ID: 1079089488

View in Genome Browser
Species Human (GRCh38)
Location 11:17470754-17470776
Sequence CTGATTTTGTCTCCTCTCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 373}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079089482_1079089488 28 Left 1079089482 11:17470703-17470725 CCATTTTATGGGGTGAGGAAACT 0: 1
1: 0
2: 5
3: 32
4: 387
Right 1079089488 11:17470754-17470776 CTGATTTTGTCTCCTCTCTCGGG 0: 1
1: 0
2: 2
3: 35
4: 373
1079089481_1079089488 29 Left 1079089481 11:17470702-17470724 CCCATTTTATGGGGTGAGGAAAC 0: 1
1: 0
2: 4
3: 20
4: 229
Right 1079089488 11:17470754-17470776 CTGATTTTGTCTCCTCTCTCGGG 0: 1
1: 0
2: 2
3: 35
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079089488 Original CRISPR CTGATTTTGTCTCCTCTCTC GGG Intronic
901456898 1:9368237-9368259 CTGTTTCAGTCCCCTCTCTCTGG + Exonic
902780444 1:18701590-18701612 CTCATTTTCTTGCCTCTCTCTGG + Intronic
903064985 1:20694546-20694568 CTGTCCTTGTCCCCTCTCTCTGG - Intronic
904328173 1:29740819-29740841 CTTGTTTGCTCTCCTCTCTCAGG - Intergenic
904655881 1:32046669-32046691 CTGATTTTTTCTCTGCTCTGAGG + Intronic
905117988 1:35659176-35659198 AAGAGGTTGTCTCCTCTCTCAGG - Intergenic
909404260 1:75269069-75269091 GCGATTTTTTCTCCTCACTCTGG + Intronic
910747877 1:90593007-90593029 CTAACTTTTTCTTCTCTCTCAGG - Intergenic
910800393 1:91139068-91139090 CTGATTTTCCCACCACTCTCTGG - Intergenic
910867835 1:91804297-91804319 CTGTTTTTGTCTTCTCTTCCCGG + Intronic
912452991 1:109778792-109778814 CTCCATTTGTCTCCTCTGTCTGG + Intergenic
913012717 1:114700380-114700402 CTGACTTTATTTCCTGTCTCTGG + Intergenic
914775946 1:150735407-150735429 CTGATTTTCTTATCTCTCTCTGG + Intronic
915064664 1:153214988-153215010 CAGAGTTTGACTCCTCTCACTGG - Intergenic
915079137 1:153339398-153339420 CTGACTGTCTCTCCCCTCTCTGG - Intronic
917487606 1:175469017-175469039 GTCATTTTGACTCCTCCCTCAGG - Intronic
917950052 1:180022785-180022807 ATGATTTTGTCTCCTCTCCAGGG + Exonic
918150786 1:181796646-181796668 GTGCTTTTGTCACCTCTCACAGG + Exonic
918373110 1:183881530-183881552 GTGATGTTGTATCCTCTCACTGG + Intronic
919365880 1:196660150-196660172 CTGGCTTTGTCTCATCTTTCAGG - Intronic
919877273 1:201878844-201878866 CATATTTTGTCTCCTGTCTTTGG + Exonic
920266284 1:204725856-204725878 CTGACTTTGTGTACTCTTTCAGG - Intergenic
920731905 1:208495430-208495452 TTTACTTTTTCTCCTCTCTCAGG + Intergenic
921274394 1:213504770-213504792 TTGTTTTTTTCCCCTCTCTCTGG + Intergenic
921498224 1:215867057-215867079 GTGAGATTGGCTCCTCTCTCTGG + Exonic
922419443 1:225449642-225449664 TTGATTTGGTCTCCTCTACCCGG + Intergenic
922512242 1:226178637-226178659 CATATTTTTTCTCTTCTCTCTGG + Intronic
924214045 1:241801207-241801229 CTGATTTTTTCTCCTTACTTGGG - Exonic
924879245 1:248140591-248140613 TTAATTTTGTCTCCACTCTTGGG + Intergenic
1063093285 10:2886930-2886952 CTGACTTTCTCTCCTCCCTCAGG + Intergenic
1063406880 10:5804655-5804677 CTGGATTTGTCTCATCTCTGGGG - Intronic
1063558152 10:7100359-7100381 CTCTTTTTGTATCCTCTCCCAGG - Intergenic
1063677529 10:8154700-8154722 CTGATATTCGCTCCTCTCTGGGG - Intergenic
1064143689 10:12810689-12810711 CTGACTTTGTGTTCTCTCTGTGG - Intronic
1064283344 10:13970621-13970643 CTCATTTTTCCTCCTCTCACGGG - Intronic
1067187462 10:44043088-44043110 CTGATTCTGTCTCCTGTGCCTGG + Intergenic
1067530932 10:47072156-47072178 CAGATTCTGTTTCCTTTCTCTGG - Intergenic
1067785409 10:49242147-49242169 CTGACACTGTCTCCCCTCTCTGG + Intergenic
1069567306 10:69472375-69472397 CTGATTTAGTGTCTCCTCTCTGG + Intronic
1069598606 10:69688720-69688742 CTGATTTTGTTTCTCCTCTGGGG + Intronic
