ID: 1079086492

View in Genome Browser
Species Human (GRCh38)
Location 11:17449306-17449328
Sequence AGCCATAAAAATGATGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 432}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079086489_1079086492 5 Left 1079086489 11:17449278-17449300 CCAGAGGCCAGTGGAGAACACAG 0: 1
1: 0
2: 2
3: 41
4: 303
Right 1079086492 11:17449306-17449328 AGCCATAAAAATGATGAAGTGGG 0: 1
1: 0
2: 5
3: 43
4: 432
1079086486_1079086492 25 Left 1079086486 11:17449258-17449280 CCACTTGTATTCTTGATTTACCA 0: 1
1: 0
2: 1
3: 20
4: 202
Right 1079086492 11:17449306-17449328 AGCCATAAAAATGATGAAGTGGG 0: 1
1: 0
2: 5
3: 43
4: 432
1079086490_1079086492 -2 Left 1079086490 11:17449285-17449307 CCAGTGGAGAACACAGATCAGAG 0: 1
1: 0
2: 1
3: 21
4: 214
Right 1079086492 11:17449306-17449328 AGCCATAAAAATGATGAAGTGGG 0: 1
1: 0
2: 5
3: 43
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079086492 Original CRISPR AGCCATAAAAATGATGAAGT GGG Intronic
901121691 1:6899871-6899893 AGCCATAAACTTGGTGAACTTGG + Intronic
901281896 1:8043926-8043948 GGGCAAGAAAATGATGAAGTTGG - Intergenic
902520650 1:17013863-17013885 AGCAATAAAAAGAATGAAGGGGG - Intergenic
904483975 1:30812527-30812549 AGCCTTTAAAATGATGAAGAAGG - Intergenic
906079625 1:43076215-43076237 AGCCATAAAAAGAATGAAATTGG - Intergenic
906799706 1:48725726-48725748 ACCCATACAAATGAAGAAATGGG - Intronic
906942392 1:50266677-50266699 AGCCACAGAAATGATGCAATTGG - Intergenic
907886964 1:58601079-58601101 AACCATAAAAATGATGAAGATGG - Intergenic
907932080 1:59010018-59010040 AGCCATCAACATAATGAAGGAGG - Intergenic
908197485 1:61759389-61759411 AGCAATTAAAATGATGAAATAGG - Intronic
908393695 1:63706041-63706063 AGTCATAAAGAGAATGAAGTTGG + Intergenic
908604679 1:65783409-65783431 AGCCATAACAATGATACAATAGG + Intergenic
908607533 1:65815323-65815345 AGCCATATAGATGATTAAGTTGG + Intronic
909202083 1:72702736-72702758 AGCCATACAAGCCATGAAGTTGG - Intergenic
909743729 1:79066119-79066141 AGCCATAAAAAGGGAGGAGTTGG + Intergenic
910031217 1:82726201-82726223 AGACATAAATATGAGGAAGCCGG + Intergenic
911804630 1:102190527-102190549 AGACATAATCATGATGAAGAGGG - Intergenic
911884344 1:103278529-103278551 TGCCATGAAACTGATGAATTTGG - Intergenic
912124370 1:106515513-106515535 AGAAACACAAATGATGAAGTTGG - Intergenic
912128921 1:106576995-106577017 AGCCTTAAAAATGAGGATGCTGG + Intergenic
912352641 1:109028832-109028854 ACACATAAAAATGGTGAAGATGG - Intronic
912453873 1:109784971-109784993 AGCCTGCAAAATTATGAAGTTGG - Intergenic
912946663 1:114090437-114090459 AGCCCTAAAAATGACCAGGTTGG - Exonic
913645975 1:120854120-120854142 CACCATTAAAATGAAGAAGTTGG - Intergenic
913718893 1:121570931-121570953 AGCCACATAAAAGCTGAAGTAGG + Intergenic
914080664 1:144408763-144408785 CACCATTAAAATGAAGAAGTTGG + Intergenic
914175575 1:145277297-145277319 CACCATTAAAATGAAGAAGTTGG + Intergenic
914340666 1:146757197-146757219 AGCTATTAAAATGATGACTTCGG - Intergenic
914530296 1:148518766-148518788 CACCATTAAAATGAAGAAGTTGG + Intergenic
915211450 1:154312724-154312746 AAGAATAAAAATGATGAAGTAGG - Intergenic
915212564 1:154321418-154321440 AAGAATAAAAATGATGAAGTAGG - Intronic
915272851 1:154767460-154767482 TCCCATAACATTGATGAAGTGGG - Intronic
917462080 1:175240780-175240802 AGGCATAAGAATGATACAGTAGG + Intergenic
917810588 1:178654419-178654441 AGGCAAAAAAATCATTAAGTGGG - Intergenic
918638198 1:186805223-186805245 AGAGATAATAATGAAGAAGTTGG + Intergenic
918753252 1:188300620-188300642 ACACACAAAAAAGATGAAGTAGG + Intergenic
920615649 1:207490301-207490323 ACCCTTAAAAATGGTGAAGATGG - Intergenic
920815198 1:209324859-209324881 GGCCATAATAAAGATGAATTAGG + Intergenic
921032036 1:211342346-211342368 ACCCATAAAAATAAAAAAGTAGG - Intronic
921258789 1:213366783-213366805 AGCCAAAAATATCATGAACTTGG - Intergenic
921423022 1:214970722-214970744 AGTGATGAAAATGATGAAGGAGG + Intergenic
923662243 1:235968455-235968477 AGGCATAATAATGATGCAATGGG + Intergenic
924010145 1:239655857-239655879 AGACATAAAAATGTTGGTGTTGG + Intronic
1064084285 10:12333643-12333665 AGCCACAAAAAAGTTGAAGCTGG + Intergenic
1064138498 10:12770856-12770878 AGCAAGAAAAAAGATGAGGTTGG + Intronic
1064240514 10:13623946-13623968 ACACATAAAAATGATTAAGATGG - Intronic
1064711260 10:18128652-18128674 ACCCATAAAAATGATGTACTTGG + Intergenic
1064763228 10:18643697-18643719 GGCTATCAAAATGATGAAGGAGG - Intronic
