACCAACAGCTGGGCCCAGG + Intergenic
1160657812 19:282299-282321 CTGCACATACAGCTGGAGTGGGG + Exonic
1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG + Intronic
1161849455 19:6731100-6731122 CTCCACCAAGAGCTGGGGGACGG + Exonic
1162283127 19:9716488-9716510 CAGCACTACCAGCTGTGGCAGGG + Intergenic
1162524478 19:11199435-11199457 CAGCACAGACAGCTGAGGCCCGG + Exonic
1162828139 19:13266947-13266969 CTGCAAGAACTGGTGGGGCATGG + Intronic
1163241067 19:16064285-16064307 CAGCCTGAACAGCTGGGGCAGGG + Intergenic
1163506391 19:17709594-17709616 CTTCACAACCACCTGGGGCATGG - Intergenic
1165059001 19:33195703-33195725 AGGCTCACACAGCTGGGGCAAGG - Intronic
1166053852 19:40277097-40277119 CTTCACACACAGCTGGGGACAGG + Intronic
1167744069 19:51340701-51340723 CTGAACCGACAGCTGGGGTAGGG + Exonic
1168271700 19:55253469-55253491 CTCCCCAGACAACTGGGGCAGGG + Intronic
926646408 2:15294462-15294484 ATGCACTAAGAGCTGGGGCACGG - Intronic
927041582 2:19235986-19236008 CTTCACAAACACCTGGGGCCAGG - Intergenic
928091615 2:28378067-28378089 CTGCACACACAGGTGTGCCAGGG + Intergenic
928702919 2:33917461-33917483 TGGCACAACCAGCTGTGGCAGGG + Intergenic
930811224 2:55543680-55543702 CTGTACAAACAGCAGAAGCATGG + Intronic
930858480 2:56044385-56044407 CTGGACAGACAGCTGGGTCAGGG + Intergenic
936631658 2:114209751-114209773 CTGAACAAACAGTAGGTGCATGG - Intergenic
937633834 2:124133469-124133491 CTGGTCACACAGTTGGGGCAAGG + Intronic
938099833 2:128491135-128491157 CTGCACAAACCCCTGGGCTAAGG - Intergenic
938107945 2:128546036-128546058 CTGCACCCACAGCTTGGGCGAGG + Intergenic
947820252 2:233064128-233064150 CTGCAGGAGCAGCTGGGGCCCGG + Intronic
947821620 2:233075358-233075380 CACCACAAAGAGCTGGGGAAGGG + Intronic
948433529 2:237936287-237936309 CAGCACACACAGCCTGGGCACGG + Intergenic
1169195154 20:3678856-3678878 TGGCACAAACAGATGGGGCATGG + Intronic
1169202660 20:3720348-3720370 CTGGACACACAACTGAGGCAAGG - Intergenic
1169343546 20:4813366-4813388 CTGTGCAGACAGCTTGGGCAGGG - Intronic
1171255465 20:23686375-23686397 CCCCTCAAAGAGCTGGGGCATGG + Intronic
1171262807 20:23748297-23748319 CCCCTCAAAGAGCTGGGGCATGG + Intronic
1171271936 20:23824501-23824523 CGCCTCAAAGAGCTGGGGCATGG + Intronic
1171275816 20:23855803-23855825 CCCCTCAAAGAGCTGGGGCATGG + Intergenic
1171429961 20:25076832-25076854 TTGCACAAACAGGTGGGGGAGGG - Intronic
1171482839 20:25467000-25467022 CTCCACAAGCAGCTGGGCCTCGG + Intronic
1172899811 20:38326317-38326339 CTGCACAGACAGGTGTGGCGGGG - Exonic
1176672140 21:9744859-9744881 GTGCACAAACAGCTGGGGGGGGG + Intergenic
1176845894 21:13876139-13876161 CTGCACACAGAGGGGGGGCATGG + Intergenic
1176848627 21:13895682-13895704 CTGCACACAGAGGGGGGGCATGG + Intergenic
1179039702 21:37791410-37791432 CTGCACATTGAGCTGGGGCCAGG + Intronic
1179064648 21:38013741-38013763 CTCTGCACACAGCTGGGGCATGG - Intronic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1180085296 21:45505467-45505489 CTGCAGAACCAGCCAGGGCACGG - Intronic
1181848920 22:25735852-25735874 CTGCAGGAACAGCTGGCTCAAGG - Intergenic
1181924910 22:26350520-26350542 TTGCCCAAAGAGGTGGGGCACGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183554285 22:38513129-38513151 CTGCAGAAACAGCCTGGGCATGG + Intergenic