1070480293 10:76875604-76875626 GTGATTTGGTCTCCTCTGGCAGG - Intronic
1071354678 10:84782728-84782750 CTTATGTTTTCTTCTCTCTCAGG + Intergenic
1073270041 10:102254956-102254978 CTGAGTATGTCCCCTCACTCAGG - Intronic
1073639797 10:105240155-105240177 TTGATCTTGTCTCCTCCATCTGG - Intronic
1073864215 10:107783997-107784019 CTTATTTTCTCTCCTCTCTGAGG + Intergenic
1077527428 11:3075714-3075736 GTGAGTTTGCCTCCTCTCTTTGG - Intergenic
1078457880 11:11489531-11489553 CTGATTCTATCTTCTCTCTAGGG - Intronic
1079089488 11:17470754-17470776 CTGATTTTGTCTCCTCTCTCGGG + Intronic
1079500005 11:21092563-21092585 CTCAATTTTTCTCCTCTCTAGGG - Intronic
1080931158 11:36812704-36812726 CTGGTCTTGCCTCTTCTCTCAGG + Intergenic
1081083189 11:38768604-38768626 CTGATCTTCTGGCCTCTCTCGGG + Intergenic
1082792941 11:57359701-57359723 CTCCTTTTGGCTCCTCTCTTAGG + Intronic
1082990146 11:59200351-59200373 GTCAGTTTGTTTCCTCTCTCGGG + Intronic
1083457831 11:62790875-62790897 CTGGTCTTCTCTTCTCTCTCCGG - Exonic
1083600730 11:63945997-63946019 CTTATTTTGTCTCCACCCTGTGG + Intronic
1083650684 11:64202751-64202773 CTGATGTTGTCCCCTCTGTTTGG + Intronic
1085755276 11:79196775-79196797 CTCATTTTCTCTCCTCTTCCAGG + Intronic
1085852677 11:80139848-80139870 CTCATTTCGTTTTCTCTCTCGGG - Intergenic
1086213953 11:84354862-84354884 CTGTTTTTGTCTCTACTTTCAGG - Intronic
1087107506 11:94424886-94424908 CTTATTCTCTCTTCTCTCTCAGG - Intronic
1087720646 11:101661587-101661609 ATGATCTTGTCTCTTCTCGCAGG + Intronic
1088362454 11:109005333-109005355 CCTATGTTGTCTCTTCTCTCTGG + Intergenic
1088398069 11:109390680-109390702 CTCATTTTCTCTTCTCTCTGAGG - Intergenic
1088969579 11:114761153-114761175 CTGAGTTTGCCTCCTTTCTGAGG - Intergenic
1089728152 11:120501114-120501136 CTGAATTTCTCTCTTTTCTCTGG + Intergenic
1089942535 11:122434095-122434117 TTGTTTTTGTTTCCTGTCTCAGG - Intergenic
1090579728 11:128146629-128146651 CTTATTTTTCCCCCTCTCTCTGG - Intergenic
1090672276 11:128957111-128957133 CTGATTTCATCTCCTCTTCCAGG - Intergenic
1091031453 11:132192051-132192073 CTTGTTTTCTCTCCTCTTTCAGG - Intronic
1091394855 12:147847-147869 CAGATTTAGCTTCCTCTCTCTGG + Intronic
1091581246 12:1791480-1791502 CTGGTTTTGTCTGCTTCCTCTGG - Intergenic
1091682361 12:2536212-2536234 CTCATTTTCTCTCTTCTCTGGGG - Intronic
1091842098 12:3628540-3628562 CTGACCTTGCCCCCTCTCTCTGG - Intronic
1091965878 12:4741165-4741187 GTCATTTTGTTTGCTCTCTCAGG - Intronic
1092080745 12:5713954-5713976 CTCCTTCTGTCTCCTTTCTCTGG - Intronic
1092126631 12:6079295-6079317 CTGTTTCTGTGTCCTGTCTCAGG - Intronic
1092523609 12:9296123-9296145 CTGTTGTTGCCTCCTCTCCCTGG + Intergenic
1092543688 12:9435776-9435798 CTGTTGTTGCCTCCTCTCCCTGG - Intergenic
1092608990 12:10152412-10152434 CTTACTCTCTCTCCTCTCTCAGG + Intergenic
1092678747 12:10953171-10953193 CTGATTCTTTCTCATCTCTGTGG - Intronic
1092948146 12:13475668-13475690 CTGCTTTTTTCTCCTCCTTCAGG + Intergenic
1093431082 12:19085593-19085615 GTGATCTGGTCTCCTCACTCTGG + Intergenic
1093572909 12:20689249-20689271 GTGAATTTTACTCCTCTCTCAGG + Intergenic
1093785639 12:23189023-23189045 CTGATTTTGTCACCTTTCTCAGG - Intergenic
1094509256 12:31086275-31086297 CTGTTGTTGCCTCCTCTCCCTGG + Intronic
1095195733 12:39313971-39313993 ATGCTGTTGTATCCTCTCTCCGG - Intronic
1096048866 12:48588209-48588231 CTTATTCTCTTTCCTCTCTCAGG - Intergenic
1096518124 12:52169491-52169513 CTGTTTTTATCTCCCCTCTCAGG - Exonic
1099619468 12:84983007-84983029 CTCAGTTTGTCTCCTCAATCTGG - Intergenic
