ID: 1079087259

View in Genome Browser
Species Human (GRCh38)
Location 11:17455452-17455474
Sequence GGGCGGAGAGAGGAAGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 463}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079087259_1079087262 -5 Left 1079087259 11:17455452-17455474 CCTTTGACTTCCTCTCTCCGCCC 0: 1
1: 0
2: 0
3: 43
4: 463
Right 1079087262 11:17455470-17455492 CGCCCCCAACAAAATAACCTAGG 0: 1
1: 0
2: 0
3: 8
4: 68
1079087259_1079087269 16 Left 1079087259 11:17455452-17455474 CCTTTGACTTCCTCTCTCCGCCC 0: 1
1: 0
2: 0
3: 43
4: 463
Right 1079087269 11:17455491-17455513 GGGTCAGAAATCTACTTTTGTGG 0: 1
1: 0
2: 0
3: 22
4: 167
1079087259_1079087263 -4 Left 1079087259 11:17455452-17455474 CCTTTGACTTCCTCTCTCCGCCC 0: 1
1: 0
2: 0
3: 43
4: 463
Right 1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG 0: 1
1: 0
2: 0
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079087259 Original CRISPR GGGCGGAGAGAGGAAGTCAA AGG (reversed) Intronic
901337496 1:8463740-8463762 GGAAGGAGAGAGGACGCCAAAGG + Intronic
901621915 1:10595372-10595394 GGGTGGAGAGAGTAACTGAACGG + Intronic
901814681 1:11787453-11787475 GGGTGGACGGAGGAAGCCAAGGG + Exonic
901966066 1:12867462-12867484 GGGAGGGGAGAGGAGGTGAAGGG - Intronic
902019856 1:13336779-13336801 GGGAGGGGAGAGGAGGTGAAGGG + Intergenic
902784805 1:18726075-18726097 GGGCGGAGGGAGGAACAGAATGG - Intronic
903177228 1:21588376-21588398 GGTCGCAGAGAGGAAGCCACTGG + Intergenic
903995059 1:27300477-27300499 GCGGGGAAAGAGGAAGTGAAAGG - Intronic
904109102 1:28111380-28111402 TGGGGGAAAGAGGAAGTAAATGG - Intergenic
904607839 1:31707866-31707888 GGGCTGAGAAAGGAAGTGAGTGG - Intergenic
905639178 1:39576779-39576801 GGGCGGAGAGAGGCGGCCGAGGG + Intronic
906201899 1:43965937-43965959 GGGGGAAGAGATGAAGTGAAGGG - Intronic
906564711 1:46790736-46790758 AGGCAGGGAGAGGAAGTCAGAGG - Intronic
906717135 1:47978757-47978779 GGGAGGAGCGAGGACGTCAGAGG - Intronic
907319822 1:53595187-53595209 GGGGAGAGAGAGGAAGAGAAGGG + Intronic
907448555 1:54526785-54526807 GGCAGGAGAGAGAAAGTAAAGGG - Intergenic
907934986 1:59033936-59033958 CAGCTGAGAGATGAAGTCAAAGG - Intergenic
907998535 1:59657323-59657345 GACCAGAGAGAGGAAGCCAAAGG + Intronic
908039883 1:60100755-60100777 GAGCAGAGAGAGAGAGTCAAAGG - Intergenic
908291716 1:62673906-62673928 GGAAGGAGAGAGGAAGGAAAAGG + Intronic
908330674 1:63067841-63067863 GGCCAGAGAGAGGAAGTGATTGG - Intergenic
909742314 1:79045537-79045559 GGACGTCGAGAGGACGTCAATGG - Intergenic
911122554 1:94310787-94310809 GGCAGGAGAGGGGGAGTCAAAGG + Intergenic
911613992 1:99988731-99988753 GGGAGGAGAGAGGAGGGGAAGGG - Intronic
912757077 1:112333415-112333437 GGGAGTAGAGAGGGAGTCAGGGG - Intergenic
913450120 1:118987538-118987560 GGGCGGAGAGGGGACGCCGAAGG - Intronic
914882236 1:151556367-151556389 GGGAGGAGAAAGGAAGGGAAGGG - Intronic
915072950 1:153287470-153287492 GGGAGGAAAGAAGAAGTCAGTGG + Intergenic
915316948 1:155034125-155034147 GGGATGAGAGTGGAGGTCAAGGG - Intronic
915567799 1:156726007-156726029 GGGGTGAAAGAGGAAGTGAAGGG - Intronic
915571627 1:156748065-156748087 GGGAAGAGAGAGGAAGACAGGGG + Intronic
915624752 1:157107719-157107741 GGGTGGAGAGGGGAACCCAAGGG - Intergenic
915904407 1:159867332-159867354 GGGTGGAGAGAGGAGGCCAGGGG + Intronic
916393098 1:164354393-164354415 GGGAGGAGAGGGGAAGAGAAGGG + Intergenic
916524756 1:165598859-165598881 GGGAGGGGAGGGGAAATCAAGGG + Intergenic
917056358 1:170986190-170986212 GGACAGAGTGAGGAAGTCAAGGG - Intronic
918178848 1:182068992-182069014 GGAAGGAGAGAGGAAGGGAAAGG + Intergenic
918433549 1:184487071-184487093 GTGACAAGAGAGGAAGTCAAAGG + Intronic
920264796 1:204713703-204713725 GAGGGGAGAGAGGAAGGCAATGG + Intergenic
920402225 1:205683134-205683156 GGGAAGAGAGAGGAAGGGAAAGG - Intergenic
920548541 1:206838789-206838811 GGAAGGAGAGAGGAAGGGAAGGG - Intronic
922251565 1:223853840-223853862 GGGCAGAGACAGGCATTCAAGGG - Intergenic
922574738 1:226654266-226654288 TGGAGGAGACAGGAAGTCAGAGG + Intronic
923019289 1:230150462-230150484 GGGCAGAAAGAGGAAGTGGAAGG - Intronic
1062922865 10:1293102-1293124 GGGGGGAGAGAGAAAGAGAAAGG + Intronic
1063032894 10:2253791-2253813 CGTTGGAGAGAGGAAGTCCAGGG - Intergenic
1064443926 10:15376900-15376922 GGGAAAAGAGAGGAAGACAATGG + Intergenic
1064843040 10:19617301-19617323 GAGAGAAGAAAGGAAGTCAATGG + Intronic
1065192145 10:23222506-23222528 GGAGGGAGAGAGGAAGGTAAGGG + Intronic
1065877642 10:30011129-30011151 GGACAGAGTGGGGAAGTCAAGGG + Intergenic
1066290491 10:34010048-34010070 GTGCAGAGAGAGGGAGACAAAGG + Intergenic
1066420886 10:35263577-35263599 GGGAGGAGAGAGGAAAGGAAAGG + Intronic