1065165349 10:22970918-22970940 ACACTTAAAAATGATGAAGACGG - Intronic
1066152212 10:32635468-32635490 AGCTATAAAAATGATAAAGCAGG - Intronic
1066245385 10:33578375-33578397 AGCCATAAAAATGATGCTTGTGG - Intergenic
1066634678 10:37489037-37489059 AGCCACAAAAAAGTTGAAATTGG + Intergenic
1066710614 10:38229560-38229582 AGCTATAAAAATGATTAACAGGG - Intergenic
1066979393 10:42397923-42397945 AGCTATAAAAATGATTAACAGGG + Intergenic
1068123442 10:52808333-52808355 AGCTATGAAATTGAGGAAGTGGG + Intergenic
1068264578 10:54629993-54630015 AGCCACAAAAAAAATTAAGTAGG + Intronic
1069472211 10:68703420-68703442 ACACATAAAAATAATAAAGTCGG + Intergenic
1069951669 10:72023034-72023056 AGCCATTAAAATGATCATGCAGG + Intergenic
1070240140 10:74672119-74672141 AACAATAAATATAATGAAGTAGG - Intronic
1072060048 10:91800695-91800717 AGTAATAAAAATTATGAAGTGGG + Intronic
1072759911 10:98048050-98048072 AATAATAAAAATGATGAATTGGG - Intergenic
1074207376 10:111295569-111295591 AGCAACAAAGATGAAGAAGTTGG - Intergenic
1074517899 10:114188178-114188200 AACCATGAGAATGAAGAAGTAGG - Intronic
1074922419 10:118029456-118029478 AACCATGAAAATGTTTAAGTTGG - Intronic
1075697279 10:124446612-124446634 AGGCATAAAAATGATAATGAAGG - Intergenic
1076516860 10:131050594-131050616 AGACATGGAAATGATGACGTTGG - Intergenic
1077952465 11:6975243-6975265 ACCCACAAAAATTATCAAGTGGG - Intronic
1078683067 11:13498469-13498491 AGCCATAAAAAAGAACAAGATGG - Intergenic
1079086492 11:17449306-17449328 AGCCATAAAAATGATGAAGTGGG + Intronic
1080286296 11:30617587-30617609 AGCAAGAGAAATAATGAAGTGGG + Intergenic
1080296227 11:30731823-30731845 GGACATACATATGATGAAGTTGG + Intergenic
1080799003 11:35592137-35592159 ACCAATATAAATGATGAAATAGG - Intergenic
1080981711 11:37415305-37415327 AGGCATAAAAATGATAATGAAGG - Intergenic
1082223072 11:49665818-49665840 AGAAAAAAAAATGATAAAGTAGG + Intergenic
1083806009 11:65074372-65074394 AGCCTTAAAAAGGAGGAAATTGG - Intronic
1084186985 11:67478553-67478575 AGCAATAAAACCCATGAAGTAGG - Intergenic
1085668916 11:78442930-78442952 AGCCAGGGAAAGGATGAAGTTGG - Intronic
1086021960 11:82240482-82240504 TGTAATAAAAATGAAGAAGTAGG - Intergenic
1086247472 11:84770950-84770972 AGCCATAAAAAGAATGAAATCGG - Intronic
1086374757 11:86188866-86188888 GGCCATAAAAAGGATAAAGTAGG - Intergenic
1086494612 11:87389258-87389280 AGCCATAAAAAAGATGAGATTGG + Intergenic
1087637764 11:100721772-100721794 AGCAATAAAAATGAATAAGCTGG - Intronic
1089030612 11:115324360-115324382 AACAATAAAAATGATGATTTTGG + Intronic
1089308246 11:117540517-117540539 ACCCTTAAAAATGATTAAGATGG + Intronic
1089763094 11:120742930-120742952 AGCCATAAAAAGAATGAGATTGG + Intronic
1089993920 11:122886746-122886768 AGCCAAAAAAAGAATTAAGTGGG - Intronic
1090109434 11:123889250-123889272 AGGCATAAAAATTATAAAGAAGG - Intergenic
1090138297 11:124224112-124224134 AGCCATAACACTGCTGCAGTGGG + Intergenic
1090139530 11:124240389-124240411 AACCATAAAAAGTAAGAAGTGGG + Intergenic
1091091379 11:132774435-132774457 AGTGTTACAAATGATGAAGTGGG + Intronic
1092946764 12:13463512-13463534 ACCCATAGAAAAGATGAAGGAGG + Intergenic
1095701782 12:45198124-45198146 AGCTTAAAAAATGATGAAGATGG - Intergenic
1096933456 12:55242090-55242112 AGCCAGAAGGGTGATGAAGTGGG - Intergenic
1097200741 12:57276585-57276607 AGGCATAAGAATGATAAAATGGG + Intronic
1097405151 12:59180171-59180193 AGGCATAAGAATGATATAGTGGG + Intergenic
1099314556 12:81067872-81067894 TGCAATAAAAATGATAAAGGGGG + Intronic
1099779690 12:87177726-87177748 AGTCATAAATTTAATGAAGTAGG + Intergenic
1101611198 12:106293775-106293797 AGCCAGTAAAATGGTAAAGTTGG + Intronic
1103285505 12:119797911-119797933 AGCCATAAGAATGATTTAGATGG + Intronic
1105318923 13:19298112-19298134 AAACATAAAACTGAGGAAGTAGG - Intergenic
1105667111 13:22572421-22572443 ATCCTTAAAAATAATGAAATGGG + Intergenic
1106166113 13:27248073-27248095 ATGGATAAAAATGATGGAGTTGG + Intergenic
1106268255 13:28129216-28129238 ACCCTTAAAAATGAAGATGTGGG + Intergenic
1107845576 13:44509258-44509280 AGTAATCAAAATGATGAAGAGGG + Intronic
1108407294 13:50117731-50117753 ACCCTTAAAAATGGTGAAGATGG + Intronic
1109084062 13:57947622-57947644 ACCAATAAAAATAATGAAATGGG - Intergenic
1109943633 13:69404512-69404534 AGCCAGAAAGAGGATGGAGTGGG - Intergenic
1110515223 13:76403792-76403814 AGCCATAGAAAAGCTGAAATAGG - Intergenic
1110641710 13:77831965-77831987 AGCCATTAAAATGAAGAAAAAGG - Intergenic