1101627909 12:106463578-106463600 CTGAATTTGTCTCCAATTTCTGG - Exonic
1102796622 12:115694677-115694699 CTGATTTCTTCTCATCACTCAGG - Intergenic
1102919270 12:116779631-116779653 ATGCTTTTTTTTCCTCTCTCAGG - Intronic
1103164546 12:118758859-118758881 CTGAGGTTGTCTCCTCTATTTGG + Intergenic
1105626768 13:22120364-22120386 CTCAGATTGTCTCCTCTCTGCGG - Intergenic
1106085881 13:26541209-26541231 CTAAATCTGACTCCTCTCTCGGG - Intergenic
1106622375 13:31383095-31383117 CAGATTTTGTCTTCTGTGTCTGG + Intergenic
1108034365 13:46273231-46273253 CCCATTTTGTTTCCTCTTTCTGG - Intronic
1108155506 13:47580287-47580309 TTTACTTTTTCTCCTCTCTCAGG - Intergenic
1109582486 13:64360721-64360743 CTGATAGTTTCTCCTCTGTCTGG + Intergenic
1110516760 13:76422037-76422059 CTGCTGTTGTCTCCTCTATGGGG + Intergenic
1111686375 13:91506111-91506133 CTTATTTACTCTCCTGTCTCAGG - Intronic
1111852020 13:93587759-93587781 CTGAGTTTGTGTCCACTCTGAGG - Intronic
1112937024 13:104813601-104813623 CTGAATTTCTCCCCTCTCTGAGG + Intergenic
1113944402 13:114035713-114035735 CGGACTTCGTCTCCTCTCTGCGG - Intronic
1115714383 14:36086523-36086545 CTGATGTTATCCCCTCTGTCTGG - Intergenic
1117327244 14:54680894-54680916 CTGCTTTATTCTTCTCTCTCTGG - Intronic
1117566663 14:57000506-57000528 CTTACTTTGTCTGTTCTCTCTGG + Intergenic
1118347931 14:64953213-64953235 CTGAGCTTATCTCCTCCCTCTGG + Intronic
1120206161 14:81589627-81589649 CTCAGTTTGGCTCCTCCCTCAGG - Intergenic
1121308881 14:92924041-92924063 CTGATTTTGTTTCCCTTCCCTGG - Intronic
1123455967 15:20426323-20426345 CGTATTCTCTCTCCTCTCTCAGG + Intergenic
1123635603 15:22304514-22304536 CGTATTCTCTCTCCTCTCTCAGG - Intergenic
1123796589 15:23778293-23778315 CTGATTTCGATTCCTCTCACTGG + Intergenic
1124060359 15:26288311-26288333 CTGATATTTTTTCCTCTCTATGG + Intergenic
1126361839 15:47854457-47854479 CTAATTTTGGCAACTCTCTCTGG + Intergenic
1126740286 15:51770199-51770221 CTGAGTTCTTTTCCTCTCTCAGG + Intronic
1126773136 15:52077371-52077393 CTGACTGTGCCTCCTGTCTCTGG - Intergenic
1127107118 15:55628240-55628262 CTGCCTTTGCCTCCTCTCTGGGG - Intronic
1127207134 15:56733111-56733133 CTGGTTTTGGCTTTTCTCTCTGG - Intronic
1128219497 15:65958223-65958245 CAGATGTGGCCTCCTCTCTCTGG + Intronic
1129241441 15:74254625-74254647 CTGATTTTCTACCCTGTCTCTGG + Intronic
1130041397 15:80407623-80407645 CTGATTTTCTCTTTTCTCTCTGG + Intronic
1131034027 15:89209502-89209524 CTTTTTTTGTCTTCACTCTCAGG - Intergenic
1131590765 15:93746543-93746565 CTGCTTTTGTTTGCTCTCCCTGG - Intergenic
1134614957 16:15643570-15643592 CTTTTTTTTTTTCCTCTCTCGGG + Exonic
1134746814 16:16595038-16595060 ATGATTCGGGCTCCTCTCTCTGG - Intergenic
1134998660 16:18758625-18758647 ATGATTCGGGCTCCTCTCTCTGG + Intergenic
1137246619 16:46711218-46711240 CTGATTCTCTATCCTCCCTCAGG - Intronic
1137934919 16:52625590-52625612 CTGATGTTATCTCTTTTCTCTGG + Intergenic
1138696157 16:58815389-58815411 CTGCTTTTATGCCCTCTCTCTGG + Intergenic
1139265866 16:65637626-65637648 CTGATGTTGGGTCCTTTCTCTGG - Intergenic
1139305762 16:65984907-65984929 CTGTCTTAGTCTCCTTTCTCTGG - Intergenic
1140018879 16:71217340-71217362 ATGATTTTGGCTCCTCATTCTGG - Intronic
1140043896 16:71426906-71426928 CTGCTATTGTCCCCTCTCCCAGG + Intergenic
1141062938 16:80891625-80891647 CTGATTTTGTCTTCTTCCTTAGG - Intergenic
1141165566 16:81658615-81658637 CACATTTTGTTTCTTCTCTCTGG - Intronic
1142285159 16:89168655-89168677 CTGTGTTTGTCTCCTCACCCCGG + Intergenic
1142541901 17:666269-666291 CTGATTTTTTCTCATGTCACTGG - Intronic
1143071574 17:4299740-4299762 CTGAGTTTTTCTCCTATCTGTGG + Intronic
