ID: 1079084291

View in Genome Browser
Species Human (GRCh38)
Location 11:17434081-17434103
Sequence CACATTTAGAACTATGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079084291_1079084294 3 Left 1079084291 11:17434081-17434103 CCAACTACATAGTTCTAAATGTG 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1079084294 11:17434107-17434129 TAGCCTCGCCCCTCCCCTATGGG 0: 1
1: 0
2: 0
3: 3
4: 76
1079084291_1079084295 4 Left 1079084291 11:17434081-17434103 CCAACTACATAGTTCTAAATGTG 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1079084295 11:17434108-17434130 AGCCTCGCCCCTCCCCTATGGGG 0: 1
1: 0
2: 1
3: 13
4: 112
1079084291_1079084304 28 Left 1079084291 11:17434081-17434103 CCAACTACATAGTTCTAAATGTG 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1079084304 11:17434132-17434154 CAGTCACTCCAAGGAGCAACTGG 0: 1
1: 0
2: 2
3: 13
4: 120
1079084291_1079084303 19 Left 1079084291 11:17434081-17434103 CCAACTACATAGTTCTAAATGTG 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1079084303 11:17434123-17434145 CTATGGGGTCAGTCACTCCAAGG 0: 1
1: 0
2: 0
3: 13
4: 106
1079084291_1079084293 2 Left 1079084291 11:17434081-17434103 CCAACTACATAGTTCTAAATGTG 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1079084293 11:17434106-17434128 GTAGCCTCGCCCCTCCCCTATGG 0: 1
1: 0
2: 1
3: 11
4: 85
1079084291_1079084305 29 Left 1079084291 11:17434081-17434103 CCAACTACATAGTTCTAAATGTG 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1079084305 11:17434133-17434155 AGTCACTCCAAGGAGCAACTGGG 0: 1
1: 0
2: 0
3: 8
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079084291 Original CRISPR CACATTTAGAACTATGTAGT TGG (reversed) Intronic
902946001 1:19839532-19839554 CACATTTAGAAGAAAGAAGTTGG + Intergenic
902997177 1:20235446-20235468 CACATATAAGACTATGCAGTAGG + Intergenic
904886245 1:33740693-33740715 GACATTTAGAAATATGGTGTGGG + Intronic
905899179 1:41569507-41569529 CAGATTTAGAATTATGTCTTTGG - Intronic
906837690 1:49101525-49101547 CTTATTTAGAACCATGTATTAGG - Intronic
907116644 1:51974779-51974801 CACAATTAACACTATGAAGTAGG - Intronic
908044281 1:60151536-60151558 CACATTTACCACTAAGTAGCTGG + Intergenic
908089063 1:60667529-60667551 CCCATCTAGAACAATGTAGGAGG - Intergenic
908504486 1:64782787-64782809 CACATGTATACCTATGTAATTGG - Intronic
909379430 1:74981340-74981362 CACCTTTAGCACTATTTAATGGG - Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
911623383 1:100092873-100092895 CATATTTAAAACTCTGGAGTGGG - Intronic
911738924 1:101366057-101366079 CATATTTCAAACTATGTAGAAGG - Intergenic
915156800 1:153883897-153883919 AAAATTAAGAACTATATAGTGGG + Intronic
915293225 1:154900478-154900500 CATAATTAGAACCATGTATTGGG + Intergenic
916611455 1:166395960-166395982 TTCATTTAGAAAGATGTAGTTGG - Intergenic
917753905 1:178080299-178080321 TACATTTATAACTTTGGAGTAGG + Intergenic