1110940531 13:81343169-81343191 GGCCATAGAAATGATGCTGTAGG + Intergenic
1111710630 13:91808354-91808376 ACCCATAAAAATGACCAAGATGG - Intronic
1112731024 13:102362296-102362318 AGCCAGAAAAAGGATAAAATAGG - Intronic
1112843670 13:103611142-103611164 AGCCATAAAAACAATGAATAAGG - Intergenic
1112846012 13:103644849-103644871 AGCCATAAAAGAAATGAAGAAGG - Intergenic
1112881566 13:104112834-104112856 AGTTATAAAAATAATGAGGTTGG - Intergenic
1113189358 13:107726291-107726313 AGCCAGAAACAAGATGAAGTGGG + Intronic
1113253038 13:108475587-108475609 AGCCATGAAAATAAAGAAGCAGG - Intergenic
1114344537 14:21781239-21781261 ACCCATAAAAATCTTGAACTCGG + Intergenic
1115381452 14:32744784-32744806 AGGAATAAAAACAATGAAGTAGG - Intronic
1116317363 14:43415503-43415525 GGGAATAAAAATGGTGAAGTGGG + Intergenic
1116546695 14:46176634-46176656 AGCTATAAAAAGGAAGGAGTGGG + Intergenic
1118647839 14:67857404-67857426 GTACATAAAAATAATGAAGTAGG + Intronic
1119000060 14:70873566-70873588 AGCAAGAAAAAGGATGGAGTGGG - Intergenic
1119001019 14:70881895-70881917 AGCCATCAAATAGATAAAGTAGG + Intergenic
1120172749 14:81262135-81262157 AGACAAAAAAGTGAGGAAGTTGG - Intronic
1121234593 14:92383095-92383117 AGCCATAGAAATGATGGGCTGGG - Intronic
1124214102 15:27792398-27792420 TGCCATGTAAAGGATGAAGTAGG - Intronic
1124985910 15:34613204-34613226 ACCCATAAAAATGACCAAGATGG - Intergenic
1125568865 15:40699056-40699078 AGAAATAAAAATGATAAAGTAGG - Intronic
1126288357 15:47042564-47042586 AGCCTTAAAAAGAAAGAAGTTGG - Intergenic
1126646456 15:50879775-50879797 ACCCTGAAAAATGGTGAAGTTGG - Intergenic
1131760791 15:95620431-95620453 AGCCATAAAAAGAAAGAAGATGG - Intergenic
1131966146 15:97845361-97845383 AGCTATAACAATGATGAACCAGG - Intergenic
1133515309 16:6502920-6502942 AGCCACTTAAAGGATGAAGTAGG + Intronic
1133554076 16:6887961-6887983 AGTAATAAAAATGATGAGGATGG - Intronic
1133718979 16:8476584-8476606 AGCCCTAAAAATGAAAAAGTTGG - Intergenic
1134013952 16:10875579-10875601 AAACACAAAAATGATGAAGGTGG - Intergenic
1134420178 16:14080011-14080033 AGCCAGTAAAATGATCATGTAGG - Intronic
1136400159 16:30012493-30012515 ACCCTTAAAAATGGTGAAGATGG + Intronic
1137377697 16:47967677-47967699 AGCCATAGAAATCAAGATGTAGG - Intergenic
1137415812 16:48277976-48277998 AGGTATAAAAATGATACAGTGGG - Intronic
1137623247 16:49890812-49890834 AGTAATAATAATGATGAAGATGG + Intergenic
1139993619 16:70960209-70960231 AGCTATTAAAATGATGACTTCGG + Intronic
1140713405 16:77699213-77699235 AACCATAAAAATAATCAGGTAGG + Intergenic
1141129137 16:81423159-81423181 AGGCATAAGAATGATACAGTGGG + Intergenic
1141301593 16:82821186-82821208 AACCAGAAAAATAATGATGTGGG - Intronic
1142910313 17:3083693-3083715 AGGCATAAAAATGATACAATGGG - Intergenic
1144136737 17:12302312-12302334 ACCCTTAAAAATGATGAAAATGG - Intergenic
1144409113 17:14982874-14982896 AGCCAGAATCATGATGTAGTGGG - Intergenic
1148706815 17:49641324-49641346 AGAAAAAAAAATGATGAAGCAGG - Intronic
1149366541 17:55951115-55951137 AGGCATAAAAATGACAAAATGGG - Intergenic
1150363231 17:64556994-64557016 AGCCACTAAAATGATAATGTGGG - Intronic
1151637541 17:75361636-75361658 ATCCTTAAAAATTATGGAGTGGG + Intronic
1152114897 17:78379415-78379437 AGTTATGTAAATGATGAAGTAGG + Intronic
1152173089 17:78766806-78766828 AGACATAAAAATGAAGAGGGGGG + Intronic
1152509681 17:80777705-80777727 AGCTATAAAAGTGCTGGAGTCGG - Intronic
1203166445 17_GL000205v2_random:101331-101353 AGCCTAAAAAATAATGAAATTGG + Intergenic
1153245921 18:3072770-3072792 AGCCATGAAAATGATAGAGCGGG - Intronic
1153352269 18:4094296-4094318 AGCAATAAAAATAGTGAAGATGG + Intronic
1155060231 18:22222191-22222213 AGCCAAAAGAATAATGAAGCTGG + Intergenic
1155740062 18:29278464-29278486 AGCCTTAAACTTGATGATGTTGG + Intergenic
1155774493 18:29741818-29741840 AGCCCTAAAAAAGATAAAATTGG - Intergenic
1156272002 18:35544116-35544138 AGCCATTAAAATGATGCTTTAGG - Intergenic
1156895150 18:42237516-42237538 AGCCAAAAAAATAATGAGGGAGG - Intergenic
1157141845 18:45116206-45116228 AGCTATCAAAATGCTGAAGGAGG - Intergenic
1157970828 18:52266740-52266762 AGGCATAAAAATGATACAGTGGG + Intergenic
1158003110 18:52642282-52642304 AGGCATAAGAATGATGCAATGGG + Intronic
1158017544 18:52802204-52802226 AGCCATACAGATGAGGCAGTAGG + Intronic
1159109079 18:64035623-64035645 AGACATAAAAATGATACAATGGG - Intergenic
1159242663 18:65762830-65762852 AGAAAAAAAAAAGATGAAGTTGG + Exonic