1143442678 17:6987590-6987612 CAGATTTTATCTCCTCCCTCGGG + Intronic
1143765796 17:9136981-9137003 CAGAAGTTGACTCCTCTCTCAGG + Intronic
1144054084 17:11523453-11523475 ATGCTCTTTTCTCCTCTCTCAGG - Intronic
1145257880 17:21337515-21337537 CTGATTTTGTCTCCGCATCCGGG + Intergenic
1145318753 17:21750491-21750513 CTGATTTTGTCTCCGCATTCGGG - Intergenic
1145876464 17:28321986-28322008 CTGATTTTGTTGCTTCTCTATGG + Intronic
1146355532 17:32130938-32130960 CCTATTTTGTCCTCTCTCTCTGG - Intergenic
1147021947 17:37541791-37541813 CTGATTTTGACTCCCGTCTCAGG + Intronic
1148472389 17:47903187-47903209 CTGATTTTGTCTAGTCTCGTGGG - Intronic
1151116611 17:71742814-71742836 CTTATTAGGTCTCCACTCTCTGG - Intergenic
1151224544 17:72638904-72638926 CTGATATAGTCTCCATTCTCTGG - Intergenic
1152117277 17:78396286-78396308 TTGAATTTTTCTCCTCTCTCAGG + Exonic
1152492585 17:80647535-80647557 CTGGTGTTGTCCACTCTCTCTGG - Intronic
1154023597 18:10686312-10686334 TTGAATTTCTCTTCTCTCTCTGG + Intronic
1154193767 18:12251589-12251611 CTGGTTTTGCCTCCTCTAGCTGG - Intergenic
1155060501 18:22223996-22224018 TTTATTTTTTCTCTTCTCTCTGG + Intergenic
1156284693 18:35680194-35680216 CTGATTTTGTTCCCTCTCCCTGG + Intronic
1156604751 18:38653189-38653211 CTGATTTCATCACCTCTCTCGGG - Intergenic
1156754141 18:40500272-40500294 GTGATTATGTTTCCTCTCGCTGG + Intergenic
1157885368 18:51361238-51361260 CTGATTTTGTCTGCACCCCCTGG + Intergenic
1158660953 18:59387025-59387047 CTGCTTTTGTCTCCTCTAATTGG - Intergenic
1159649207 18:70957215-70957237 CTGAGTTTCTCTCTTCTCTTAGG + Intergenic
1160063053 18:75549795-75549817 CTGATTTCGCCTCATCCCTCAGG - Intergenic
1162855319 19:13463567-13463589 CTGGTTTTGTTTTCTCTCCCCGG - Intronic
1163091647 19:15024095-15024117 CTGATGTGGTCCCCACTCTCAGG + Intergenic
1164499174 19:28799487-28799509 CTTATTCTCTCTCCTCTCTCAGG - Intergenic
1165823359 19:38691521-38691543 CTGGTTTTGTCTCATCACTCAGG - Intronic
1167428687 19:49442472-49442494 CTGAATTTGTCTCCTCCCCTAGG + Intergenic
1167599428 19:50445750-50445772 CTCATTATGTCTCCTCCCTCCGG + Intronic
1168136055 19:54352499-54352521 CTAATTTTCTGTCTTCTCTCTGG + Exonic
925821676 2:7805128-7805150 CTGCCTTTGGCTCCTCACTCTGG - Intergenic
926720099 2:15953644-15953666 CTGCTCTTTTGTCCTCTCTCAGG - Intergenic
927401235 2:22713768-22713790 CTTACTTTTTCTTCTCTCTCAGG + Intergenic
927922682 2:26985575-26985597 CTGATTAGGTCTCCTCTCACTGG - Intronic
928061512 2:28117818-28117840 CTGATACCCTCTCCTCTCTCAGG - Intronic
929626852 2:43418203-43418225 CATATTATGTCTACTCTCTCTGG + Intronic
929679085 2:43970354-43970376 CTTTCTTTGTCTGCTCTCTCAGG - Intronic
930228957 2:48824390-48824412 CTAATTTTGGCTGCTCTTTCTGG + Intergenic
930375740 2:50564447-50564469 GTAATTTTATCTCATCTCTCTGG + Intronic
930422573 2:51171820-51171842 CTGAAATCTTCTCCTCTCTCTGG + Intergenic
930615145 2:53585760-53585782 TTGTTTATGTCTCCTCTCACTGG + Intronic
931191010 2:60000309-60000331 CTGATTTTGGCTGTTCTCCCTGG - Intergenic
931250245 2:60524309-60524331 ATAATTTTGTCACCTATCTCTGG + Intronic
931681069 2:64750534-64750556 CTGATTTTATTTTCCCTCTCTGG - Intronic
931697087 2:64879489-64879511 CTGATCTTGTCACCCCTCCCTGG - Intergenic
932977638 2:76623769-76623791 CTTATTCTCTCTCCTCTCTTAGG + Intergenic
933085938 2:78053788-78053810 TTGATTTTCTCTCTTCTCTATGG + Intergenic
933513237 2:83267546-83267568 CTCATTTTGTCTACACTTTCAGG - Intergenic
933613906 2:84464206-84464228 CTGATTCTGTCAGCTCTCTCTGG + Intergenic
934152564 2:89161656-89161678 CTTTTTTTGTATTCTCTCTCTGG - Intergenic
