ID: 1079087263

View in Genome Browser
Species Human (GRCh38)
Location 11:17455471-17455493
Sequence GCCCCCAACAAAATAACCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079087259_1079087263 -4 Left 1079087259 11:17455452-17455474 CCTTTGACTTCCTCTCTCCGCCC 0: 1
1: 0
2: 0
3: 43
4: 463
Right 1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG 0: 1
1: 0
2: 0
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079087263 Original CRISPR GCCCCCAACAAAATAACCTA GGG Intronic
901320264 1:8335705-8335727 GCCCCCAACAACAGCACCAAGGG + Intronic
903680244 1:25091698-25091720 GCCCCCAACCCCTTAACCTACGG + Intergenic
905515683 1:38560206-38560228 GCCCCCAGCACAAAAAGCTAAGG - Intergenic
908243692 1:62210303-62210325 GTCCCCAACCAAATAACTAAAGG - Exonic
910776983 1:90886641-90886663 TCCCCCAAAAAAAAAATCTACGG + Intergenic
914407158 1:147387625-147387647 GCCATCTACAAAAAAACCTATGG - Intergenic
919293768 1:195668304-195668326 GACCTCAACAAAATAATCTGGGG - Intergenic
920035909 1:203065316-203065338 GCCCCCACCCAAATCAGCTAGGG + Intronic
922122819 1:222690135-222690157 TCACACAACAAAATCACCTAAGG + Intronic
923331761 1:232931760-232931782 GCCTCCTTCAAAAGAACCTAGGG + Intergenic
1064233296 10:13549003-13549025 CCCCCCTAAAAAAAAACCTAAGG - Intergenic
1068689560 10:59902046-59902068 GCCCCAAATAAAATGGCCTAGGG + Intronic
1070935551 10:80291982-80292004 CCCCCCAATAAAAAAACATAAGG - Intergenic
1071989071 10:91082020-91082042 CCCCTAATCAAAATAACCTATGG - Intergenic
1072206478 10:93209738-93209760 CCCCCCAAAAAAAAAACCTGGGG + Intergenic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1080857577 11:36125745-36125767 ACCTCCACCAAAATAACTTACGG - Intronic
1088814797 11:113413483-113413505 GCCTCAAACAAGAGAACCTATGG - Intronic
1091435292 12:467683-467705 ATCACTAACAAAATAACCTAAGG + Intronic
1097953117 12:65454999-65455021 TTCCCCAACAAAATACCCTGTGG - Intronic
1098727513 12:73987185-73987207 GTCCCCGACAAAAAAAGCTAGGG - Intergenic
1099170664 12:79359947-79359969 AACCCCATCAAAATCACCTAGGG + Intronic
1100165293 12:91910735-91910757 GCCCCCAGCATAATTAGCTATGG + Intergenic
1102461153 12:113100293-113100315 ACCCCCAAAAAAAGAAGCTAAGG - Intronic
1102805652 12:115777926-115777948 GCCCACAGCTAAACAACCTATGG - Intergenic
1103144719 12:118585030-118585052 ACCCCCAATCCAATAACCTATGG - Intergenic
1105063568 12:133176788-133176810 TCCCCCACCAAAAAAGCCTAGGG + Intronic
1105838731 13:24234561-24234583 GCCCCCACCAACAAAACGTACGG - Intronic
1108242974 13:48486240-48486262 GCACACAACAGAATAATCTATGG - Intergenic
1110358848 13:74601623-74601645 GCCCCCAACAATATATTGTATGG - Intergenic
1121573934 14:94967880-94967902 GCCCCCAACCAAGTAACTTTGGG + Intergenic
1122976700 14:105173840-105173862 GCCCCCAACCAGATACCCTGAGG + Intronic
1124236656 15:27994779-27994801 GCCCCCAAGGAAATTATCTAGGG + Intronic
1130233724 15:82115540-82115562 AGCCCCAACATCATAACCTATGG + Intergenic
1132151654 15:99466481-99466503 GAGGCCAACAAAATAAACTATGG + Intergenic
1134385914 16:13772268-13772290 TCCCACAACAAAATCACCTAGGG + Intergenic
1142672635 17:1494159-1494181 GCCCCCAACACATATACCTAGGG - Intergenic
1149409725 17:56393023-56393045 GCCTGGAACAAAATGACCTAAGG - Intronic
1152049492 17:77960762-77960784 TCCCCCAACAAAGCATCCTAGGG - Intergenic
1152573086 17:81128977-81128999 GCCCCCAACAAAGGAGCCTTTGG - Intronic
1158746942 18:60211825-60211847 GCCTCCAAAAAAGTAGCCTATGG - Intergenic
1159430948 18:68352573-68352595 GCCGCCATCAAAATAATTTAGGG - Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1160305866 18:77735714-77735736 TCCCCTAACAAAAAAACTTATGG - Intergenic
929434938 2:41921391-41921413 GCCCCCTACAAAATGTCCTATGG + Intergenic
930081482 2:47452584-47452606 GCCCCCAACTACTTAACGTAAGG - Intronic
938084487 2:128389788-128389810 GCCCCCAACAGAGTCCCCTAGGG - Intergenic
939208395 2:139139169-139139191 GCCACCTATAAAATAACCAAAGG + Intergenic