1066964654 10:42251961-42251983 GGGAGGAGAGGGGAAGGGAAGGG - Intergenic
1067169467 10:43894639-43894661 GGGAGGTGAGAGAGAGTCAAAGG + Intergenic
1067472190 10:46545440-46545462 GGGAGGGGAGAGCAAGTTAAGGG - Intergenic
1067703957 10:48593133-48593155 GGGCTGAGAGAGGAACCCTAGGG - Intronic
1069171556 10:65236443-65236465 TGGATTAGAGAGGAAGTCAAAGG + Intergenic
1069232703 10:66031566-66031588 GGAGGGAGAGAGGGAGTAAAGGG + Intronic
1069354885 10:67573695-67573717 GGAGGGAGAGAGGAAGGGAAGGG - Intronic
1069392595 10:67952081-67952103 GGGCTGAGATAAGAAGTCAGAGG - Intronic
1070171335 10:73935130-73935152 AGGCACAGAGAGGTAGTCAAGGG + Intergenic
1070799678 10:79237999-79238021 GGGCGGAGACAGGAAGGAACTGG - Intronic
1071335676 10:84598596-84598618 GGACAGAGAGAGGAAGTGACAGG - Intergenic
1071779505 10:88827227-88827249 GGGAGGAGAGAGGAAAGCATTGG - Intronic
1071875727 10:89840995-89841017 GGGAGGAGAGAGGAAATACAGGG - Intergenic
1072627098 10:97119570-97119592 GGGCGGTGCGAGGAGGTCATCGG + Intronic
1073580746 10:104663501-104663523 ATGCGGAGAGAGGAAAGCAATGG - Intronic
1073911214 10:108347030-108347052 GGAGGGAGAGAGGAAGTGAGGGG + Intergenic
1074492645 10:113953079-113953101 GGGGGAGCAGAGGAAGTCAAAGG - Intergenic
1074875120 10:117607628-117607650 GGGCTGGGAGAGGAAGCCCAGGG + Intergenic
1076019047 10:127055354-127055376 TGGAGGAGAGGGGAAGGCAAAGG + Intronic
1076767303 10:132643619-132643641 GGGGCATGAGAGGAAGTCAAAGG + Intronic
1077018912 11:408856-408878 AGACGGGGAGAGGAAGTCAGGGG + Exonic
1077096584 11:801631-801653 TGGGGGAGAGAGGAGGTCACAGG + Intronic
1077585218 11:3446366-3446388 AGGCACAGAGAGGAAGTCAATGG + Intergenic
1077914269 11:6601053-6601075 GGCCTGAGAGTGGAAGGCAAGGG + Exonic
1078555347 11:12320806-12320828 GGGAGGAGAGAGGAAGAAAGAGG + Intronic
1079087259 11:17455452-17455474 GGGCGGAGAGAGGAAGTCAAAGG - Intronic
1079110068 11:17600405-17600427 GGTCGGGGATTGGAAGTCAAAGG - Intronic
1079807871 11:24957484-24957506 GGATGGAAAGATGAAGTCAAAGG - Intronic
1080011931 11:27468944-27468966 GGGAGAAGAGATGAAGTCATGGG - Intronic
1080446930 11:32345997-32346019 GGGCAGAGAGATGAGATCAAGGG + Intergenic
1082000871 11:47393203-47393225 GGAAGGAAAGAGGAAGCCAAGGG + Intergenic
1084270035 11:68024046-68024068 GGGCCGAAAGAGGATGTCAGTGG - Intronic
1084695098 11:70748348-70748370 GGCAAGAGTGAGGAAGTCAAGGG + Intronic
1084995972 11:72978695-72978717 GGTAGGAGAGAGGAAGCGAAGGG - Intronic
1085520056 11:77132363-77132385 AGGAGGAGAGAGGCAGTCCAGGG + Intronic
1085638927 11:78179089-78179111 GGCCGGAGCAAGGAACTCAAAGG - Intronic
1087009037 11:93496252-93496274 GGGCGGATACAGGAAGGCCATGG + Intronic
1089094180 11:115904787-115904809 GGACTGAGAGAGGAGGTCAGAGG - Intergenic
1089290621 11:117435932-117435954 GGGAGCAGAGGGGAAGTCCAGGG - Intronic
1089685370 11:120143321-120143343 GGGAGGGGAGGGGAAGTAAAAGG + Intronic
1090262335 11:125330592-125330614 GGCAGAAGAGAGGAAGCCAAGGG - Intronic
1090441540 11:126728943-126728965 GGGCAGAGGGAGGAGGGCAATGG + Intronic
1090597116 11:128331776-128331798 GGGAAGAGAGAAGAAGACAAAGG - Intergenic
1090941808 11:131393676-131393698 GGGCGGAGAGAGAGAGGCATGGG - Intronic
1091567987 12:1662208-1662230 GGGAGGGGAGAGGAAGACAGCGG - Intergenic
1092412370 12:8263628-8263650 AGGCATAGAGAGGAAGTCAATGG + Intergenic
1093017634 12:14170936-14170958 GGGAGGAGAGAGGAAGGAGAAGG + Intergenic
1095629506 12:44358173-44358195 GGAGGGAGGGAGGCAGTCAAAGG + Intronic
1095667329 12:44817849-44817871 TGTAGCAGAGAGGAAGTCAAGGG - Intronic
1096015633 12:48271571-48271593 GGGCAGAGGGAGGAAGAAAAGGG - Intergenic
1096910813 12:54981979-54982001 GGGAGGAGAGAAGAAGGAAATGG + Intronic
1096996684 12:55842624-55842646 GGGCAGAGAGAGCAAGGGAAAGG + Intronic
1097218309 12:57430921-57430943 GGGGGGAGAGGGGAAGAAAAGGG + Exonic
1097301982 12:58028694-58028716 GTGGGGAGAGAGAATGTCAAGGG - Intergenic
1099715048 12:86281345-86281367 GGATGGAGAGAGGAAGGAAAGGG - Intronic
1100618539 12:96250061-96250083 GGCAGGAGAGTGGAAGTAAAGGG + Intronic
1102249509 12:111376615-111376637 GGACGGAGGGAGGAAGGAAAAGG + Intergenic
1102514586 12:113437849-113437871 GGATGGAGAGAGGAAGGAAAGGG - Intronic
1102976079 12:117207936-117207958 GGGAGGAGAGAGGAAGAGAAGGG - Intergenic
1103229721 12:119319100-119319122 GGGCAGAGAGAGGCACTCCAAGG + Intergenic
1103304204 12:119951649-119951671 GGGAGGAGAAAGGAAGGGAAGGG + Intergenic
1103304256 12:119951789-119951811 GGGAGGAGAAAGGAAGGGAAGGG + Intergenic
1103432815 12:120903445-120903467 GGGTGGAGAGAGGCAGGCCAGGG - Intronic
1103917595 12:124384048-124384070 GGGAGGAGAGAGAAAGTGAAAGG + Intronic