918691418 1:187484924-187484946 CACATCTAGAAGTATGCATTTGG - Intergenic
921086538 1:211799046-211799068 CTTATTTAGAAGTATGTATTAGG - Intronic
921226433 1:213024806-213024828 CATATTTAGAACTATGTAGATGG + Intergenic
922055529 1:222038987-222039009 CACATTTCCAAATATGTGGTCGG + Intergenic
923691450 1:236197582-236197604 CACATGTAGAACAATGAAGCTGG - Intronic
1064897293 10:20252445-20252467 CACTTTTAAAATTATGTATTTGG + Intronic
1069537571 10:69266088-69266110 CACATTTAGCCCTATGTGGTAGG - Intronic
1078405202 11:11064858-11064880 AACATTTAGAATTATGTATGTGG + Intergenic
1078904733 11:15673263-15673285 TATATTGAGAACTATGTATTAGG + Intergenic
1079084291 11:17434081-17434103 CACATTTAGAACTATGTAGTTGG - Intronic
1079716088 11:23747413-23747435 CACATTTAAAAATATGTCCTTGG + Intergenic
1080270119 11:30442272-30442294 CACATGTAGATCTAATTAGTTGG - Intronic
1084344527 11:68536567-68536589 CATTTTTAGAAGTATGTATTTGG - Intronic
1086486242 11:87305471-87305493 CACATTTAGAAGTAGTGAGTGGG + Intronic
1087872018 11:103306916-103306938 CACATTAATAACTATATTGTGGG + Intronic
1088801305 11:113309849-113309871 CTCATATAGAAATATGAAGTCGG + Intergenic
1092060014 12:5541249-5541271 CACATGTAGAAGTATGAAGCTGG - Intronic
1092896015 12:13011115-13011137 CACATTCATAAATATGTAATAGG + Intergenic
1095801885 12:46277654-46277676 CAAATTCAGAATTATGAAGTAGG - Intergenic
1096886722 12:54725952-54725974 CACATCTAGAACAGTATAGTTGG + Intergenic
1098391571 12:69975003-69975025 CATATTTAGAACTATGGAGCTGG - Intergenic
1099261840 12:80392047-80392069 CACATATAGAACTATTAGGTTGG - Intergenic
1099359977 12:81688184-81688206 TACATTAAAAACTATGTATTGGG + Intronic
1099559936 12:84160210-84160232 CACATCTATAAGTATGTACTAGG - Intergenic
1106894519 13:34284539-34284561 CACATGTAGAAGAATGTAGCTGG + Intergenic
1106917665 13:34532329-34532351 CACACTTAGAACAATGAAATGGG + Intergenic
1108954957 13:56141643-56141665 CAAATTTTCAACTATTTAGTGGG + Intergenic
1109485690 13:63016399-63016421 CACATTAAGAACCAAGTAGAAGG + Intergenic
1109955616 13:69561958-69561980 CAGCTTTAGAACTAGGTAATAGG + Intergenic
1111014220 13:82355883-82355905 CACATTTAGGAATATGGAATAGG + Intergenic
1111770384 13:92588673-92588695 GAAATATAGAACTATGTAGTAGG + Intronic
1111770580 13:92590979-92591001 GAAATATAGAACTATGTAGCAGG + Intronic
1115319207 14:32060935-32060957 CATATGTAGAATTAAGTAGTGGG + Intergenic
1115932797 14:38516405-38516427 AACATTTAGAAAAATGTGGTAGG + Intergenic
1116136072 14:40925608-40925630 AACTTTTATAACTTTGTAGTTGG + Intergenic
1117068028 14:52030134-52030156 CAGATTTAGAACCAGGAAGTTGG - Intronic
1117976531 14:61302640-61302662 GTTATTTAGAACTATGTTGTGGG + Intronic
1118343752 14:64918261-64918283 CAGATTTAGAAATAATTAGTGGG + Intronic
1120028917 14:79617359-79617381 CACACTTAGAAATATGCAGTAGG + Intronic
1120767213 14:88339492-88339514 CAAATGTGGAACTTTGTAGTGGG - Intergenic