1159725888 18:71957828-71957850 AGAGATTAAAATGAAGAAGTTGG + Intergenic
1160065540 18:75570797-75570819 ACCCATAAAAATGAATAAGCTGG + Intergenic
1160360959 18:78277823-78277845 AGCCATAAAAATGAACAAAATGG - Intergenic
1161175398 19:2839682-2839704 AGACTTAAAAATGATGAACATGG - Intergenic
1162406484 19:10477591-10477613 ACCATTAAAAATGATCAAGTGGG + Intergenic
1163225251 19:15956024-15956046 AGTCATAAAATTGATGAGGAGGG + Intergenic
1163983869 19:20926895-20926917 AGCCATAAAGATGATATAGTTGG - Intronic
1165965324 19:39572978-39573000 AGGCATAAAAATGATACAATAGG - Intergenic
1167914539 19:52730091-52730113 AACCATAAAAAACATGATGTAGG + Intronic
1168074735 19:53974003-53974025 ATACTTAAAAATGATGAAGATGG - Intronic
926560508 2:14412047-14412069 AGCCATCATAATGATGAATGGGG + Intergenic
927332464 2:21881839-21881861 CCCCATAAAGATGAAGAAGTAGG + Intergenic
928454810 2:31410348-31410370 ACACATAAAAATGATTAAGATGG + Intronic
929767166 2:44854966-44854988 AAGCATAAATATGATGAAGTGGG + Intergenic
930299376 2:49595270-49595292 GGTCATAAAAATGATACAGTAGG + Intergenic
931800417 2:65752714-65752736 ATGCATAAAAATGATGAAATAGG - Intergenic
932016223 2:68029912-68029934 AGCCATAAAAATAATAAATCTGG + Intergenic
932815526 2:74858179-74858201 ATTCTTAAACATGATGAAGTTGG + Intronic
933029480 2:77309822-77309844 AGCCATTAAAATAATAATGTAGG + Intronic
933543069 2:83672874-83672896 AGAAATAAAAATGATAAAGCAGG + Intergenic
933632750 2:84675262-84675284 GGCCATAAAAATGAGGGAGATGG - Intronic
933669758 2:84995611-84995633 AGAAATAAAAATGATAAAGTTGG - Intronic
934033938 2:88072830-88072852 AGCCATTAAAATGGTGTAGAAGG - Intronic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
935865013 2:107377883-107377905 GGCCATGAAAAAGATGAATTAGG + Intergenic
936245607 2:110824304-110824326 AGCCAAAACAATATTGAAGTAGG - Intronic
936599573 2:113882531-113882553 AGACATAAAAATACTGATGTCGG - Intergenic
936704017 2:115049217-115049239 AATAATAATAATGATGAAGTTGG + Intronic
936714849 2:115174350-115174372 AGCCATCAAGATGGTAAAGTTGG + Intronic
936725949 2:115316020-115316042 AGTCAGATAAATGATGAATTTGG + Intronic
936774829 2:115960361-115960383 AATCATAAAAAAGATGAAGCTGG - Intergenic
937137526 2:119566909-119566931 AGTCATAAAAATGGTTAAGATGG - Intronic
938680813 2:133687996-133688018 ACCCATCAAAATGATGTACTTGG - Intergenic
938682902 2:133710495-133710517 TGACATAAAAATAATGAATTTGG - Intergenic
938804743 2:134795788-134795810 AGGAATAAAAATAATGAACTCGG - Intergenic
939466897 2:142568564-142568586 AACCATAAAATTGAAAAAGTTGG + Intergenic
939487640 2:142835686-142835708 AGCCATGCAAATGATGATCTAGG - Intergenic
939925453 2:148168500-148168522 AGTCATGAAAATGATAAAGTGGG + Intronic
940116715 2:150217569-150217591 AACAATAAAAATTATGAAGATGG - Intergenic
940492461 2:154381128-154381150 AGACATAAATATCAGGAAGTAGG + Intronic
941092870 2:161198369-161198391 AGCCAGCAATGTGATGAAGTAGG - Intronic
941314887 2:163980082-163980104 GGCCACGAAAATGATGAAGTAGG + Intergenic
941426914 2:165358660-165358682 AGCCAAGAAAATGAAGAAGATGG - Intronic
941485075 2:166070177-166070199 AGACATAAAAATGCAGAAGAAGG + Intronic
942288824 2:174449542-174449564 AGCCATAAAAAGAATGAAATAGG + Intronic
943318234 2:186414659-186414681 ACCCAGAAACATAATGAAGTTGG - Intergenic
944295146 2:198053248-198053270 AGCCATGCAGATAATGAAGTGGG - Intronic
945484312 2:210377003-210377025 AGACATAAGAATGAGGGAGTTGG - Intergenic
945494138 2:210489645-210489667 AACCAAAAAAATCATAAAGTGGG + Intronic
945798797 2:214398404-214398426 AGGCATAAAAATGGCAAAGTTGG - Intronic
946210177 2:218141362-218141384 ATCTTTAAAAATAATGAAGTAGG + Intergenic
946650761 2:221891187-221891209 AGTCACAAAAATGTTGACGTGGG - Intergenic
946809129 2:223504268-223504290 AGCCTTAAAATGGATGAAGCTGG + Intergenic
948714316 2:239850106-239850128 AGACATAAGAATGATACAGTGGG + Intergenic
1170626615 20:18034923-18034945 AGCTATAATATTGATGAGGTGGG - Intronic
1172119131 20:32587469-32587491 CGCTATACAGATGATGAAGTAGG - Exonic
1174296966 20:49553398-49553420 AGCTATAAAAATGATTAACAGGG + Intronic
1174441845 20:50561922-50561944 AGGGAGAAAAATGATGAGGTTGG - Intronic
1176405310 21:6357765-6357787 AGCCTAAAAAATAATGAAATTGG - Intergenic
1176431847 21:6631338-6631360 AGCCTAAAAAATAATGAAATTGG + Intergenic
1177038594 21:16076985-16077007 ATCAATAACAATGTTGAAGTTGG - Intergenic
1177496346 21:21896633-21896655 AGCCATTAAAAGAATGAAATAGG - Intergenic