1184148203 22:42623712-42623734 CGCCACAAACAGCTGGGCAAAGG + Intronic
950767794 3:15286286-15286308 CGGCACAAACTGGTGTGGCAGGG + Intronic
951196470 3:19828616-19828638 CGGCACACCCAGCAGGGGCATGG - Intergenic
951340082 3:21474927-21474949 CTGTACAAACAGCTAGAGAAAGG - Intronic
952946604 3:38482133-38482155 ATACACACACAGCTGGGACATGG - Intronic
954289281 3:49640868-49640890 CTGTACAACAAGCTGGGCCAGGG + Intronic
954807459 3:53228877-53228899 CTACACGAACACCAGGGGCAAGG + Intronic
961651569 3:128419204-128419226 GTGCACAAAGAAGTGGGGCACGG + Intergenic
963564213 3:146907358-146907380 CTGCACAAACACCCGTGGTAAGG + Intergenic
963874602 3:150461286-150461308 CTAAACAATCAGCTGGGGGAAGG - Exonic
966761495 3:183423215-183423237 CAGTACCAACAGCTGAGGCATGG + Intronic
967289663 3:187906597-187906619 CAGCACAGACAACAGGGGCAGGG + Intergenic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
969338131 4:6523600-6523622 CTGCACACACTGCTGGGGGCAGG + Intronic
970922643 4:21413006-21413028 CTGCACATAACCCTGGGGCAAGG - Intronic
977475292 4:97499786-97499808 CAGCAGAAACAGCTAGTGCAAGG + Intronic
979398989 4:120224497-120224519 CTGGACAAACAGATGGGGCGGGG - Intergenic
982278199 4:153658471-153658493 CGGCACCGACAGCTGGGGCCTGG + Intergenic
984160106 4:176241973-176241995 CTGCACATACACCTGGGACGCGG + Intronic
984259886 4:177432280-177432302 ATGCTCAAACACCTGGGGGAGGG + Intronic
985402596 4:189606989-189607011 GTGCACAAACAGCTGGGGGGGGG - Intergenic
985427065 4:189841348-189841370 CTGCATAAACACCAGGGGAAAGG - Intergenic
989823651 5:45827306-45827328 CTGTAACTACAGCTGGGGCAGGG + Intergenic
991082789 5:62619561-62619583 CTGCACAAACAGGCCGGGCGTGG + Intronic
992676329 5:79109802-79109824 CTGCAACAGCAGCTGGGGAAAGG + Intronic
996791107 5:127294019-127294041 CAGCATATACAGCTGGGTCATGG - Intronic
997979205 5:138458656-138458678 CTGCACACTCAGCTGGGGGTAGG + Intergenic
1001046848 5:168380313-168380335 ATACAGAATCAGCTGGGGCATGG + Intronic
1001673106 5:173490852-173490874 CCCCAGAGACAGCTGGGGCATGG + Intergenic
1002469942 5:179429124-179429146 CTGCACTGGCAGCTGGGCCAGGG + Intergenic
1003013692 6:2450789-2450811 TAGCACAAGCAGGTGGGGCATGG + Intergenic
1003497062 6:6673422-6673444 CTAGACAGACAGATGGGGCAGGG - Intergenic
1006047125 6:31307822-31307844 CTGCTCAGACACCTGGAGCATGG - Intronic
1006373186 6:33657764-33657786 CAGCACCAAGAGCTGGGGCAGGG + Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006515692 6:34544452-34544474 CAGCCCAAACAGCAGCGGCATGG - Exonic
1007211164 6:40194405-40194427 CAGCAGAAACACCTGGGGAAGGG + Intergenic
1013256110 6:108387402-108387424 CTGCACATACACCTGGGCTATGG + Intronic
1014740935 6:125147014-125147036 CTACACAGAAAGGTGGGGCAAGG + Intronic
1015592941 6:134839834-134839856 CTGAGACAACAGCTGGGGCATGG + Intergenic
1015804204 6:137092150-137092172 CTGCAGCAACAACAGGGGCAAGG - Intergenic
1016403560 6:143706213-143706235 CTGCTTCAAGAGCTGGGGCATGG - Intronic
1018071460 6:160167834-160167856 TTCCACCCACAGCTGGGGCACGG + Intergenic
1018295976 6:162344542-162344564 CTGCCCTCACAGCTGGGTCAGGG + Intronic
1019224714 6:170500401-170500423 TTTCAGAAACAGCAGGGGCAGGG - Intergenic
1019307396 7:342328-342350 CAGCACCAACCGCTGGGGCCTGG - Intergenic
