ID: 1079086019

View in Genome Browser
Species Human (GRCh38)
Location 11:17445520-17445542
Sequence CCATTCCCGTGTAAGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079086019_1079086023 26 Left 1079086019 11:17445520-17445542 CCTCAGGGCTTACACGGGAATGG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1079086023 11:17445569-17445591 AAAAAGCCTTACGTGCCCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079086019 Original CRISPR CCATTCCCGTGTAAGCCCTG AGG (reversed) Intronic
900242721 1:1624648-1624670 CCATTCCCGGGCAAGAGCTGGGG + Intronic
900965968 1:5958948-5958970 CCAGTGCCGTGTGGGCCCTGAGG - Intronic
901349690 1:8583052-8583074 CCATTCCTGTATAAACCATGAGG - Intronic
908556076 1:65257310-65257332 CCCTTCCCCCATAAGCCCTGGGG + Intronic
1065788806 10:29241456-29241478 CAATCCCTGTGAAAGCCCTGTGG - Intergenic
1070517205 10:77219192-77219214 ACATTCCTTTCTAAGCCCTGTGG - Intronic
1072350017 10:94547791-94547813 ACATTCCAGTGTAGGCCATGTGG + Intronic
1079086019 11:17445520-17445542 CCATTCCCGTGTAAGCCCTGAGG - Intronic
1090090099 11:123688670-123688692 CCGTTATCGTGTAAACCCTGTGG - Intergenic
1090275865 11:125419064-125419086 CCATTCCTATGTCAGCCATGTGG - Intronic
1091653109 12:2324226-2324248 CCAGGCCCATGGAAGCCCTGAGG - Intronic
1098266021 12:68720145-68720167 CCATTTCCCTATAAGTCCTGTGG - Intronic
1098468265 12:70813952-70813974 CCATTCCTGTGTGAACTCTGAGG - Intronic
1098732163 12:74050488-74050510 GCAGACCCCTGTAAGCCCTGTGG - Intergenic
1104688181 12:130804103-130804125 CCATTCCAGAGAAAGCACTGTGG + Intronic
1108389805 13:49936610-49936632 CCACTCACCTGTCAGCCCTGGGG - Intergenic
1111781619 13:92734266-92734288 TCATTCCTGCGTTAGCCCTGGGG + Intronic
1119072176 14:71597702-71597724 CTATTCCAGTGTATACCCTGAGG - Intronic
1121713661 14:96057532-96057554 CCATTCCAGTAGATGCCCTGAGG - Intronic
1128169562 15:65499185-65499207 CACTTCCTGTGTAAGCACTGAGG - Intronic
1128688487 15:69705362-69705384 CCATTCCCCTGTAAGACCTTAGG - Intergenic
1129520825 15:76185012-76185034 ACAGGCCCGTGTGAGCCCTGGGG + Intronic
1130955940 15:88627342-88627364 CCATTTCCCCTTAAGCCCTGTGG - Intronic
1133145620 16:3783838-3783860 CCATTACCTTGGAAGCCCTTTGG - Intronic
1133720318 16:8488694-8488716 CTATTCCCTTGTAAGACCTGTGG - Intergenic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1137502100 16:49019516-49019538 CCCTTCCCATCTCAGCCCTGGGG - Intergenic
1138660137 16:58511881-58511903 CCATTCCTGGGTGAGCCCTTGGG + Exonic
1142000910 16:87663878-87663900 CCATTCCCCAACAAGCCCTGTGG + Intronic
1142296634 16:89227630-89227652 CCATACACGTGTAAGGACTGCGG + Exonic
1142297319 16:89234000-89234022 CCTTTCCTGTGAAAACCCTGTGG + Exonic
1143455372 17:7064362-7064384 AAATTCCCGTGTGAGCCCTGGGG + Intergenic
1144093660 17:11880817-11880839 TCATTCCCATGTCAGCCATGAGG + Intronic
1147345632 17:39791553-39791575 CCATTCCAGTGTAATCAGTGTGG - Exonic
1152449883 17:80371415-80371437 CCATTCCTGTGCTGGCCCTGGGG - Intronic
1157679951 18:49597325-49597347 CCCTCCCCGTGTATGCCCAGTGG + Exonic