1106247625 13:27962724-27962746 GAGGGGAGAGAGGGACTCAAGGG - Exonic
1106567721 13:30900687-30900709 GGGTGGAGGGAGGAAGTGAGAGG + Intergenic
1107018322 13:35726567-35726589 GGAGGGAGAGAGGAAGGGAATGG - Intergenic
1107375183 13:39796637-39796659 GGGGGCAGAGAGGAAGGGAAGGG + Intergenic
1108767019 13:53643784-53643806 GGAAGGAGAGAGGAAGAGAAAGG + Intergenic
1109008405 13:56908572-56908594 GGGAGGAAAGGGGAAGACAAGGG + Intergenic
1109213089 13:59557409-59557431 GGAAGGAGGGAGGAAGACAAGGG + Intergenic
1109552166 13:63917829-63917851 GGGAGGGGAGAGGAAGGGAAGGG - Intergenic
1109552203 13:63917965-63917987 GGGAGGGGAGAGGAAGGGAAGGG - Intergenic
1110306030 13:73987733-73987755 GGGAGGAAAGAGGAAGTGAGGGG + Intronic
1111399207 13:87710174-87710196 GGGAGGAGAAAGGAAGGGAAAGG - Intergenic
1114643876 14:24242663-24242685 GGGCGGTAAGAGGGAGCCAATGG + Exonic
1116051557 14:39809916-39809938 GGGCTGAGAGAGAAAATCATTGG + Intergenic
1117023097 14:51592240-51592262 GGACAGAGAGAGCCAGTCAAAGG - Intronic
1117277495 14:54204510-54204532 GTGCGGAGAGAGGTAGACATGGG + Intergenic
1117303326 14:54449403-54449425 GGAGGGAGAGAGGAACACAAGGG + Intergenic
1117505528 14:56398668-56398690 GGGGGGAGAGATGAACTCAATGG - Intergenic
1118359655 14:65045222-65045244 TGTGGGAGAGAGGAAGTCATGGG + Intronic
1119329954 14:73786667-73786689 GGGCGCAGGAAGGAAGTTAAAGG - Intronic
1121468201 14:94129388-94129410 GAGCGGAGGGAGGAAGGGAAGGG + Intronic
1122251565 14:100443622-100443644 GGGCAGAGAGAGAAAATAAAAGG - Intronic
1122868427 14:104621438-104621460 GGGAGGGGAGAGGAAGGGAAGGG + Intergenic
1123058364 14:105583081-105583103 GGGCTGAGTGAGGAGGTCCAGGG + Intergenic
1123082654 14:105703134-105703156 GGGCTGAGTGAGGAGGTCCAGGG + Intergenic
1123082688 14:105703294-105703316 GGGCTGAGTGAGGAGGTCCAGGG + Intergenic
1123082705 14:105703374-105703396 GGGCTGAGTGAGGAGGTCCAGGG + Intergenic
1123082710 14:105703394-105703416 GGGCTGAGTGAGGAGGTCCAGGG + Intergenic
1123082715 14:105703414-105703436 GGGCTGAGTGAGGAGGTCCAGGG + Intergenic
1123102653 14:105816164-105816186 GGGCTGAGGAAGGAAGTCACAGG - Intergenic
1123107986 14:105851922-105851944 GACCAGAGAGAGGAACTCAAAGG - Intergenic
1124074983 15:26435974-26435996 GGGAGGAGTGTGGAAGTCATGGG + Intergenic
1124439251 15:29674957-29674979 TGGCGGAGAGGGGAAGCCAGCGG - Intergenic
1124637971 15:31376976-31376998 GGGTGGAGGCAGGAAGTCATGGG + Exonic
1124849146 15:33319127-33319149 GGGCAGAGAGAGCTAGTCAGCGG + Intronic
1125007974 15:34839356-34839378 AGGCTGAGAGAGGCAGTCATGGG + Intergenic
1125141765 15:36416350-36416372 GGGAGGAAAGAGGAAGACACTGG + Intergenic
1125850206 15:42895923-42895945 GGGCTGAGAGAAGAAGGGAATGG - Intronic
1125927111 15:43571894-43571916 GGAAGTAGAGAGGAACTCAAGGG + Intronic
1125940255 15:43671459-43671481 GGAAGTAGAGAGGAACTCAAGGG + Intergenic
1126328995 15:47511699-47511721 AGGGGTAGAGAGGAAATCAAGGG + Intronic
1126398550 15:48245410-48245432 GAGGGGATAGAGGAAGGCAAGGG - Intronic
1127375626 15:58382039-58382061 GGGAGGGGAGAGGCAGTCCAGGG + Intronic
1128233446 15:66051229-66051251 GGGAGCAGAGAGGAAGTACAGGG + Intronic
1128878757 15:71224022-71224044 GGGAGGAGAGGGGAAGACAACGG + Intronic
1129225678 15:74169050-74169072 GGGAGGAGAGAGGGGGGCAAAGG + Intergenic
1129297408 15:74607403-74607425 AGGAGGAGAGAGGAAATGAAGGG - Intronic
1130097093 15:80863936-80863958 GGGAGGGGAGAGGAAGGCAAAGG - Intronic
1130259960 15:82346943-82346965 GGGGGAAGAAAGGAAGTCAGAGG - Intronic
1130268765 15:82432494-82432516 GGGGGAAGAAAGGAAGTCAGAGG + Intronic
1130285458 15:82550819-82550841 TGGCGGGGAGAGGAACACAAAGG + Intronic
1130472644 15:84238250-84238272 GGGGGAAGAAAGGAAGTCAGAGG + Intronic
1130480135 15:84352821-84352843 GGGGGAAGAAAGGAAGTCAGAGG + Intergenic
1130491634 15:84435308-84435330 GGGGGAAGAAAGGAAGTCAGAGG - Intergenic
1130503249 15:84514348-84514370 GGGGGAAGAAAGGAAGTCAGAGG - Intergenic
1130594939 15:85242884-85242906 GGGGGAAGAAAGGAAGTCAGAGG + Intergenic
1131759142 15:95600963-95600985 GGGAGGGAAGAGGAAGACAAAGG + Intergenic
1132000278 15:98172499-98172521 GTGCGGGGAGAGGAAATCCAAGG - Intergenic
1132878419 16:2150301-2150323 GGTGGGTCAGAGGAAGTCAAGGG + Intronic
1134105159 16:11480094-11480116 TGGCGGACAGAGGAAGCCCATGG - Intronic
1134211733 16:12283168-12283190 GGGAGGAGAAAGGAAGCTAAGGG - Intronic
1134468397 16:14499337-14499359 GGACAGAGAGAGGAAGTGGAAGG + Intronic
1135869554 16:26136802-26136824 GTGGGGAGGGAGGAAGTCAGGGG - Exonic
1136730348 16:32405953-32405975 GGGAGGAGAGGGGAAGGGAAGGG - Intergenic
1137499255 16:48997825-48997847 GGGTGGAGAGAGGAAGAGCAGGG - Intergenic
1137815300 16:51392558-51392580 GGGCGGGGGGAGGGAGGCAAAGG + Intergenic