935851746 2:107229132-107229154 CTGAAACTTTCTCCTCTCTCTGG + Intergenic
937411111 2:121676902-121676924 CTGATTTTTTTTTCTCTCTGCGG - Intergenic
938262875 2:129907572-129907594 CAGATGGTGGCTCCTCTCTCTGG - Intergenic
938508229 2:131909582-131909604 CTGTTTTTCTCTACTCTCTCAGG + Intergenic
939125846 2:138176743-138176765 CTCCTTTTCTCTTCTCTCTCAGG - Intergenic
939880238 2:147623079-147623101 CTCCTTTTGTCTGCTCACTCTGG + Intergenic
940019678 2:149143976-149143998 CTGATCTCATCTCATCTCTCAGG - Intronic
940502823 2:154515641-154515663 AGGATTTTGTTTCCTCTATCTGG + Intergenic
941949934 2:171144768-171144790 CTGCTTTTGTCTTCTCTTTATGG - Intronic
941961343 2:171256801-171256823 TTGAATTTGCCTCCTCTCTCTGG + Intergenic
943351710 2:186804584-186804606 CTTGTTTTCTCTCCTCTTTCAGG + Intergenic
944993029 2:205259645-205259667 CTCATTCTGTCTCCTCTTTGTGG + Intronic
946701201 2:222416110-222416132 CAGGTTTTGTCTGGTCTCTCAGG - Intergenic
948183926 2:236004157-236004179 CTCATTTTGTCTCCTGACTGTGG + Intronic
1168731097 20:81650-81672 CTTATTCTTTCTCCTCTTTCAGG - Intergenic
1169406588 20:5326442-5326464 CTGCTTGTGTCTCCCCTCTCTGG + Intergenic
1170658449 20:18313685-18313707 CTGATTTTGTGTTCTATTTCTGG - Intronic
1170808058 20:19651419-19651441 CTGCTTTCCTCTCCTCTGTCTGG + Intronic
1170987827 20:21274519-21274541 CTGATTATGTCTCATCTGACAGG - Intergenic
1172832988 20:37852500-37852522 CTCATAGTGGCTCCTCTCTCTGG + Intronic
1172834161 20:37862213-37862235 CTCATTTTGCCTCCTCCCTAAGG + Intronic
1173399109 20:42708924-42708946 GGGATTTGGTGTCCTCTCTCTGG - Intronic
1173441172 20:43077607-43077629 CTGGCTTTTTCTACTCTCTCTGG - Intronic
1173959912 20:47062880-47062902 CAGATATAGTCTCTTCTCTCGGG + Intronic
1174537040 20:51259268-51259290 CCGATTTTGTTTCTTCTCTGGGG - Intergenic
1174973500 20:55305227-55305249 CTGATTCTGTCTCATCTGTGTGG + Intergenic
1175615088 20:60391025-60391047 CTCACTTTGTCCACTCTCTCTGG - Intergenic
1175811055 20:61857426-61857448 CTGATTTTGGTTCCACTTTCTGG - Intronic
1176785262 21:13248982-13249004 CTGTTTTTCTCTACTCTCTCAGG - Intergenic
1176865433 21:14049733-14049755 CTAAATTTCTTTCCTCTCTCTGG - Intergenic
1177825990 21:26083964-26083986 CTGGTATTGTGTCCTCTTTCTGG - Intronic
1178201351 21:30409768-30409790 TTTACTTTTTCTCCTCTCTCAGG - Intronic
1178643193 21:34363277-34363299 CTGTTCTTGGCTCCTCTCCCTGG + Intergenic
1179330864 21:40399907-40399929 CTGCTTTTTTCTCCTGTCCCTGG + Intronic
1179958401 21:44754067-44754089 TTGACTTTCTATCCTCTCTCGGG - Intergenic
1180195994 21:46194671-46194693 GTGATGGTGTCTCCTGTCTCTGG - Intronic
1181758462 22:25041413-25041435 CTGCTCTCGCCTCCTCTCTCTGG - Exonic
1182810280 22:33110406-33110428 CAGATATTGTCCTCTCTCTCTGG + Intergenic
1182911175 22:33985861-33985883 CTCATTTAGATTCCTCTCTCTGG - Intergenic
1185417768 22:50719745-50719767 CAGAGTTTGTGTCCTTTCTCAGG + Intergenic
949792506 3:7808735-7808757 CTCCTATTCTCTCCTCTCTCTGG + Intergenic
949862934 3:8522761-8522783 CTTTTTTTCTTTCCTCTCTCAGG - Intronic
950148272 3:10667076-10667098 CTGACTGTGTTTCCTCTCTTGGG + Intronic
950730884 3:14956264-14956286 CTTATTTTTTATCCTCTCTCAGG + Intronic
950922964 3:16714627-16714649 CTGATTCTTTCTCATCTGTCAGG + Intergenic
951252401 3:20409444-20409466 CTTACTTTGTCTTCTTTCTCTGG - Intergenic
951822561 3:26828296-26828318 CTGATTCTTTCTCATCTCTGTGG - Intergenic
952218986 3:31305171-31305193 CTGAGTGTGCCTCCTGTCTCTGG - Intergenic
952819590 3:37474848-37474870 GTGTTTTTGTCCCCTCTCTAAGG + Intronic
953530054 3:43732402-43732424 CAGATTTTGCTTCCTCACTCAGG - Intronic
953711533 3:45275243-45275265 ATTCTTTTGTCTCCTCTCTTGGG + Intergenic