1121753621 14:96381917-96381939 TACATTTAAAAATATGTACTAGG + Intronic
1124878206 15:33616184-33616206 CAAATTTAGATCTATGGAGAAGG + Intronic
1127783628 15:62337333-62337355 CACTTTTAAGACTATGAAGTAGG - Intergenic
1130451465 15:84057790-84057812 CACATTTAGAATTTTGTGTTTGG + Intergenic
1131452201 15:92551834-92551856 CACACTTATAACTTTCTAGTTGG - Intergenic
1132123387 15:99197513-99197535 CATATTTAGCACTATGTATCAGG + Intronic
1134122100 16:11591930-11591952 CACATGTAGAAGAATGAAGTTGG + Intronic
1134344773 16:13379564-13379586 CACATTTAAAAAAATATAGTTGG - Intergenic
1135121953 16:19773803-19773825 CATAATTAGAAGTAAGTAGTAGG + Intronic
1138504055 16:57468316-57468338 CACTTTTAGAAATATGAAATGGG - Intronic
1142335615 16:89488180-89488202 CAAATTTAGCACTATCTTGTGGG + Intronic
1145199919 17:20934547-20934569 CACATTTAGATCTATGCAACTGG - Intergenic
1149949626 17:60971887-60971909 TACAATTAGAACTTTGTAGCTGG + Intronic
1155362077 18:25013517-25013539 CACATCTGGAAGTAAGTAGTGGG - Intergenic
1156190182 18:34709951-34709973 GACATTTAAAAATATTTAGTTGG + Intronic
1156199193 18:34810584-34810606 CAAAATTACAACTATGTAGGAGG + Intronic
1158582763 18:58699334-58699356 CACACTTAGGACGATATAGTAGG + Intronic
929848542 2:45558608-45558630 TATATTAAGAACTATGTAATAGG - Intronic
930413582 2:51059493-51059515 TACATTTAACACTATGTAGTTGG + Intergenic
930481921 2:51959070-51959092 GTCATTTAGAAATATCTAGTTGG - Intergenic
933006102 2:76997627-76997649 CACATTTAAGAATATGTGGTTGG + Intronic
936272834 2:111064134-111064156 CTTATATAAAACTATGTAGTAGG + Intronic
939673058 2:145037630-145037652 CACATAAATAATTATGTAGTGGG + Intergenic
939919506 2:148091602-148091624 CACATTTAGAAGAATGAAGCTGG + Intronic
943123107 2:183762046-183762068 AAAAATTACAACTATGTAGTTGG + Intergenic
943483025 2:188445705-188445727 GACATTTAGAACAGTGTTGTTGG + Intronic
945991975 2:216403797-216403819 CACATGTAGAATTAAGGAGTAGG + Intergenic
946801133 2:223417230-223417252 CACATTTGGGCCTATTTAGTTGG + Intergenic
1168741492 20:195230-195252 CACAATAAGAACTAAGAAGTTGG + Intergenic
1169307443 20:4504509-4504531 AACATGCAGAACTATGGAGTAGG - Intergenic
1170531884 20:17301429-17301451 CACATTTAAAATTATGTATATGG - Intronic
1173366551 20:42391055-42391077 CAAATTGAGTAATATGTAGTGGG + Intronic
1173566834 20:44045873-44045895 CAGCTTTAGAACTCTGTATTAGG - Intronic
1177250797 21:18587875-18587897 CACATTGAGAACTATGTCTTGGG - Intergenic
1177370275 21:20194561-20194583 CATAGTAAGAACTATATAGTAGG - Intergenic
1179578716 21:42324188-42324210 CACATTTAGACCTCTGTCTTTGG - Intergenic
1181379775 22:22492551-22492573 TACATTTAGAATTATGTAGAAGG - Intronic
1182934163 22:34205384-34205406 CCCATTTAGAAGTGTGTTGTTGG + Intergenic
951839472 3:27018531-27018553 CACATTTTGAAATGTGGAGTTGG + Intergenic
951980611 3:28562296-28562318 CACATTTATAAATATCTACTAGG - Intergenic
952539482 3:34352516-34352538 CTCATTTAGAATTGTGAAGTAGG + Intergenic