1138014614 16:53417288-53417310 GTGGGTAGAGATGAAGTCAAAGG - Intergenic
1138239825 16:55418437-55418459 TGGAGGAGAGAGGAAGGGAAGGG + Intronic
1138385299 16:56632352-56632374 GGGAGGAGGGTGGAAGGCAAAGG + Exonic
1138385872 16:56635443-56635465 GGGAGGAGGGTGGAAGGCAAAGG + Intergenic
1138539534 16:57679948-57679970 GGGAGGGGAGAGGAAGGCAGGGG - Intronic
1138862524 16:60775324-60775346 GGGAGGGGAGAGGAAGGGAAGGG + Intergenic
1139214708 16:65116030-65116052 GGGTGAAGAGAGTAAGTCCAAGG - Intronic
1140026729 16:71297636-71297658 GGGTGGGGAGAGGAAGGCAGGGG - Intergenic
1141524473 16:84603084-84603106 GGGCAGAGAGGGGAAGTCGCTGG - Intronic
1142252596 16:88999606-88999628 GGGCGGAGGGAGGAGGGCAGAGG + Intergenic
1142495184 17:302497-302519 GGGAGGAGAGAGGAAGCCATCGG + Intronic
1142605144 17:1077383-1077405 GGGAAGGGAGAGGAAGCCAAGGG + Intronic
1143021293 17:3918232-3918254 GGGAGGAGAAAGGAAGGGAAGGG + Intergenic
1143608528 17:8004169-8004191 GGGAGGAGGGAAGAAGGCAAGGG + Intronic
1144821133 17:18075494-18075516 GGAGGGAGAGAGGACTTCAAGGG + Intergenic
1146332226 17:31937102-31937124 GGGAGGAGAGGGGAAGGGAAGGG - Exonic
1146370283 17:32261896-32261918 AAGCGGGGAGAGGAAGGCAAAGG - Intergenic
1146519540 17:33515568-33515590 GGGAGGAGAGAGGCACTCAAAGG - Intronic
1146944533 17:36864726-36864748 GGGGGGAGGGAGGAAGGAAAGGG - Intergenic
1147133437 17:38421859-38421881 GGGAAGAGAGAGGAAGCAAAGGG - Intergenic
1148476521 17:47932325-47932347 GGGGGTAGAGAGGATGTCACTGG - Intergenic
1150078461 17:62214553-62214575 AGCAGGAGAGAGGAAGTGAAGGG + Intergenic
1151105416 17:71610650-71610672 GGAGGGAGAGAGGAGGACAAGGG + Intergenic
1151105605 17:71612875-71612897 GGAGGGAGAGAGGAGGACAAGGG + Intergenic
1151872514 17:76845940-76845962 GGAGGGAGGGAGGAAGCCAAGGG - Intergenic
1152315057 17:79575325-79575347 GGGCAGAGTGAGGGAGACAAAGG + Intergenic
1152905926 17:82970914-82970936 GGGTGGAGAGCGGAAGGCAGTGG + Intronic
1153187279 18:2499662-2499684 GGGAGGAGAAAGGAAGTCACAGG + Intergenic
1153432625 18:5035218-5035240 GGAGGGAGGGAGGAGGTCAAAGG + Intergenic
1154098997 18:11451072-11451094 GGAAGGAGAGAAGAAGGCAAGGG + Intergenic
1155058246 18:22204404-22204426 GGGAGGAGAGGGGAAGGGAAGGG - Intergenic
1155858543 18:30866828-30866850 GAGCGGGGAGAGGAAGGCACTGG + Intergenic
1156840966 18:41608976-41608998 GGGAGGAGGGAGGAAAACAATGG - Intergenic
1157209474 18:45729289-45729311 AGGCTGAGGGAGGAAGCCAATGG - Intronic
1157333326 18:46719381-46719403 TGGAGGAGAGAGGGAGGCAATGG + Intronic
1157611094 18:48956119-48956141 TAGAGGAGAGAGGAAGTCGAGGG + Intergenic
1158449967 18:57555470-57555492 GTGGGGAGAGAGGAAGTGGAAGG - Intronic
1159850661 18:73523315-73523337 GGAGGGAGAGAGGAAGGGAAGGG + Intergenic
1160365926 18:78325902-78325924 GGGCGGTGAGAGGGTGGCAAAGG - Intergenic
1161142971 19:2659703-2659725 GGAGGGAGAGAGGAAGGGAAGGG + Intronic
1161360177 19:3844252-3844274 GGGTGGAGAGGGGAAGTGATTGG - Intronic
1161401899 19:4069591-4069613 GGGAGGAAAAAGGAAGTGAAGGG - Intergenic
1161937754 19:7382637-7382659 GGAGGGAAGGAGGAAGTCAAGGG + Intronic
1161984456 19:7646044-7646066 AGACGGAGAGAGAAAGCCAAAGG - Intronic
1162134728 19:8548327-8548349 GGGTGGGGACAGGAAGTCAGTGG + Intronic
1162858791 19:13489975-13489997 GGGGAGAGAGAGGGAGTCCAAGG - Intronic
1164633611 19:29777398-29777420 GGGCAGTGAGAGGGAGGCAAGGG - Intergenic
1164654541 19:29910712-29910734 GGAGGGAGGGAGGAAGGCAAAGG - Intergenic
1164771994 19:30816437-30816459 GGAGGGAGAGAGGAAAGCAAGGG - Intergenic
1165739389 19:38196372-38196394 GGGCGGAGCATGGAGGTCAAGGG + Intronic
1165739393 19:38196392-38196414 GGGCAGAGCAAGGAGGTCAAGGG + Intronic
1165739401 19:38196432-38196454 GGGCAGAGCAAGGAGGTCAAGGG + Intronic
1165739406 19:38196452-38196474 GGGCGGAGTGTGGAGGTCAAGGG + Intronic
1165739413 19:38196491-38196513 AGGCGGAGCAAGGAGGTCAAGGG + Intronic
1165739422 19:38196531-38196553 GGGCAGAGCAAGGAGGTCAAGGG + Intronic
1165739427 19:38196551-38196573 GGGCGGAGCGTGGAGGTCAAGGG + Intronic
1165739431 19:38196571-38196593 GGGCAGAGCGTGGAGGTCAAGGG + Intronic
1166104473 19:40590536-40590558 GGGAGCAGAGAGGGGGTCAAAGG - Intronic
1166347924 19:42177732-42177754 GGGAGCAGAGAGGGATTCAAAGG + Intronic
1166834368 19:45658231-45658253 GGGAGGAGAGGGGAAGGAAAGGG - Intergenic
1166977144 19:46611299-46611321 GGGTGAAGAGAGGAAGGCAGGGG + Intergenic
1167608386 19:50493749-50493771 AGGCAGAGAGAGGAAGAGAAAGG + Intergenic
1167706349 19:51083250-51083272 GGACTGAGAGAGGGAGTCACGGG + Intronic
1167852977 19:52215977-52215999 GGGCAGGGAGAGGGAGGCAAAGG - Intronic
1168140499 19:54383553-54383575 GGAAGGAGAAAGGAAGTCAAGGG + Intergenic