953934458 3:47028188-47028210 CTCATTTTGTCCCTTGTCTCAGG - Intronic
955108779 3:55927024-55927046 CTGATTTGCCCTCCACTCTCAGG - Intronic
956096725 3:65724280-65724302 CTGATTCTGTTTCATCTCTCAGG + Intronic
957209522 3:77240801-77240823 CTGATTTTCTCTGTTCTATCTGG - Intronic
957254928 3:77824944-77824966 CTGATTTTTTCTCTTCTGTAGGG + Intergenic
958497327 3:94862188-94862210 TTTACTTTTTCTCCTCTCTCAGG + Intergenic
958623539 3:96594975-96594997 TTTATTTTGTTTCTTCTCTCGGG + Intergenic
958793702 3:98682898-98682920 CTGGTTTTGTCTCATCTTTGTGG - Intergenic
959444294 3:106418856-106418878 CTGATTATATCTCCACACTCTGG - Intergenic
960116889 3:113904066-113904088 ATGATTTGGTCTCCTCACTGAGG - Intronic
960472451 3:118083983-118084005 CACATTTTGTCTCCTCCCACTGG + Intergenic
960567078 3:119145589-119145611 TGGATCTTCTCTCCTCTCTCTGG + Intronic
961559754 3:127720426-127720448 CTGGTTTCATCTCCTTTCTCGGG + Intronic
963381595 3:144537249-144537271 TTGTTTATGTCCCCTCTCTCGGG + Intergenic
963814616 3:149815564-149815586 CTAATTTTGTTTCCTCTTTTGGG - Intronic
963913873 3:150840407-150840429 CTGATTCTTTCTCATCTCTGTGG + Intergenic
965162767 3:165155939-165155961 CTGATTTTGAATCCTAACTCTGG + Intergenic
965614830 3:170584027-170584049 CTGATTTTGAATCCAATCTCTGG + Intronic
966609160 3:181851016-181851038 ATGATTTTCTCTTCTCTTTCAGG - Intergenic
968227105 3:196979670-196979692 CTCCTTGTGTCTCCTTTCTCAGG + Intergenic
969340148 4:6535320-6535342 CTGTGTTAGTCACCTCTCTCAGG - Intronic
969408367 4:7010631-7010653 GTGCCTTTCTCTCCTCTCTCAGG + Exonic
969898840 4:10329818-10329840 CTCATTCTGTCTCTTCTCCCTGG + Intergenic
970170934 4:13290136-13290158 CTGATTCTTTCTCCTCTGTGTGG + Intergenic
970290976 4:14572025-14572047 CTGATTTTTCCTCCACTCTCTGG - Intergenic
970405024 4:15754417-15754439 CTAAGATTGTCTCCTCTCTAAGG + Intergenic
970586831 4:17522637-17522659 TTGATTTTGTGTCCACTCTAAGG + Intronic
971253133 4:24989797-24989819 CTGATTTGGTCTCCGACCTCAGG - Intergenic
972215213 4:36890577-36890599 CTGATTTTTTCTCTTCTGTGTGG + Intergenic
972443547 4:39120406-39120428 CTGAGTTTGTTTCCACTCCCAGG + Intronic
972952016 4:44338433-44338455 GTGATTTGTTCTACTCTCTCTGG - Intronic
973926821 4:55747432-55747454 CAGAGCTTGCCTCCTCTCTCTGG + Intergenic
975024997 4:69536600-69536622 CTGATTCTTTCTCCCATCTCTGG - Intergenic
975526471 4:75355949-75355971 TTTATTTTGTCTCCTTTCTCTGG + Intergenic
978373730 4:108053674-108053696 CTGTGTTTGTCTCCTCTGTGAGG + Intronic
978841171 4:113214408-113214430 AGCATTTTGGCTCCTCTCTCCGG - Intronic
979450796 4:120868561-120868583 CTAAGTTTGTATCATCTCTCTGG - Intronic
980016823 4:127659365-127659387 TTCATTTTGTCTCTTCTCTCTGG - Intronic
980264859 4:130502312-130502334 CTGCTTTTATCTCCTATTTCAGG + Intergenic
980863215 4:138523310-138523332 CTTATTCTTTCTTCTCTCTCAGG - Intergenic
981332045 4:143522013-143522035 CTGCATTTGTTTCCTCTCTGAGG - Intronic
981596507 4:146429618-146429640 CTGATCTTCTCTCCCATCTCTGG - Intronic
981704863 4:147648270-147648292 TTCAGTGTGTCTCCTCTCTCTGG - Intronic
982800692 4:159702728-159702750 CTACTTTTGCCTCCTCTCTGAGG + Intergenic
984096998 4:175446629-175446651 ATGATCTTGTCTCCGCTCCCTGG + Intergenic
984132287 4:175892930-175892952 CTGTTGATGTCTCCTCTCTTTGG + Intronic
985514820 5:336166-336188 CAGATTTAGTCTCCTGTGTCAGG + Intronic
986307425 5:6525893-6525915 GTGATTTAGTGTCTTCTCTCTGG - Intergenic
986545649 5:8893774-8893796 CTGAATATGTCTACTATCTCCGG - Intergenic
986800232 5:11252267-11252289 CTGAGTTTGTTTGCTTTCTCTGG - Intronic