1178744354 21:35233683-35233705 ATCAATAAAAATGATTAAATTGG - Intronic
1178818773 21:35955859-35955881 AGCCCTAAAAATTACGTAGTTGG + Intronic
1178822989 21:35992152-35992174 AGACTTAAAAATGGTGAAGATGG - Intronic
1179042260 21:37814596-37814618 AGCCATAAAAAGAATGAGATCGG + Intronic
1179238497 21:39567920-39567942 AGAGATAGAAATGATGATGTAGG - Intronic
1179319799 21:40279791-40279813 AGCCATAAAATAGATGAAACTGG + Intronic
1180917944 22:19502015-19502037 GGCTATAAAAATGATTAAGAAGG - Intronic
1181295393 22:21834237-21834259 AGGCATAAAAATTATGAAGCTGG + Intronic
1181777086 22:25167496-25167518 AGCCAGTAAAATGGTGATGTAGG + Intronic
1182003580 22:26940750-26940772 AGCCACAGAAAAGATGAAGTGGG - Intergenic
1182209027 22:28658657-28658679 ACACATAAAAATGATTAAGATGG + Intronic
1183889786 22:40917589-40917611 ATCAATAAAAATGATAAATTCGG + Intronic
1184000405 22:41669157-41669179 AGCAATAAAAATGGTCATGTTGG - Intergenic
1184206809 22:43009798-43009820 AGCCTTAAAAATGATAAATAAGG - Intronic
1184970968 22:48019601-48019623 GGCCATGAAGATGATGAAATGGG + Intergenic
1185031636 22:48446577-48446599 AGCCACGAAAATGATGAAGCAGG + Intergenic
949124083 3:424558-424580 AGCCCTATTAATGAGGAAGTAGG - Intergenic
950818610 3:15733426-15733448 AAGCAGATAAATGATGAAGTTGG - Intronic
950833308 3:15896496-15896518 AGCTATAAGAATGCTGAGGTAGG + Intergenic
950947368 3:16963350-16963372 AGCCATCATAATCATGAAGATGG + Intronic
951744345 3:25960822-25960844 AGAGAAAAAAATGATGAAGGAGG + Intergenic
952097910 3:29977149-29977171 TGCTATAAAACTGATGAAGCTGG - Intronic
952877786 3:37961524-37961546 AGCCATAAAAATGCTGAAAGGGG + Intronic
953835887 3:46343692-46343714 TGCCATGATAATGATGAATTTGG - Intergenic
954738960 3:52731585-52731607 AGCCACATACATAATGAAGTTGG + Intronic
957471388 3:80661981-80662003 AGGCATAAAAATGATATAATGGG + Intergenic
957991223 3:87630235-87630257 AGCCCTAAAAGGGATGAGGTTGG - Intergenic
958431137 3:94043138-94043160 GGCCAAAAAAATAATGAATTTGG + Exonic
958738794 3:98042978-98043000 AACCATACATATGATAAAGTTGG + Intergenic
959369376 3:105504463-105504485 AGCCAGAAGGAGGATGAAGTGGG + Intronic
959446735 3:106449785-106449807 AGGCAGCAAAATGAGGAAGTAGG + Intergenic
959469069 3:106726608-106726630 AGCCATAATATTGGTGAAGGAGG + Intergenic
959614609 3:108333202-108333224 AGCCACATAATTTATGAAGTCGG - Intronic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
960558305 3:119053892-119053914 AGCCAACAAAAAGATAAAGTGGG + Intronic
962426219 3:135271395-135271417 TGCCATAGAAATGTAGAAGTGGG - Intergenic
964937323 3:162106394-162106416 AGCCAATAAAATGATGAAACAGG + Intergenic
965224333 3:165969067-165969089 AACCATAAAAAATATGAATTAGG + Intergenic
965288460 3:166846068-166846090 AGCCATGAAAAGGATGAGATTGG - Intergenic
965654356 3:170968156-170968178 AGCCATAAAAATGCACAGGTTGG + Intergenic
966108342 3:176363517-176363539 AGGCATAAGAATGATACAGTGGG + Intergenic
966509049 3:180740738-180740760 ATCCATACAAATGATTAAGTGGG - Intronic
966844195 3:184114226-184114248 AGCTATTAAAATGATCATGTGGG - Intergenic
967086022 3:186096039-186096061 AGGCATAAAAATGGGGAAGCAGG + Intronic
967188159 3:186962877-186962899 AGCCATTAAAATGATGCTGCTGG + Intronic
967432974 3:189409537-189409559 AGCCTTAAAAATAATTACGTAGG - Intergenic
967778977 3:193415295-193415317 ATCCAGCAAAATGGTGAAGTAGG + Intronic
970137983 4:12947164-12947186 AGCCATTAAAATTATGCATTTGG + Intergenic
970335538 4:15036907-15036929 AGTCATAAAAATGGGAAAGTGGG + Intronic
970491574 4:16580545-16580567 AGTCACAAAAAGGATGGAGTGGG - Intronic
970493210 4:16597628-16597650 AACCATAAAAATGCAGATGTAGG + Intronic
970576961 4:17437206-17437228 AGCCATAAGGCTGATGGAGTGGG + Intergenic
970590897 4:17559951-17559973 AGCCATAAGAATGATTTAATTGG + Intergenic
970912845 4:21297739-21297761 ACCCAGAAAAATGAGGAAGAGGG - Intronic
971401095 4:26275924-26275946 AGCCATAAAAACTATGATTTGGG - Intronic
971887210 4:32466130-32466152 AGCCATTAAAATAATAAGGTAGG - Intergenic
972076621 4:35097998-35098020 AATGATAAAAATCATGAAGTAGG - Intergenic
972612257 4:40666798-40666820 AGACATAAGAATGATGTAATGGG - Intergenic
973999055 4:56492220-56492242 ATGCATAAAAAGGATGAAATAGG - Intronic
974227890 4:59071573-59071595 AGCCATGAAAATGATAAAGTAGG + Intergenic
974293974 4:59970411-59970433 AGGCCTAAAAATCAGGAAGTGGG + Intergenic
974940258 4:68459618-68459640 AGCCATTCTATTGATGAAGTAGG - Intronic
974984469 4:69003881-69003903 AGGCATAAGAATGATATAGTGGG + Intergenic