1157862632 18:51154440-51154462 CACTTCCCTTGAAAGCCCTGTGG - Intergenic
1167190890 19:47988785-47988807 CCACTCCCATGTAATCCCTTAGG + Intronic
927885269 2:26714394-26714416 CCATTCCTGTTGAATCCCTGTGG - Intronic
940847044 2:158652768-158652790 GCATTCCCGTTGAAGCTCTGGGG - Intronic
948386673 2:237585003-237585025 CAATTCCCCTGTATCCCCTGGGG + Intronic
948656886 2:239481835-239481857 TCATTCCTGTCTCAGCCCTGAGG + Intergenic
1172604487 20:36205557-36205579 CCCTTCCCATGTCAGCCATGGGG - Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1176038091 20:63050059-63050081 CGCTTCCCCTGCAAGCCCTGGGG - Intergenic
955541731 3:59983836-59983858 CCATTCCTGTATTACCCCTGTGG + Intronic
957255084 3:77825954-77825976 CCATCTCCGTGTAATCTCTGGGG + Intergenic
958178979 3:90033130-90033152 TCATTCCCGTGTAGACACTGGGG - Intergenic
961453441 3:127012986-127013008 CCCATCCCCTGGAAGCCCTGGGG + Intronic
961482493 3:127193072-127193094 GCATTCCCGTAAAAGCCCGGTGG + Intergenic
963086916 3:141445497-141445519 CCATACCAGTGCAAGACCTGCGG + Exonic
966757246 3:183383014-183383036 CCATTCCCTGGTAAGCACTTTGG + Intronic
969547741 4:7842867-7842889 CCATTCCCGGGCAGGGCCTGTGG - Intronic
979685956 4:123510469-123510491 CCATGACAGTGTGAGCCCTGTGG + Intergenic
983832537 4:172346074-172346096 CCATTCCAGTATAAGCCAAGAGG - Intronic
988095420 5:26602408-26602430 CCATTCCTTTGTATGCCTTGTGG + Intergenic
988531283 5:32029523-32029545 CCTTTCCCCTGCAAGTCCTGTGG + Intronic
995292178 5:110469636-110469658 CTGTTCCCGTGTCAGCACTGAGG + Intronic
1005776678 6:29140185-29140207 ACATTCACATGTTAGCCCTGAGG - Intergenic
1012915923 6:105170732-105170754 CCATTTTCTTGTGAGCCCTGTGG - Intronic
1013698250 6:112730140-112730162 CCATACCTGTGTAATCTCTGGGG - Intergenic
1016367667 6:143337031-143337053 CCCCTCCCCTGTGAGCCCTGAGG - Intronic
1018009249 6:159654945-159654967 CCATTCTAGAGTATGCCCTGGGG - Intergenic
1022856115 7:34316158-34316180 CTATTCCAAAGTAAGCCCTGGGG - Intergenic
1023806348 7:43875584-43875606 CCATCCAGGTGTAAGCTCTGGGG + Intronic
1024086997 7:45902045-45902067 CCCTTCCCCTCTAAGCTCTGTGG + Intergenic
1027579865 7:79978843-79978865 CAATTCCTGTATAAGACCTGAGG - Intergenic
1033603513 7:142908139-142908161 CTCTTCCCACGTAAGCCCTGGGG + Exonic
1033824997 7:145178688-145178710 CCATTTGCCTGTAAGCCCAGTGG + Intergenic
1038147972 8:24915271-24915293 CCATTCCCATCTGAGCCCTTTGG - Intronic
1041671267 8:60493952-60493974 CCATACCAGTGTTGGCCCTGTGG + Intergenic
1051513623 9:17906500-17906522 CCCCTCCCGTGTCAGCCCAGCGG - Intergenic
1056482702 9:87021794-87021816 CAAGTGCCGTGTAAGCCCTCAGG - Intergenic
1058815635 9:108680485-108680507 CCCTTCCCGTGAAAGAACTGAGG + Intergenic
1062622990 9:137430971-137430993 CCATCCCTGTGTAAGACCTGGGG + Intronic
1186542529 X:10415416-10415438 CCATTCCATTGTGAGCCCTTAGG + Intergenic
1192439521 X:71164396-71164418 CGATTCCCTTGGATGCCCTGGGG - Intronic
1199613158 X:149634668-149634690 CCAGTCCCGTGCAAGGCCTATGG + Intergenic