987060930 5:14243170-14243192 CTGCTTCTGTGTCCCCTCTCCGG + Intronic
987239993 5:15986342-15986364 CTTATTTTGTTTCCTCTTTGCGG + Intergenic
988775893 5:34477843-34477865 CTTCTTCTGACTCCTCTCTCAGG - Intergenic
989603864 5:43225326-43225348 CTTATTTTGATACCTCTCTCTGG + Intronic
990315384 5:54578325-54578347 CAGATTCTATCTCCTGTCTCTGG - Intergenic
994613909 5:102079116-102079138 CTGTTTTTTTCTCATCTCTGTGG - Intergenic
996081400 5:119261969-119261991 CAGATCTTGGCTCCTCCCTCTGG + Intergenic
996211756 5:120819099-120819121 GTGATTTTATTTCCTCTCTGTGG + Intergenic
998985181 5:147748888-147748910 CTGCTTGGGACTCCTCTCTCTGG + Intronic
999481918 5:151956494-151956516 CTGCTGTTGTCTCATCTCCCTGG + Intergenic
999803728 5:155062368-155062390 CTCGTGTTGTCTCCTCTCTTGGG + Intergenic
999859593 5:155631510-155631532 CTGGTTTTGGATCCTCTCTCTGG - Intergenic
1000092468 5:157941705-157941727 CTGTTTTTGTTTCTTTTCTCAGG + Intergenic
1002030406 5:176424489-176424511 CTGTTTGTTTCTCTTCTCTCAGG + Intergenic
1003385253 6:5661488-5661510 CAGATTTGCTCTCCTCTATCTGG - Intronic
1004090505 6:12495303-12495325 CTGATTCTTTCTCATCTTTCTGG - Intergenic
1004308440 6:14522178-14522200 CTGTTTATGTCCCCTTTCTCTGG + Intergenic
1004962794 6:20810695-20810717 TTCATTCTCTCTCCTCTCTCTGG + Intronic
1006238626 6:32658191-32658213 CTGATTTTGTCCTCTTCCTCAGG - Intergenic
1007841511 6:44720057-44720079 AGGATTTTGTCTCCTCACCCAGG + Intergenic
1009325213 6:62340307-62340329 TTTATTCTCTCTCCTCTCTCAGG - Intergenic
1009443487 6:63711430-63711452 CTGATTCTGCCTTCTTTCTCAGG + Intronic
1009775288 6:68197503-68197525 CTCACCTTCTCTCCTCTCTCAGG - Intergenic
1009803409 6:68571950-68571972 CTTACTTTGTCTTCTCTCTCAGG + Intergenic
1012337068 6:98073465-98073487 CTCACTTTGTTTCCTATCTCAGG - Intergenic
1012691434 6:102317864-102317886 CTGATATATTCTCCTCTCTTAGG - Intergenic
1013015947 6:106160747-106160769 TTGGTTTTGACTCCTCTCTGAGG - Intergenic
1013376704 6:109523669-109523691 CTGGTTTTGGCTCCTTTCTCTGG - Intronic
1013672514 6:112420993-112421015 CTTCTTTTGTCTCCTCTGACAGG + Intergenic
1014318606 6:119897582-119897604 CTGATTTTTTCCCCTCTCCTGGG + Intergenic
1014852595 6:126360530-126360552 CTTATTCTCTCTCCTCTCTCAGG + Intergenic
1015350104 6:132208687-132208709 TTTATTTTTTCTTCTCTCTCAGG + Intergenic
1015825777 6:137309905-137309927 CTCATTTTCTTTCCCCTCTCAGG + Intergenic
1016629816 6:146215345-146215367 CTTTTTTTGTCTTTTCTCTCTGG + Intronic
1017439708 6:154452508-154452530 ATGATTTTCTCTTCTCTCTTGGG + Intronic
1018172199 6:161152084-161152106 CTGCTTTTCTCTCTCCTCTCCGG + Intronic
1020038634 7:4983705-4983727 ATGATTCTGTCTTCTCTCTTTGG - Intronic
1020156665 7:5730761-5730783 ATGATTCTGTCTTCTCTCTTTGG + Exonic
1020383423 7:7570230-7570252 ATCATCTTGTCTCCTCACTCAGG - Intronic
1020570845 7:9859116-9859138 CTGCTTTCCTCTCCTCTCTTTGG - Intergenic
1021132697 7:16930233-16930255 GTGATTTTGTGTCTTCTCCCAGG + Intergenic
1021351626 7:19601410-19601432 ATTGTTTTTTCTCCTCTCTCAGG + Intergenic
1022151954 7:27617517-27617539 CTAATTTTGGCTCTTCTTTCTGG - Intronic
1023346058 7:39272348-39272370 CTGATCTGGCCTCCTCCCTCTGG + Intronic
1024182775 7:46913664-46913686 GTGATTTTGTATTCTCTCTTAGG + Intergenic
1025159114 7:56637462-56637484 CTGATTTTCTCTCATCTCTGTGG - Intergenic
1025727472 7:64080723-64080745 CTGATTTTGTCTCATCTTTGTGG + Intronic
1027627374 7:80563294-80563316 CTGATTATTTCTCATCTCTGTGG + Intronic
1028625300 7:92870722-92870744 CTCATTTTTTCTCCTCCTTCAGG - Intergenic
1030401241 7:109053184-109053206 CTCATTGTGTCTCTCCTCTCTGG + Intergenic