1168236687 19:55068166-55068188 GGGGGGAGAGAGAGAGACAAAGG - Intronic
1168349700 19:55668968-55668990 GGGGGAAGAGGGGAAGGCAAAGG - Intronic
1168520114 19:57043507-57043529 GGGGTGGGAGAGGAAGGCAAGGG - Intergenic
926211142 2:10870428-10870450 GGCCAGAGAGAGGAAGGCAGGGG - Intergenic
926266778 2:11330700-11330722 GGGAGGAAGGAGGAAGACAAGGG + Intronic
927283422 2:21331810-21331832 AGGTGGAGACAGGAAGTCAGAGG + Intergenic
929806883 2:45153993-45154015 GAGCAGAGAAAGGAAGTCACGGG - Intergenic
932616404 2:73234255-73234277 GGGCCGGGAGAGGAAGAGAACGG - Exonic
932689535 2:73900565-73900587 GGGAGGAGAGAGGAAAAGAAGGG - Intronic
932749468 2:74362146-74362168 GGAAGGGGAGAGGAAGACAAGGG + Intronic
934186654 2:89683999-89684021 GGGAGGAGAGGGGAAGGGAAGGG - Intergenic
934981100 2:98842159-98842181 GGGCATAGAGAGTAAGTGAAAGG - Intronic
935543689 2:104378436-104378458 GGAAGGCGAGAGGATGTCAAGGG - Intergenic
935740032 2:106139152-106139174 AGGTGGGGAGAGGAAGTCAAAGG + Intronic
936109177 2:109650977-109650999 GGGCAGAGAGTGGAGGTAAATGG + Intergenic
936236614 2:110747829-110747851 GGGAGCAGACAGGAAGTAAAGGG - Intronic
936587051 2:113767277-113767299 GGGCTCAGAGAGCAAGGCAAAGG - Intergenic
937060659 2:118978177-118978199 GAGCTCAGAGAGGAAGCCAAGGG + Intronic
937363095 2:121242563-121242585 GGGCGCAGGGAGGAACTCAGGGG + Intronic
938239057 2:129728796-129728818 CAGTGGAGAGAGGAAGTCAAAGG + Intergenic
938262740 2:129906975-129906997 GGGCAGAGACAGGGAGTCCAGGG - Intergenic
938421894 2:131153136-131153158 GAGAGGAGAGAGGAAGGCAGAGG - Intronic
941574117 2:167209418-167209440 GGGAGGAGAGAGGAAGAACAGGG + Intronic
943356490 2:186862317-186862339 GGAGGGAGAGAGGAAGGAAAGGG + Intergenic
944203958 2:197137426-197137448 GGGCTGAGAAAGTGAGTCAAGGG + Intronic
944503927 2:200390426-200390448 GGGCGGTGTGATGAAGGCAAGGG + Intronic
945769841 2:214029477-214029499 GCGGGGAGAGGGGAAGGCAATGG + Intronic
946031887 2:216711896-216711918 GGGATGAGAGAGGAAGGCCAGGG - Intergenic
948173945 2:235928600-235928622 GGGCGGAGAAGGGATGTGAAGGG + Intronic
948898170 2:240937907-240937929 GGCAGGAGAGAGGGAGTGAAGGG - Intronic
1169432084 20:5545562-5545584 GGGCACAGAGAGGAAGTCCAGGG + Exonic
1170442702 20:16395237-16395259 GGGAGGAGAGGGGAGGCCAAGGG + Intronic
1170442719 20:16395272-16395294 GGGAGGAGAGGGGAGGCCAAGGG + Intronic
1170442733 20:16395302-16395324 GGGAGGAGAGGGGAGGCCAAGGG + Intronic
1170442750 20:16395337-16395359 GGGAGGAGAGGGGAGGCCAAGGG + Intronic
1170442764 20:16395367-16395389 GGGAGGAGAGGGGAGGCCAAGGG + Intronic
1171001653 20:21421909-21421931 GGGAGGAGAGGGGAAGGGAAGGG - Intergenic
1171311477 20:24148599-24148621 GGGCTGAGGGAGGAAGTGAGAGG - Intergenic
1172773892 20:37396438-37396460 GGGAGGAGAGAGGAAGGGAGGGG - Intronic
1172794263 20:37526374-37526396 GGGCATATAGAGGAAGTCAGAGG - Intronic
1174340017 20:49889715-49889737 TGGAGAAGAGAGGAAGTCAGAGG + Exonic
1175315997 20:58047139-58047161 GGGCTGAGAGACGGAGTGAAGGG + Intergenic
1176546516 21:8204657-8204679 GGAGGGAGGGAGGAAGACAATGG - Intergenic
1176554410 21:8248848-8248870 GGAGGGAGGGAGGAAGACAATGG - Intergenic
1176565467 21:8387704-8387726 GGAGGGAGGGAGGAAGACAATGG - Intergenic
1176573332 21:8431872-8431894 GGAGGGAGGGAGGAAGACAATGG - Intergenic
1176719102 21:10378997-10379019 GGGGGGAGAGAGGGAGACAGAGG - Intergenic
1176956056 21:15105294-15105316 GGGCAGTGGGAGGAGGTCAAAGG + Intergenic
1177531344 21:22361775-22361797 GAGCAAAGAAAGGAAGTCAAAGG + Intergenic
1178506839 21:33169538-33169560 GGTTGGATAGAGGAAGTGAAAGG + Intronic
1178791310 21:35702847-35702869 GGGAGGGGAGAGGTAGGCAAGGG + Intronic
1179710630 21:43211146-43211168 GGGGGGAGACAGGCAGTCACAGG - Intergenic
1179917283 21:44485623-44485645 GGACGTGGAGAGGACGTCAAGGG + Intergenic
1180542137 22:16459107-16459129 GGGAGGAGAGGGGAAGGGAAGGG + Intergenic
1180911494 22:19454026-19454048 GGCGGGACAGAGGAAGGCAAGGG - Intronic
1182622523 22:31625859-31625881 GGGAGGAAAGAGGAAAACAAAGG - Exonic
1182692461 22:32173601-32173623 GGGCAAAGGGAGGAAGCCAAGGG - Intergenic
1182845746 22:33429707-33429729 GGGTGGAGAAAGGAAGTCTCAGG - Intronic
1183404772 22:37625028-37625050 GTGCGGGGTGAGGAGGTCAACGG + Exonic
950080192 3:10216453-10216475 TGGCAGAAAGAGGAAGGCAAAGG + Intronic
950316528 3:12005627-12005649 GGGCGGGGCGTGGAAGTGAATGG + Intronic
952110843 3:30122615-30122637 GGGAGGAGAGGGGGAGGCAAAGG - Intergenic
952125113 3:30290943-30290965 GGAGGGAGGGAGGAAGTCATGGG - Intergenic
952181080 3:30917427-30917449 GCGGGGAGAGAGGAAGGGAAAGG - Intergenic
952312158 3:32199967-32199989 GGAAGGAGAGAGGAAAACAAAGG + Intergenic