939329293 2:140737051-140737073 TCCCCCAAAAAAATAAACAAGGG + Intronic
1169626910 20:7581395-7581417 GCCCTCCTCAAAGTAACCTATGG - Intergenic
1171325320 20:24286250-24286272 CCCCCCATCTAATTAACCTACGG + Intergenic
1172540534 20:35712056-35712078 CCCACCAACAAAATAACAAAAGG + Intronic
1174444361 20:50580476-50580498 GCCCCCACCAAAATATGCTTTGG - Intronic
1178790819 21:35698546-35698568 GCCCCCAAAATAATAAACTTAGG + Intronic
1183324337 22:37183335-37183357 GCCCTCAACAAAATGTCCTGTGG + Intronic
952374956 3:32759208-32759230 ATCCCCAACAAAATAACCAATGG - Intronic
952619470 3:35320020-35320042 GCCCCTATCAAAATAATCTCTGG + Intergenic
956205620 3:66751984-66752006 CCCTCATACAAAATAACCTATGG - Intergenic
962611079 3:137076709-137076731 GCCCCCATCAAGAGAACTTAAGG - Intergenic
967137353 3:186523660-186523682 GACCCCAAAAAAAAAACCTCCGG + Intergenic
973853013 4:54980253-54980275 ACCCCCAACAAAATAACAGCTGG + Intergenic
979776931 4:124601143-124601165 GAAACCAACAAAATAACCTCTGG + Intergenic
982483761 4:155942059-155942081 GCCACCAACACAATAACTCAGGG - Intronic
984565626 4:181326889-181326911 TCCCACGACAAAATCACCTAAGG + Intergenic
984622010 4:181964267-181964289 TCCCCCAACAAAGTAAGATATGG + Intergenic
987024186 5:13907436-13907458 CCCCCCAAAAAAAGAACCTGGGG + Intronic
987211766 5:15691119-15691141 GCCCCCAGGATGATAACCTAGGG + Intronic
987714913 5:21555695-21555717 GCTCCCACCAAAAGAAGCTAGGG - Intergenic
989608309 5:43267076-43267098 GCCAGCAACAAAAAAGCCTAGGG - Intronic
996366189 5:122703738-122703760 GCCCCCAACAAAATTTTTTATGG + Intergenic
997973151 5:138420837-138420859 GCCTCCAACAACAAAACCGAAGG + Exonic
1001145917 5:169184578-169184600 ACACACAACAAAATCACCTAGGG + Intronic
1002137970 5:177119988-177120010 CCCCCAAACAAAAAAACATAAGG + Intergenic
1002952242 6:1825505-1825527 GGGCCCAACAAAATCACCTAAGG - Intronic
1005156017 6:22807416-22807438 GTGCCCTACAAAATACCCTAAGG - Intergenic
1006206139 6:32344845-32344867 AGCCCCAAAAAAAAAACCTAAGG - Intronic
1008335671 6:50301930-50301952 AAACCCTACAAAATAACCTATGG - Intergenic
1009001810 6:57726334-57726356 GCTCCCACCAAAAGAAGCTAGGG + Intergenic
1012665264 6:101961230-101961252 GCTACCAACAAAATGACCTCGGG + Intronic
1012759021 6:103273244-103273266 GCCCCCTACAGAATAACCAAAGG + Intergenic
1016426687 6:143942541-143942563 GACCCCAACAAAATGGCCTTTGG - Exonic
1016744357 6:147562395-147562417 ACCCCTAACACTATAACCTAAGG + Intronic
1020665816 7:11041577-11041599 GCCTCCAACAAAAAAACAGAAGG - Intronic
1023233927 7:38064438-38064460 GCCTCCACCAGAATCACCTAAGG + Intergenic
1028184570 7:87767939-87767961 ACTACCAACAAAATAACCCAAGG + Intronic
1030977284 7:116142592-116142614 GCCCTCAACAAGTTAACCTGTGG - Intronic
1037248864 8:16869064-16869086 TCCCCCCACAAAATAGCCTTGGG - Intergenic
1039156184 8:34560623-34560645 GCCACCAACAAAATAAAGTTAGG + Intergenic
1039599400 8:38821795-38821817 TCACACAACAAAATCACCTAAGG - Intronic
1039927626 8:41951496-41951518 GCCCCCAACAAGATTCTCTAGGG - Intronic
1043392303 8:79803616-79803638 GCTCCAAACAAAATACCCTGAGG + Intergenic
1047439354 8:124862840-124862862 GACCCCATCACACTAACCTAGGG + Intergenic
1050316906 9:4411721-4411743 GCTCCCAAAGAAATAACCCATGG + Intergenic
1051297587 9:15612996-15613018 ACCCCCAACAAAACAGTCTATGG - Intronic
1055526459 9:77138586-77138608 GGCCACAACAAAATAACACAGGG + Intergenic
1057935782 9:99237634-99237656 GCCACCAACAAAAAAACCTTGGG + Intergenic
1058588476 9:106535356-106535378 ACCCCCACCAAAATAAGCAAAGG + Intergenic
1059714102 9:116897118-116897140 GCTCCCAAAAAAATAACCTCAGG + Intronic
1185660544 X:1725332-1725354 GTCCCCAAAAAAATCACCTCTGG - Intergenic
1190944777 X:55081294-55081316 GCCCCCAATAAAATAATAGATGG - Intergenic
1195764682 X:108283572-108283594 CCCCCCAAAAAAAAAACTTAGGG - Intronic
1196994323 X:121364602-121364624 GCCCTCAGCAAAATACCTTAAGG - Intergenic
1199844451 X:151680620-151680642 GCCCCTAAGACTATAACCTATGG + Intergenic