953528897 3:43720576-43720598 CACATTTAAAAAAATATAGTGGG + Intronic
954788231 3:53110957-53110979 CACATTGAGAGCTCTGTCGTAGG + Intronic
957364958 3:79211010-79211032 AACATTTCAAACTATGTAATAGG + Intronic
957802761 3:85106452-85106474 CTCCTTTAAAACTATGTACTGGG - Intronic
958033073 3:88137324-88137346 GACATTTAGAAATCAGTAGTTGG + Intronic
958450055 3:94261630-94261652 CAAATTAATAACTATGAAGTTGG - Intergenic
960184882 3:114626145-114626167 AACATTTAGGAATATGTGGTGGG - Intronic
961189024 3:124941815-124941837 CACATTTAAACCTCTGTTGTTGG - Intronic
961597659 3:128031592-128031614 CACATGTAGAAAAAGGTAGTTGG - Intergenic
962284922 3:134077529-134077551 CACATTTGGAACTGTGTAGCAGG + Intronic
964549579 3:157871873-157871895 TACATGTAGAATTATATAGTTGG - Intergenic
965114812 3:164476242-164476264 CACAATTACAACTCTGTAGAAGG - Intergenic
965948324 3:174270339-174270361 CAGATATAGAACAATGAAGTTGG - Intronic
966472489 3:180306864-180306886 CTCATTTAGAACTATGTTAAGGG + Intergenic
971094314 4:23382104-23382126 CAAATTGAAATCTATGTAGTTGG - Intergenic
971382818 4:26115060-26115082 CACATTCAGTACTATTTTGTTGG + Intergenic
972134175 4:35871658-35871680 CTTATTTAGAAATATGGAGTAGG + Intergenic
972192943 4:36616639-36616661 CAACTTTAGAACTCAGTAGTGGG - Intergenic
977147309 4:93459949-93459971 CACTTCTAGAAATATTTAGTAGG - Intronic
978272150 4:106903833-106903855 CACAGTCAGAAATCTGTAGTAGG - Intergenic
978317182 4:107451269-107451291 CTCATTTATATCTATTTAGTAGG - Intergenic
983788324 4:171761925-171761947 CACATTTAAAACTGTGTAGAGGG + Intergenic
984549429 4:181142927-181142949 CGCCTTTAGAACTAGGTAGTAGG + Intergenic
990427592 5:55702558-55702580 CTCATTTAGTACTTTGTAATGGG + Intronic
993379931 5:87195267-87195289 CACATATAGAGCTATGTTTTTGG - Intergenic
994102211 5:95906105-95906127 TACATTTTAAACTATTTAGTAGG + Intronic
995599644 5:113781387-113781409 CACAAGTAGAACCATGTAATAGG + Intergenic
996295310 5:121907736-121907758 CACATGTAGAAGAATGAAGTTGG + Intergenic
999601193 5:153267138-153267160 CACATATACAATTATTTAGTTGG + Intergenic
1004564799 6:16786258-16786280 CACATTTAGAAAGATGAAGAAGG + Intergenic
1005133604 6:22541201-22541223 CACATTCAGAAGAATGTAGTCGG - Intergenic
1008165362 6:48131721-48131743 CACATTCAAAAGAATGTAGTTGG - Intergenic
1009334105 6:62463784-62463806 TACTTTTAGAACTATTTTGTAGG - Intergenic
1009590677 6:65665620-65665642 CATTTTTACAACTATGTATTAGG - Intronic
1010477536 6:76306816-76306838 CAAATTTAGAATTAAGTATTTGG - Intergenic
1010845435 6:80701730-80701752 CAACTTTAGAACTGTGTAATAGG + Intergenic
1012570612 6:100722586-100722608 AGCACTTAGAACTATGTAGCTGG + Intronic
1014334390 6:120114653-120114675 CACAAATAGAACAATGTATTGGG - Intergenic
1014525985 6:122502247-122502269 CAACTTTGGAACTATGTAATGGG - Intronic
1015024522 6:128518863-128518885 CCCATTTAGAACTCTGTAAAGGG - Intronic
1015228531 6:130886447-130886469 CACATTTAGAAATATATACAAGG - Intronic