953567667 3:44046915-44046937 TGGCAGAGGGAGAAAGTCAAAGG + Intergenic
953706938 3:45238298-45238320 GTGTGAAGAGAGGAAGTGAAGGG - Intergenic
953734492 3:45480269-45480291 TGTCTGAGAGAGGAAGTCATAGG + Intronic
954936658 3:54333110-54333132 GAGAGGAGAGAGCAAGACAAGGG + Intronic
956077694 3:65523420-65523442 AGGCGAAGAGAGGGAGGCAAGGG + Intronic
956745457 3:72307421-72307443 GGGCTGAGAGAGGAAGAGCAGGG + Intergenic
957057586 3:75455856-75455878 AGGCAGAGAGAGCAAGTCATTGG + Intergenic
959926107 3:111923627-111923649 GGGTGGAGGGTGGAAGGCAAGGG - Intronic
960132450 3:114071756-114071778 AGGCAGAGAGAAGAATTCAAAGG - Intronic
960550952 3:118975869-118975891 GGGCAGGGGGAGGAAGTCAAGGG + Intronic
961182483 3:124887381-124887403 GGCCGGAGGGAGGAAGGGAAGGG - Intronic
961889933 3:130122288-130122310 AGGCACAGAGAGGAAGTCAATGG + Intergenic
964335953 3:155654525-155654547 GGCCCGAGAGAGGAAGAAAATGG - Intronic
964428172 3:156575064-156575086 GGTTTGAGAGAGCAAGTCAAGGG - Intergenic
965881723 3:173395870-173395892 GGGCGGGGAGAGGGAGGCAGCGG + Intergenic
966087049 3:176080523-176080545 GGGCAGAGAGAGAAAGAGAAGGG - Intergenic
966517792 3:180838191-180838213 GGAAGGAGGGAGGAAGACAAGGG + Intronic
966875703 3:184320479-184320501 GGGCTGAAAGTGGAACTCAAGGG + Intronic
968680078 4:1912167-1912189 GGGAGGAGAGAGGAAGGCAGGGG - Intronic
969000413 4:3976266-3976288 AGGCACAGAGAGGAAGTCAATGG + Intergenic
969520825 4:7676947-7676969 GGGTGGAGAGAGGAAGGCAGAGG - Intronic
969753609 4:9132399-9132421 AGGCACAGAGAGGAAGTCAATGG - Intergenic
969813506 4:9668584-9668606 AGGCACAGAGAGCAAGTCAATGG - Intergenic
970886326 4:20991419-20991441 GGGAGAAGAGAGGAAGAAAAGGG + Intronic
972316809 4:37934438-37934460 GAGCGAAGAGAGTAAGTCACAGG + Intronic
973104308 4:46314624-46314646 GCGGGGAGGGAGGAGGTCAAGGG - Intronic
974439607 4:61899259-61899281 GGGAGGAGAGGGGAGGTGAAGGG - Intronic
975032765 4:69642404-69642426 GGAAGGAGAGAGGAAAGCAAAGG + Intronic
975811106 4:78170868-78170890 GGCCTGAGAAAGGAATTCAAAGG - Intronic
976826375 4:89264759-89264781 TGGCAGAGAGTGGAAGTCAATGG - Intronic
977409630 4:96645391-96645413 GGAGGGAGAGAGGAGGGCAAGGG - Intergenic
977766639 4:100806192-100806214 GGACGTCGAGAGGACGTCAAGGG - Intronic
978264186 4:106803066-106803088 GGGAGGGGAGAGGAAGGGAAGGG - Intergenic
980423349 4:132592971-132592993 GGGAGGGGAGAGGAAGGGAAGGG + Intergenic
980545279 4:134253670-134253692 GGAAGGAGAGAGGAAGGCATGGG - Intergenic
980856887 4:138451320-138451342 GGATGGAGAGATGCAGTCAAGGG - Intergenic
982380638 4:154744163-154744185 CTGAGGAGAGAGGAAGGCAAAGG - Exonic
982876267 4:160654743-160654765 GGGAGGAGAGAGGGAGGAAATGG - Intergenic
984231323 4:177103508-177103530 AGGCAGAGAGAGCAATTCAAGGG - Intergenic
984369946 4:178850697-178850719 GTGAGGAGAGAGGAATTAAAAGG + Intergenic
984375098 4:178920628-178920650 GGGAGGAGAGGGGAAGGGAAGGG - Intergenic
984414298 4:179436675-179436697 GGGCAGAGAAAGGAAGGGAAAGG + Intergenic
984803222 4:183733353-183733375 GGGCAGAGAGAGGCAGGCAGCGG - Intergenic
984883498 4:184430171-184430193 TAGAGGAGAGAGGAAGTCCATGG - Intronic
985362869 4:189193875-189193897 GGGCAGAGAGAAGAAAACAAGGG + Intergenic
985639666 5:1057814-1057836 GGGAGGAGGGAGGCAGTCACGGG - Intronic
986483985 5:8217144-8217166 GGACGGCGAGAGGACATCAAGGG + Intergenic
987221545 5:15795255-15795277 GGGCTGGGAGAGGAAGTAATAGG + Intronic
987448345 5:18049830-18049852 GGGAGGAGATAGGAAGAGAAAGG + Intergenic
990072053 5:51794600-51794622 GGGAAGAGAGAGGGAGTCAAGGG + Intergenic
990267359 5:54091878-54091900 GGGCGGAGAGTGGCAGGGAATGG + Intronic
991075405 5:62531015-62531037 GGGCAGAGGGAGGAACTCAAAGG - Intronic
991776014 5:70086659-70086681 GAGCTAAGAGAGGTAGTCAAGGG + Intergenic
991855302 5:70962113-70962135 GAGCTAAGAGAGGTAGTCAAGGG + Intergenic
991869308 5:71094891-71094913 GAGCTAAGAGAGGTAGTCAAGGG + Intergenic
993739049 5:91514400-91514422 GGAAGGAGAGAGGATGTGAAGGG + Intergenic
994210611 5:97084410-97084432 GGAAGAAGAGAGGAAGTCCATGG - Intergenic
994737629 5:103575144-103575166 AGGGAGAGAGAGGAAGGCAAAGG - Intergenic
995093295 5:108206527-108206549 GGGAGGAGAGAGGAACAAAAAGG - Intronic
995403579 5:111768503-111768525 GGGCAGAGAGAGGAGAGCAAGGG - Intronic
995760657 5:115557882-115557904 GAGCGGTGAGAGGAAGTTAAAGG + Intergenic
996408532 5:123130213-123130235 GGGAGGGGAGAGGAAGGGAAGGG - Intronic
996738583 5:126778368-126778390 GGGCAGAGAGAGGAAGGGGAGGG + Intronic
997225736 5:132208366-132208388 GGGAGGAGAGAGGAGGAGAAGGG + Intronic
997645864 5:135481579-135481601 GAGTGGAGAGAGGAAGTGAGAGG + Intergenic
997852596 5:137346165-137346187 GTGCTGGGAGAGGAAGCCAAAGG - Intronic