975096083 4:70458325-70458347 AGCCTGATAAATGATGAACTAGG + Intronic
975663905 4:76715039-76715061 AGTCTTATAAATGTTGAAGTGGG + Intronic
977152783 4:93533962-93533984 AGCCAGAAAGATAATGAGGTGGG - Intronic
977634024 4:99274748-99274770 AGCCATAGCAATGGTTAAGTAGG - Intergenic
978142911 4:105337815-105337837 AACCATTAAAATGATCATGTAGG - Intergenic
978332386 4:107628428-107628450 AGCCATAAAAATGAGGACACAGG + Intronic
979528488 4:121742705-121742727 AGCCATTAAAATTTTGAAGTAGG + Intergenic
980716487 4:136636459-136636481 AGCCAGAAAAGCGATGAACTGGG - Intergenic
980890966 4:138815231-138815253 AGTTATAAAAATGTTCAAGTGGG + Intergenic
980904497 4:138934203-138934225 ACCATTAAAAATGATGATGTTGG + Intergenic
981351474 4:143734480-143734502 AGGCATAAGAATGATAGAGTGGG - Intergenic
981869321 4:149467807-149467829 AGGCAGAAGAATAATGAAGTTGG - Intergenic
982560767 4:156926351-156926373 AACCATAAAAATGATACAGGAGG + Intronic
983120058 4:163872742-163872764 GATAATAAAAATGATGAAGTCGG + Intronic
983374648 4:166910223-166910245 AGAAATAAAAATGATGATTTAGG + Intronic
983586360 4:169359084-169359106 ACACTTAAAAATGATGAAGATGG + Intergenic
984496231 4:180500596-180500618 GGCAATAAAGATGATGAATTTGG + Intergenic
985165054 4:187084218-187084240 AGGCATAAGAATGATGTAATGGG + Intergenic
985586440 5:740088-740110 AGACATAAGAATGATGTAATGGG + Intronic
985601028 5:832265-832287 AGACATAAGAATGATGTAATGGG + Intronic
986115870 5:4773927-4773949 AGACATGAAAATGTTAAAGTTGG - Intergenic
986738631 5:10686048-10686070 AGACATAATAATAATGAAGATGG - Intronic
986930734 5:12817545-12817567 AGCCATTGAAAAGATGAAGCAGG - Intergenic
987079588 5:14414654-14414676 GGACATAAAAATGGTGAAGACGG - Intronic
987995762 5:25276380-25276402 AGCCATGGATAAGATGAAGTGGG + Intergenic
988226099 5:28412773-28412795 AGCCCTAAAACTGAAGAACTTGG - Intergenic
989334869 5:40304238-40304260 AGCCATAAAAATGAAGAAAGGGG + Intergenic
989417747 5:41200107-41200129 AACCAGTAAAATGAGGAAGTGGG + Intronic
989444044 5:41508191-41508213 AGACATAAAGATGATGACATTGG - Intronic
989976185 5:50589624-50589646 CACCATTAAAATGAAGAAGTTGG - Intergenic
990002116 5:50906549-50906571 CTCCATATAAATGCTGAAGTTGG - Intergenic
991560351 5:67944706-67944728 ACCAAGAAAAATGTTGAAGTTGG - Intergenic
993121078 5:83774796-83774818 AGAATTAAGAATGATGAAGTAGG - Intergenic
993549831 5:89259991-89260013 AGCCCTAAAAATTATGTAGCTGG - Intergenic
995472310 5:112515597-112515619 AGGCATAAGAATGATGCAATAGG - Intergenic
996234044 5:121106023-121106045 ACCCATTAAAATGATCAAGTTGG - Intergenic
996307964 5:122072210-122072232 AGCCTTAAAAATGCTGAAATTGG + Intronic
996857275 5:128022999-128023021 AGCCATGTAAATGAAGAAGTTGG - Intergenic
997771770 5:136561649-136561671 AGCAATAAAAAAGAGGAAGGAGG - Intergenic
998099944 5:139424430-139424452 AGCCAAGAAAATTATGAAGCCGG + Intronic
998563031 5:143189301-143189323 AACCATAAAAAAGATGCACTTGG + Intronic
1001707999 5:173755903-173755925 ATTCAGAGAAATGATGAAGTTGG - Intergenic
1002334533 5:178468776-178468798 ACCCGTAAAAATGGTGAAGATGG - Intronic
1002387881 5:178882921-178882943 AGCCATAAAAATGTTGAATTTGG + Exonic
1004543730 6:16576148-16576170 AGGAATAAAAACGATGAAATTGG - Intronic
1007153701 6:39721521-39721543 GCCAATAAAAATGATGGAGTAGG - Intronic
1008550309 6:52623056-52623078 ACTCATAAAAATGATTAAGATGG + Intergenic
1008686735 6:53933537-53933559 AGCACTAAAAATAATGAAATTGG - Intronic
1008726891 6:54432313-54432335 ATCCATAAAAATGAGGAGTTAGG + Intergenic
1008736447 6:54550055-54550077 AGCCATGAAAATGAAAAAATAGG - Intergenic
1008809852 6:55483240-55483262 ACACATAAAAATGATCAAGAAGG + Intronic
1008831150 6:55764271-55764293 AGCCATAAAAAGAATGAAATTGG + Intronic
1009594325 6:65714857-65714879 AGGCATAAAAATGACCAAGAAGG + Intergenic
1009958795 6:70493750-70493772 AGCCTTAAAAATGATGTTTTTGG + Intronic
1010599489 6:77806186-77806208 AGCAATAAATATGCAGAAGTAGG - Intronic
1010776673 6:79894474-79894496 AGAGATAAAAATGATGAAAATGG + Intergenic
1011953634 6:92998446-92998468 TGCAATAAAAATGATAAAGGGGG + Intergenic
1012064655 6:94535021-94535043 AGAGATAAAAATGAAGAAGCAGG - Intergenic
1012077255 6:94704844-94704866 AGCCTTAAAAATGAACAAGATGG - Intergenic
1012270778 6:97207849-97207871 AGCCATATAAATGCAGAGGTTGG - Intronic
1013184269 6:107744523-107744545 AGCTATAGAACTGATGATGTTGG - Intronic
1013633846 6:112010156-112010178 GGCCACAGAAATGGTGAAGTGGG - Intergenic
1014092753 6:117423121-117423143 AGGCATAAAAATGATACAATGGG + Intronic