1016409790 6:143770622-143770644 CAGGTTTATAACTATGAAGTAGG + Intronic
1017016811 6:150107633-150107655 CACATTGTCAACTATGCAGTGGG - Intergenic
1018037728 6:159895868-159895890 CACTTTTAGAAATATGTCCTAGG + Intergenic
1018055445 6:160048299-160048321 CTCATTTATTTCTATGTAGTTGG - Intronic
1018383134 6:163278530-163278552 CACATGTAGAAGAATGAAGTTGG - Intronic
1018592272 6:165440128-165440150 CAAATTTACATCTATGTAGACGG + Intronic
1023062877 7:36345648-36345670 CACATTTAAAAGAATGGAGTTGG + Intronic
1024756311 7:52537179-52537201 GACATTTAGAACGCTGTAATTGG + Intergenic
1026401448 7:70017888-70017910 CACATTTTGAACTATTTGGAAGG + Intronic
1030160873 7:106507376-106507398 CACATTTATAAATATGTATCAGG - Intergenic
1033309595 7:140251264-140251286 CACATTTATAACTATGGGGAGGG - Intergenic
1033880104 7:145870733-145870755 AACATTTAGAAATATGTTCTTGG + Intergenic
1034381092 7:150692946-150692968 CACATTTAGACCTCTGTATTAGG - Exonic
1044042569 8:87388093-87388115 CACATTCAAAACTGTGTAGAGGG + Intronic
1046425894 8:114048371-114048393 AACATTTTTAACTATATAGTTGG - Intergenic
1046847954 8:118939720-118939742 GACAATTAAAACTATGTATTGGG + Intronic
1047811355 8:128413058-128413080 CACATTCAGTACTATAAAGTAGG + Intergenic
1050724034 9:8626208-8626230 TATATTTAAAACTAGGTAGTTGG - Intronic
1051023452 9:12574772-12574794 CACATTTAAAACCATATATTTGG - Intergenic
1056074823 9:83027524-83027546 TACAATAAGAAATATGTAGTTGG - Intronic
1056807245 9:89738394-89738416 AACATTTAAAAACATGTAGTAGG - Intergenic
1058130703 9:101249651-101249673 CACATTTTGAACAATGAAGATGG + Intronic
1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG + Intronic
1059617669 9:115968319-115968341 CAACTTTGGAACTAAGTAGTGGG - Intergenic
1059716157 9:116915356-116915378 CATAATAAGAACTATGTATTTGG + Intronic
1061527802 9:131182006-131182028 CACATTCAAAACAATGAAGTTGG - Intronic
1061648289 9:132024595-132024617 CTCATTTAGAACGACCTAGTGGG - Intronic
1186837329 X:13450710-13450732 CACTTTGAGAACCATTTAGTTGG + Intergenic
1187856769 X:23644475-23644497 CACTTTTAGAAAAATGCAGTTGG - Intergenic
1188989228 X:36797196-36797218 CACATGTAAAACAATGTAGTTGG + Intergenic
1189845173 X:45129223-45129245 AACACTTAGAAATATGTACTAGG + Intergenic
1191920602 X:66252898-66252920 CACATGCAAAACTATGAAGTTGG + Intronic
1194347270 X:92781652-92781674 CACATTTAGAAGAATGAAATTGG + Intergenic
1194751293 X:97687239-97687261 CACATTCAGGACTCTGTATTTGG + Intergenic
1194832421 X:98640466-98640488 CACATGTAGAAGAATGAAGTTGG + Intergenic
1195745125 X:108109672-108109694 CACATACAGAAGTATGAAGTTGG - Intronic
1196398343 X:115289480-115289502 CACCTAGAGCACTATGTAGTTGG - Intergenic
1198315152 X:135458016-135458038 CACATGTAAAACTATAAAGTTGG - Intergenic
1199035405 X:143044330-143044352 CACATTTAAAACCAGGCAGTTGG - Intergenic
1200655597 Y:5898290-5898312 CACATTTAGAAGAATGAAATTGG + Intergenic