998199534 5:140108282-140108304 GGGCTGAGAGAGCAAGTAAAGGG - Intronic
998391402 5:141789130-141789152 GTGGGGAGTGAGGAGGTCAATGG - Intergenic
998816058 5:146015154-146015176 AGGAGGAAAGAGAAAGTCAAGGG + Intronic
999278985 5:150352294-150352316 GGGCAGAGAAAGGATGTGAAGGG + Intergenic
999461225 5:151758782-151758804 GGACGGAGAGAGGAGGTGAGAGG + Intronic
1000185248 5:158851905-158851927 GGGAGGAGAGGGGAAGGGAAGGG + Intronic
1001001269 5:168009492-168009514 GGGCGGGGGGAGGAGGGCAAAGG - Intronic
1001531797 5:172468000-172468022 GGGAGGAGAGAGGACATAAAGGG - Intergenic
1001586764 5:172838082-172838104 GCTCCGAGAGGGGAAGTCAATGG - Intronic
1001700285 5:173701747-173701769 GGGAGGAGAGAGGCAGTCGGAGG - Intergenic
1002391652 5:178917952-178917974 GGACTAAGAGAGGAAGTCATAGG - Intronic
1002702116 5:181131473-181131495 GGGCAGAGAGAGGTAGACTAGGG + Intergenic
1002890373 6:1326701-1326723 GGGCAGAGAGAGGAAGTGAGGGG - Intergenic
1004018984 6:11759215-11759237 GGGCAGAGAGGGGAAGTGGAAGG + Intronic
1004114023 6:12749525-12749547 GGGAGGGGAGAGGAAGGGAAGGG - Intronic
1004701913 6:18087420-18087442 GGGTGGACACAGGAAGCCAAGGG + Intergenic
1005968892 6:30745662-30745684 GGACGGAGGGAGTAAGGCAAAGG + Intergenic
1007178793 6:39913705-39913727 GGGCGGTGAGGGGAAGGCCAGGG + Intronic
1007340487 6:41188285-41188307 GAGAGGAGGGAGGAAGTGAAAGG + Intergenic
1007351377 6:41276040-41276062 GGGAGGAGGGAGGAGGTAAAAGG - Exonic
1007743403 6:44026891-44026913 GGGTGGGGAGAGGAGGTCAGGGG + Intergenic
1008139078 6:47811023-47811045 AGGCTGAGAAAGGAAGACAATGG + Intronic
1009620358 6:66067045-66067067 GGGAGGAGAGATGAAGTCCTGGG - Intergenic
1009803068 6:68567331-68567353 GGGAGGAGGGAGGGAGACAAGGG - Intergenic
1011277479 6:85643876-85643898 GGGCGGGGCGAGGCAGACAATGG + Intergenic
1012451224 6:99354053-99354075 GAGCTGAGGGAGGAAGTCATGGG + Intergenic
1013106182 6:107028321-107028343 GGGCGGAGAGGCGAAGTGACAGG - Exonic
1014492783 6:122082630-122082652 GGGTGGCGAGAGGACATCAAGGG - Intergenic
1016348928 6:143146569-143146591 GGGCGGAGGGATGAGGTGAAAGG - Intronic
1016546441 6:145229316-145229338 GAGAGGAGAGAGGAGGTAAAAGG - Intergenic
1016617301 6:146066206-146066228 GGAAGGAGGGAGGAAGACAAGGG - Intronic
1018141090 6:160837812-160837834 AGGCGGAGAGAGGAAGCCCGGGG - Intergenic
1018818010 6:167350491-167350513 AGGCGGAGAGAGGAAGCCCGGGG + Intronic
1018872606 6:167795188-167795210 GGGGGAAGAGAGGAAGGAAATGG + Intronic
1020120781 7:5502048-5502070 GGGTGGGGAGAGGAAGGAAAGGG + Intronic
1020344861 7:7151992-7152014 GGGAGGGGAGAGGAAGTGAGGGG - Intergenic
1020432417 7:8127543-8127565 GGGCGGAGTGGCCAAGTCAACGG + Intronic
1021359148 7:19690257-19690279 AGGCAGAGAGATGAAGTCAATGG - Intergenic
1021973219 7:25985076-25985098 GGGTGGAGGGAGGAAGTGATTGG - Intergenic
1022131628 7:27410029-27410051 GGGAGAAGAGAGGAAGTCACTGG - Intergenic
1022651959 7:32285709-32285731 GGGAGGAGAGGGGAAGGGAAGGG + Intronic
1022651972 7:32285758-32285780 GGGGGGAGAGAGGAAGGGAGTGG + Intronic
1023156417 7:37256637-37256659 GGGAGGGGAGAGGAGGACAAAGG + Intronic
1024119448 7:46222133-46222155 GGGAGGAGAGAGGATGAAAAAGG + Intergenic
1025049627 7:55723334-55723356 GGGAGGAGAGAGGGAGCAAAAGG + Intergenic
1026122505 7:67550275-67550297 GGGAGGAGAGAGGAGGGGAAGGG - Intergenic
1026735184 7:72944789-72944811 GGTCGGGGAGAGGAGGTCATGGG + Intronic
1026785525 7:73299718-73299740 GGTCGGGGAGAGGAGGTCATGGG + Intergenic
1026865029 7:73818436-73818458 GGAGGGAGGGAGGAAATCAAAGG - Intronic
1027108547 7:75420218-75420240 GGTCGGGGAGAGGAGGTCATGGG - Intronic
1027229170 7:76262134-76262156 GGGAGGGGAGAGGAAGTGAAAGG + Intronic
1029193112 7:98785724-98785746 GGGTGGAGAGTGGAGGGCAAAGG + Intergenic
1029239965 7:99153184-99153206 GGGAGGAGAAAGGAAGTGAGTGG + Intergenic
1030380363 7:108803963-108803985 GGGAGGAGAGAGGGAGGCAGGGG - Intergenic
1031318474 7:120288996-120289018 GGGGGGAGAGAGGAAGGCAGAGG + Intronic
1031382979 7:121111260-121111282 AGGCAGAGAGAGGAAGTGAATGG - Intronic
1031935123 7:127728130-127728152 GGGAGAAGAAAGGAAATCAAAGG - Intronic
1033825743 7:145187076-145187098 GGGAGGAGAAAGGAGGGCAAGGG - Intergenic
1034995153 7:155572232-155572254 GGAAGGAGGGAGGAAGGCAAGGG + Intergenic
1035086497 7:156263738-156263760 GGGCAGAGTGAGGAAGTGAGGGG + Intergenic
1036286617 8:7448766-7448788 GGGAGGAGAGGGGAAGGGAAGGG - Intronic
1036334860 8:7862758-7862780 GGGAGGAGAGGGGAAGGGAAGGG + Intronic
1036376822 8:8207731-8207753 AGGCACAGAGAGGAAGTCAATGG - Intergenic
1036852715 8:12215406-12215428 AGGCACAGAGAGGAAGTCAATGG + Intergenic
1036874086 8:12457928-12457950 AGGCACAGAGAGGAAGTCAATGG + Intergenic