1014105134 6:117552676-117552698 AACCATAAAAATGACCATGTTGG - Intronic
1014217099 6:118762747-118762769 AGCCATAAAAAGAATGAAATTGG - Intergenic
1014316182 6:119867919-119867941 AGTGATAAAAATGTTGAATTTGG + Intergenic
1015418117 6:132973699-132973721 AGCCATATAAAGGATAAAGATGG + Intergenic
1015703033 6:136056830-136056852 AAACATAAAAAAGATGGAGTCGG - Intronic
1015919854 6:138255748-138255770 AGCCATCAAAATAATGAAAGAGG + Exonic
1016209665 6:141514656-141514678 AGAAATAAAAATCATGCAGTTGG + Intergenic
1016227316 6:141754509-141754531 AATCATAAAAATGACAAAGTTGG - Intergenic
1016504005 6:144756686-144756708 AGGGATGAAAATGAGGAAGTAGG - Intronic
1016888978 6:148986799-148986821 AGACATAAAAATGATGATGACGG - Intronic
1017993729 6:159512173-159512195 AGACACAAAAATGAAGAAGTTGG + Intergenic
1018067711 6:160135150-160135172 TACTATAAAAATGAAGAAGTGGG - Intronic
1018778325 6:167039427-167039449 AGCCATAAAAAGGAACAAATAGG - Intronic
1020441257 7:8219116-8219138 AGAAATGAAAGTGATGAAGTAGG + Intronic
1020769589 7:12371766-12371788 AGTCATGAAAATGCTGGAGTAGG - Intronic
1021146289 7:17093154-17093176 AAGCATTAAAATGATGAAGGAGG + Intergenic
1021811922 7:24410817-24410839 AGGCATAAGAATGATACAGTTGG + Intergenic
1022955773 7:35378561-35378583 GGCCATAAAACTGATAAAGATGG - Intergenic
1023227258 7:37983692-37983714 AGAAAAAAAAATGATGAGGTGGG + Intronic
1024522398 7:50316932-50316954 AGCCAGTAAAATGATGATGGTGG + Intronic
1027400479 7:77800593-77800615 GGCCCTAAAAATGAAGAAGGTGG + Intronic
1027502886 7:78977128-78977150 AGCCAACAAAATAATGAAGAAGG + Intronic
1027788788 7:82613657-82613679 TGCCAAAAAAATGGTGAGGTGGG + Intergenic
1028281182 7:88930401-88930423 TGCTTTAAAGATGATGAAGTAGG - Intronic
1028494829 7:91450948-91450970 AGCCATCAGAAAGATGAAGGAGG - Intergenic
1029725161 7:102398066-102398088 AGCTATAAAAATCCTGTAGTTGG + Intronic
1030211239 7:106997919-106997941 AGCAATAAAAATGATTAGCTTGG + Intergenic
1030914666 7:115297561-115297583 AGCCATGAAAAAGATGGAATTGG + Intergenic
1031094976 7:117406379-117406401 AGCCATAAAGATGAGTATGTGGG + Intronic
1031780369 7:125953981-125954003 AGCCATAAAAAGGATGAAATCGG - Intergenic
1032234181 7:130105640-130105662 TGCCCTAAAAATCAGGAAGTAGG + Intronic
1032931216 7:136673769-136673791 AGAAATAAAAACGATGCAGTTGG - Intergenic
1033445133 7:141414383-141414405 AGCCATAAAAATGATGTTTTTGG - Intronic
1033502235 7:141963475-141963497 ACCCTTAAAAATGGTTAAGTTGG - Intronic
1034152456 7:148927699-148927721 AGCCCTAAAAATAATTAGGTAGG - Intergenic
1034334877 7:150315159-150315181 ATACATACAAGTGATGAAGTAGG + Intronic
1034442500 7:151093512-151093534 AGCCATTCAAATGTAGAAGTAGG + Intronic
1036606860 8:10314792-10314814 AGCCATGAAAATGAAGAAAATGG + Intronic
1037339829 8:17832497-17832519 AGCCAACAAAATGATAAAATGGG - Intergenic
1038080597 8:24131385-24131407 AGCCAAAATAATGTTTAAGTGGG + Intergenic
1038282193 8:26175604-26175626 ACCAATAAAAATGTTCAAGTTGG - Intergenic
1038321545 8:26531789-26531811 AGGCAGAAAAAAAATGAAGTAGG + Intronic
1040549072 8:48424540-48424562 AGCAAAAAAAATTATCAAGTAGG - Intergenic
1040655953 8:49507910-49507932 AGACTTAAAAATGATTAAGATGG - Intergenic
1041087319 8:54268865-54268887 ATCCCTAAGAATGATGAATTTGG - Intergenic
1041142693 8:54840004-54840026 TGCCCAGAAAATGATGAAGTGGG + Intergenic
1041199305 8:55435477-55435499 AGCTATAAAAAGGGTGAAATTGG - Intronic
1041482590 8:58339506-58339528 AGCCATAAAAAGGAACAGGTTGG + Intergenic
1042176266 8:66039648-66039670 AGCCCTAAAAAGTATAAAGTGGG - Intronic
1042823068 8:72952811-72952833 GGCCACAAAAAAGATGAAGGTGG + Intergenic
1043349440 8:79342342-79342364 AGCCAAAAACATGATGGAGAAGG - Intergenic
1043679269 8:83001495-83001517 AGCAATAAAAAATATAAAGTAGG + Intergenic
1044258010 8:90088611-90088633 AGCCTTAAAAAAAATGAGGTGGG - Intronic
1046586203 8:116151116-116151138 AGCCCCAGAACTGATGAAGTTGG + Intergenic
1046885473 8:119362188-119362210 AGCCAACAAAATGATGATTTTGG - Intergenic
1047209149 8:122826758-122826780 TGCCTGAAAAATGAAGAAGTTGG - Intronic
1047225800 8:122954665-122954687 AGCCTTACAAATGAGGACGTAGG - Intronic
1047545859 8:125815592-125815614 ACCCATAAATCTGATGATGTAGG - Intergenic
1048905179 8:139080965-139080987 AGCAACAAAAATGATGAAGCTGG - Intergenic
1049151692 8:141039060-141039082 ACACCTAAAAATGATGAAGATGG - Intergenic
1049917639 9:334049-334071 AGGCAGAAAAATGATGCACTTGG - Intronic