1019994171 7:4712792-4712814 CTGCTCAAACAGCCAGGGCAGGG + Intronic
1022482366 7:30752436-30752458 CTGCCCAAAGAGAGGGGGCAGGG - Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023761376 7:43467999-43468021 CTGCACCCAGGGCTGGGGCATGG - Intronic
1024707455 7:51975793-51975815 CTCCACAACCAGCTGTGTCAAGG - Intergenic
1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG + Intergenic
1026327146 7:69320601-69320623 CTGAACAGACTGCTGGGCCATGG - Intergenic
1026333256 7:69371780-69371802 GTGCACAAACACCTGGGTCTAGG - Intergenic
1027225923 7:76243672-76243694 CCCCACAAGCAGCTGGGGAATGG + Intronic
1027611145 7:80362214-80362236 CTGCATAAACAGCTGGCTCTTGG - Intergenic
1027745456 7:82068257-82068279 CTACAAAAATATCTGGGGCAGGG - Intronic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1035351983 7:158253500-158253522 CTGCAAAACCATCTAGGGCAGGG + Intronic
1038805864 8:30790665-30790687 CTGCCCCAGGAGCTGGGGCAGGG + Intronic
1040621370 8:49096303-49096325 CTGCAGGAACAGTAGGGGCAAGG - Intergenic
1040879312 8:52188376-52188398 CAGCAGAAACAGCAGGTGCAAGG + Intronic
1042446471 8:68890676-68890698 CAGCACTACCAGCTGTGGCAGGG - Intergenic
1043922629 8:86001266-86001288 CTGCACAACCAGCCTGGGTAAGG - Intronic
1046643769 8:116762630-116762652 CTGCACAGAATGCTGGGGAATGG + Intronic
1046662905 8:116967955-116967977 CTGCACAAACAGATGAGGGTTGG + Intronic
1046868464 8:119177078-119177100 ATTCACTATCAGCTGGGGCAGGG - Intronic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1049027833 8:140008612-140008634 CTGGACAAACAGCAGGCACAGGG + Intronic
1050298222 9:4228560-4228582 CTGCAAATACAGCCAGGGCAAGG + Intronic
1052791312 9:32877784-32877806 GTCCTCTAACAGCTGGGGCATGG - Intergenic
1055187675 9:73475209-73475231 CTGCACGAACTGCTGGGCTATGG - Intergenic
1058128678 9:101225408-101225430 CTGCACAGAGAGGTGAGGCATGG - Intronic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060934750 9:127508480-127508502 CTGCACCAGGAGCTGGGGAAGGG - Exonic
1061379563 9:130245934-130245956 CTCCAGAAAAAGCGGGGGCAAGG - Intergenic
1061846329 9:133390550-133390572 CTGCAGAACCAGGTGGGGCAGGG + Intronic
1062077043 9:134595144-134595166 GGGCCCCAACAGCTGGGGCAAGG - Intergenic
1062219967 9:135409844-135409866 CAGCCTAAACAGCCGGGGCAGGG - Intergenic
1062417906 9:136462588-136462610 TGGCACACACAGCAGGGGCACGG + Intronic
1062465684 9:136680031-136680053 TTTCACAGACAGCTGGGGCGCGG + Intronic
1062530244 9:136996511-136996533 CTTGACAAACAGCTGGAGCTTGG + Exonic
1189840630 X:45072618-45072640 CTGCTCTAACTGCTGGAGCAGGG + Intronic
1190305575 X:49079812-49079834 CGGCACCGACAGCTGGGGCCCGG - Exonic
1190369951 X:49730975-49730997 CTAGAGATACAGCTGGGGCAGGG + Intergenic
1190477485 X:50842302-50842324 CAGCGCAAACAGCCAGGGCATGG + Intergenic
1192443597 X:71193560-71193582 GGGCAGGAACAGCTGGGGCAGGG - Intergenic
1193211481 X:78811364-78811386 CAGCACAAACAGCCTGGGCATGG - Intergenic
1194194014 X:90870115-90870137 TTGCACAAATCTCTGGGGCAGGG - Intergenic
1199947806 X:152681844-152681866 CTGCGGAAACAGCAGGGGCAAGG - Intergenic
1199961873 X:152786610-152786632 CTGCGGAAACAGCAGGGGCAAGG + Intergenic
1200540624 Y:4452499-4452521 TTGCACAAATTTCTGGGGCAGGG - Intergenic