1037382604 8:18303321-18303343 GGGGAGAGAGAGGGAGGCAAAGG - Intergenic
1037752844 8:21693787-21693809 GGAAGGAGAGAGGAAGGGAAGGG + Intronic
1038151743 8:24947654-24947676 GGGCTGAGAAAGGCAGGCAAAGG - Intergenic
1038421517 8:27436963-27436985 AGGAGAAGAGAGGAAGACAAAGG + Intronic
1038495186 8:27996467-27996489 GGCCAGAGAGAGGAGGTCAGGGG + Intergenic
1038689173 8:29745834-29745856 GGGTGGAGAGAGGAAAATAAGGG - Intergenic
1039469271 8:37803404-37803426 GGGCGGGGAGAGGAGGGAAATGG + Intronic
1039947785 8:42144819-42144841 GGGGAAAGGGAGGAAGTCAAGGG - Intergenic
1040903914 8:52445393-52445415 TGGCAGAGAGAGGAAGAGAAGGG - Intronic
1042182339 8:66103647-66103669 GAGCGGGGAGAGGAAGAAAAAGG - Intergenic
1042932404 8:74026612-74026634 GGGCGGAGAAAGGAAGCCACAGG + Intronic
1044813376 8:96086444-96086466 GGGAGCAGAGAGGAAGTGCAAGG + Intergenic
1048792214 8:138114506-138114528 GGGCAGAGACAGGAATTCACAGG - Intergenic
1049465756 8:142750614-142750636 GGGAGGAGAGAGGAAGAGGAGGG - Intronic
1053108862 9:35439194-35439216 GGGCAGATAGAGGAAGGCAAAGG - Intergenic
1053541222 9:38975768-38975790 GGGCTCAGGGAGGAAGTCAGGGG + Intergenic
1053805643 9:41798814-41798836 GGGCTCGGGGAGGAAGTCAAGGG + Intergenic
1055350188 9:75378575-75378597 GGGGGGAGGGAGGAAGGAAAAGG + Intergenic
1056681158 9:88720472-88720494 GGGGGGAGGGAGGATATCAAGGG - Intergenic
1056856304 9:90132448-90132470 GAGTGGAGGGAGGAAGTTAAAGG - Intergenic
1057287535 9:93771774-93771796 GGAGGAAGAGAAGAAGTCAAGGG + Intergenic
1058115319 9:101078216-101078238 GGGGGGAGGGGGGAAGTCAAAGG + Intronic
1059003715 9:110378399-110378421 GGGAAGATTGAGGAAGTCAATGG - Intronic
1059162731 9:112050601-112050623 AGGCGGGGAGAGGAGGTAAAGGG + Intronic
1059583047 9:115573282-115573304 GGGTGGAGAGAGGAAGAAATGGG - Intergenic
1059965095 9:119605982-119606004 GGGCGGAGAGAGGGAGAGAGAGG - Intergenic
1060276456 9:122186587-122186609 GTGGGGAGAGAGGATGGCAATGG - Intronic
1061257341 9:129460416-129460438 GGGCGGAGGGAGGAAGGGAGGGG - Intergenic
1061572697 9:131487559-131487581 GGGAGGAGACAGGGAGTCAAGGG - Intronic
1061604389 9:131697928-131697950 AGGCAGACAGAGGAAGTCAGAGG + Intronic
1061699831 9:132407449-132407471 GGGGTGGGAGAGGAAGTCAGAGG + Intergenic
1061839273 9:133348211-133348233 GGGAGGAGAGAGAAAGGAAAGGG - Exonic
1061963377 9:133999177-133999199 GGGTGGAGAGATGAATTTAATGG - Intergenic
1062215294 9:135385831-135385853 GGGGTGAGAGAGGATGGCAAGGG + Intergenic
1062733393 9:138121348-138121370 GGGAGGAGAGAGGGAGGCAATGG - Intronic
1203563675 Un_KI270744v1:76630-76652 GAGGGGAGGGAGGAACTCAAGGG - Intergenic
1185446672 X:261462-261484 GGGCGGTGACAGGAAGACCAAGG - Intergenic
1185630856 X:1514871-1514893 GGGAGGGGAGAGGAAGACAGGGG - Intronic
1185640478 X:1587780-1587802 GGGAGGAGAGGGGAAGGGAAGGG - Intergenic
1185865215 X:3618201-3618223 GGGCTGAGATGGGAAGTCATTGG + Intronic
1186250462 X:7660430-7660452 GGGCACAGAAGGGAAGTCAAGGG + Intergenic
1187270962 X:17778931-17778953 CAGTGGAGAGAGGAAATCAAAGG - Intergenic
1187825868 X:23333561-23333583 GGGCGGAGTGAGGCAGAGAAGGG + Intergenic
1187878883 X:23827929-23827951 GGATGGAGAGAGGGAGACAATGG - Intergenic
1189375972 X:40466672-40466694 GGGTGGAGAGAGGGAGGCACGGG - Intergenic
1189853299 X:45198379-45198401 AGGCAGAGAGAGGCAGTCAGTGG - Intronic
1190332756 X:49246389-49246411 GGGCAGAGACAGGGAATCAAAGG - Intronic
1192234187 X:69285650-69285672 GGGAGAAGAGAGGAGGACAAGGG + Intergenic
1192880161 X:75274691-75274713 GGGCGGGGATTGGAAGTAAAAGG + Intronic
1193414406 X:81204028-81204050 GGAGGGAGGGAGGAAGGCAAAGG - Intronic
1193851222 X:86539226-86539248 GGCAGGAGAGAGGGAGTGAAGGG - Intronic
1194310727 X:92302307-92302329 GGGAGGAGAAAGGAAGGCACAGG + Intronic
1194500060 X:94671894-94671916 GGCAGGAGAGAGCAAGTGAAGGG + Intergenic
1196938358 X:120751639-120751661 GGGAGGAGGCAGGAAGTCCATGG - Intergenic
1198231372 X:134692748-134692770 TGGCAGACAGAGGAAGTGAAAGG + Intronic
1198308678 X:135407354-135407376 GAGAGGAGAGAGGACGTCACAGG - Intergenic
1199675020 X:150181528-150181550 GGGCCTGGAGAGGAAGTCAGGGG - Intergenic
1200466857 Y:3529561-3529583 GAGCCGAGAGAGGATCTCAAAGG - Intergenic
1200619005 Y:5416591-5416613 GGGAGGAGAAAGGAAGGCACAGG + Intronic
1200798475 Y:7363306-7363328 GGGCTGAGATGGGAAGTCATTGG - Intergenic
1201183031 Y:11368042-11368064 GGGAGGAGAGGGGAAGGGAAGGG + Intergenic
1201788939 Y:17816601-17816623 AGGTAGAGAGTGGAAGTCAAAGG + Intergenic
1201812614 Y:18089386-18089408 AGGTAGAGAGTGGAAGTCAAAGG - Intergenic
1202366676 Y:24170578-24170600 GGGGGAAGAAAGGAAGTCAGAGG + Intergenic
1202504106 Y:25499545-25499567 GGGGGAAGAAAGGAAGTCAGAGG - Intergenic