1050341454 9:4643702-4643724 AGCTATCAAAATAATGATGTAGG + Intronic
1050646637 9:7726595-7726617 AGCCATAAAAATGACATTGTAGG - Intergenic
1050722365 9:8605187-8605209 AGACCTTAAAATAATGAAGTTGG + Intronic
1050988242 9:12110357-12110379 AGGCATAAGAATGATACAGTGGG + Intergenic
1051688307 9:19681701-19681723 ATCCATAAAAATAAAGCAGTGGG + Intronic
1051801447 9:20938908-20938930 ACCCTTAAAAATGATAAAGATGG + Intronic
1051852091 9:21521082-21521104 AGCCATAAAAAAGAACACGTAGG - Intergenic
1052135580 9:24905945-24905967 ACCCATAAAAATAATTTAGTTGG + Intergenic
1053827366 9:42039381-42039403 TGCAATAAAAATGATAAAGGGGG + Intronic
1054603195 9:67148059-67148081 TGCAATAAAAATGATAAAGGGGG - Intergenic
1054700481 9:68407952-68407974 AGCCATAATAATGATAAATTGGG - Intronic
1054906248 9:70416241-70416263 TCCCAGAAAAATCATGAAGTAGG - Intergenic
1055278229 9:74643596-74643618 TGCCATAAAAATATTGAAGTAGG + Intronic
1056027135 9:82510730-82510752 AGGCATAAGAATGATATAGTGGG + Intergenic
1056165669 9:83938705-83938727 AGGCAGACAAATGATAAAGTTGG + Exonic
1057021547 9:91701725-91701747 AGCCATAAAAATAAGGAACTAGG - Intronic
1057104222 9:92396214-92396236 TGGCATAAAAATGTTAAAGTGGG - Intronic
1057339786 9:94189553-94189575 TGCCACATAAATGATGGAGTAGG - Intergenic
1057439870 9:95075089-95075111 AGGGAGGAAAATGATGAAGTTGG - Intronic
1058196376 9:101981843-101981865 AGGCACAACAATGATGAAATTGG + Intergenic
1058360168 9:104136294-104136316 ACTCATAAAAATGATAAAGGGGG - Intronic
1059409158 9:114121377-114121399 AACCATAAAAATGATCAATGTGG - Intergenic
1059999715 9:119947181-119947203 AGTGATAAAAATGCTGAGGTTGG + Intergenic
1203439692 Un_GL000195v1:177370-177392 AGCCTAAAAAATAATGAAATTGG - Intergenic
1185670488 X:1805533-1805555 AACCATAAAAATGAACAAGATGG - Intergenic
1186321724 X:8434664-8434686 AGCCAGAAAAATAATGAAATGGG + Intergenic
1186622385 X:11254984-11255006 TCCCATAAAAAGGAGGAAGTAGG - Intronic
1187582578 X:20624163-20624185 ACCCTTAAAAATGATAAAGATGG + Intergenic
1188139209 X:26527631-26527653 TGCCACAAAAAGGATGAAGCTGG - Intergenic
1188861935 X:35268803-35268825 AGGCATAAGAATGATACAGTGGG + Intergenic
1189602490 X:42642023-42642045 TGTCATAAAAATGGTGGAGTAGG + Intergenic
1190020215 X:46867399-46867421 AGCAATAAAAAGGAACAAGTTGG - Intronic
1190761188 X:53439524-53439546 AGCCTTAAAAGTGAGGAGGTGGG - Intergenic
1191108115 X:56784751-56784773 AGCCCTAAAAATGAATGAGTCGG + Intergenic
1191150489 X:57216304-57216326 AGGCATAAGAATGATACAGTGGG - Intergenic
1191221563 X:57993712-57993734 AGTGATAAAAATGATAAATTGGG - Intergenic
1191838576 X:65491914-65491936 AGCAATCAGAATGATGCAGTGGG + Intronic
1192116084 X:68412611-68412633 AGACTTAAAAATGATTAAGATGG + Intronic
1193897899 X:87135921-87135943 AACAATAAAAATGATAAAGGAGG + Intergenic
1194060702 X:89193412-89193434 AAACAAAAAAATGATGCAGTTGG - Intergenic
1194064648 X:89246800-89246822 AGCCGTAAAAATGATGGACATGG - Intergenic
1194469902 X:94280993-94281015 AGCCAACAAAAACATGAAGTGGG - Intergenic
1194485449 X:94480346-94480368 AGCCATAAAAAAGCTCAAGCTGG - Intergenic
1194633597 X:96316848-96316870 AGCCATCAAAAACATTAAGTGGG - Intergenic
1194653814 X:96547210-96547232 AGCAAGGAAAATGATAAAGTGGG - Intergenic
1194709255 X:97214999-97215021 AGTAATGAAAATGATGGAGTTGG + Intronic
1194816161 X:98444519-98444541 AGCAATAAAAAATATAAAGTAGG + Intergenic
1194877804 X:99210554-99210576 AACCACCAAAATGATGGAGTGGG - Intergenic
1194883921 X:99288990-99289012 AGCCAAAACAATCCTGAAGTGGG + Intergenic
1196111289 X:111950022-111950044 AGCCATAAAAAGGAATGAGTTGG + Intronic
1196604363 X:117639611-117639633 AACCTTAAAAATAATGACGTTGG + Intergenic
1196646090 X:118118477-118118499 TGCCATAAAAAGGTTCAAGTGGG + Intergenic
1196935462 X:120726238-120726260 ATCTATGAAAATGATGGAGTAGG - Intergenic
1197537236 X:127706257-127706279 AGCAAGAAATATAATGAAGTTGG + Intergenic
1198450314 X:136760710-136760732 AGCAATAAACCTGATGAATTTGG - Intronic
1199030698 X:142995711-142995733 AGCCAAAACAATGAGGAAGGGGG + Intergenic
1199079393 X:143559406-143559428 AGTGATAACAATGATAAAGTTGG - Intergenic
1199268713 X:145858015-145858037 AGTCATAAAAATGTTGGACTTGG + Intergenic
1200718822 Y:6580878-6580900 AGCCGTAAAAATGATGGACATGG - Intergenic
1201265698 Y:12204492-12204514 AGCCATAAAAATGAATGAATCGG - Intergenic
1201455493 Y:14163633-14163655 AGCCATAAAAAAGGAGAAGAAGG + Intergenic
1201649829 Y:16273463-16273485 AGCCACCAAAAAGGTGAAGTAGG + Intergenic