1030721012 7:112870087-112870109 CTTGTTTTCTCTTCTCTCTCAGG - Intronic
1031425179 7:121596476-121596498 CTGATTTTCTCATCTCTCTGGGG - Intergenic
1033856416 7:145566662-145566684 CTGTTTATGGCTCCTTTCTCAGG - Intergenic
1034448413 7:151125085-151125107 CTCATTTGATCCCCTCTCTCCGG + Intronic
1035795498 8:2352931-2352953 CAAATTGTGTCTCCTCTCACAGG + Intergenic
1036487713 8:9194697-9194719 CTCCTTTTGTCTCCTGTCTGTGG + Intergenic
1037737121 8:21576863-21576885 CTGATTCTGTCTCATCTTTTGGG - Intergenic
1038890666 8:31719086-31719108 CTGATTTTGTTTCATTTCCCCGG + Intronic
1039820618 8:41130816-41130838 CTGATTTTCTCTCATCTTTGTGG - Intergenic
1040372076 8:46787347-46787369 CTGACTTTGTCTCATCTTTGTGG + Intergenic
1041765602 8:61415162-61415184 CTGTTTTTCTCTACTCTCACAGG + Intronic
1042486057 8:69346874-69346896 CTGCTTTTGTCACATCCCTCAGG - Intergenic
1042535352 8:69853172-69853194 CTGTTTTGGTCTCCTTTATCAGG - Intergenic
1043511992 8:80959020-80959042 CTGACTTTGTATGCGCTCTCAGG + Intergenic
1043698964 8:83259466-83259488 CTGACTTTGTTTCTTCTATCTGG + Intergenic
1044916188 8:97114833-97114855 CTCATTTCATTTCCTCTCTCTGG + Intronic
1045086033 8:98686963-98686985 CTCACTTTCTCTTCTCTCTCAGG - Intronic
1046733394 8:117750238-117750260 ATGATTTTCTCTGCTCTATCAGG + Intergenic
1047590522 8:126322097-126322119 CTCATATTGTTTCCTCTCTCTGG + Intergenic
1047939399 8:129814532-129814554 TTTACTTTTTCTCCTCTCTCAGG + Intergenic
1048691967 8:136976111-136976133 CTGAGTTTATCTACTCTCACAGG - Intergenic
1048857154 8:138695058-138695080 CTGATTCTGACTCATCTTTCAGG + Intronic
1050245927 9:3689623-3689645 CTGAATTTGTTTATTCTCTCTGG - Intergenic
1050375163 9:4964153-4964175 ATGATTCTGCCTCCTCTCTATGG + Intergenic
1050966526 9:11810833-11810855 CTTGTTTTATCTCCTCTTTCAGG + Intergenic
1053542792 9:38992775-38992797 CTGATTCTTTCTCATCTCTGTGG + Intergenic
1053618660 9:39794430-39794452 CTCACTAGGTCTCCTCTCTCAGG + Intergenic
1053807239 9:41816292-41816314 CTGATTCTTTCTCATCTCTGTGG + Intergenic
1053876837 9:42553792-42553814 CTCACTAGGTCTCCTCTCTCAGG + Intergenic
1053895839 9:42740913-42740935 CTCACTAGGTCTCCTCTCTCAGG - Intergenic
1054234860 9:62547930-62547952 CTCACTAGGTCTCCTCTCTCAGG - Intergenic
1054265495 9:62912999-62913021 CTCACTAGGTCTCCTCTCTCAGG - Intergenic
1054623353 9:67371135-67371157 CTGATTCTTTCTCATCTCTGTGG - Intergenic
1054910786 9:70453418-70453440 CTAATTTTGTCTCCTCTGCCTGG - Intergenic
1055111792 9:72567051-72567073 CTGCTTATGTCTCCTGCCTCAGG + Intronic
1055343449 9:75309356-75309378 CTGCTTTTCTTTGCTCTCTCTGG + Intergenic
1055666651 9:78559832-78559854 CTCCTTGTGTCTCCACTCTCTGG + Intergenic
1055988578 9:82079993-82080015 CTGAGTTTATCTCTTGTCTCTGG - Intergenic
1055990484 9:82100918-82100940 CTTATTCTGTCTCCTCTCTCAGG + Intergenic
1056510680 9:87302035-87302057 CTGGTTTTGTGTCATCTCACTGG - Intergenic
1057583009 9:96304383-96304405 CTGTTGCTGTCTCCTCTCTCTGG + Intergenic
1059438366 9:114289473-114289495 CTGATTGTCCCTCCTCACTCAGG - Intronic
1059476139 9:114549431-114549453 CTGGTTATGTATCCTCTCTCAGG - Intergenic
1060209535 9:121701184-121701206 CTGAGTGTGTCTGCTCTCCCGGG + Intronic
1060212433 9:121718776-121718798 CTCGTGTTGTGTCCTCTCTCTGG + Intronic
1060557029 9:124513315-124513337 CTGTTTTTCTTTTCTCTCTCTGG + Intergenic
1060566843 9:124600351-124600373 CTCATTCTTTCTCCACTCTCAGG - Intronic
1061640959 9:131954736-131954758 CTGAAGTTGTCCCCTTTCTCTGG - Intronic
1185980136 X:4770176-4770198 ATGAGTTGGTCTCCTCACTCAGG - Intergenic
1186677982 X:11840675-11840697 GTGATTTTGTGCCCTTTCTCAGG + Intergenic
1187273487 X:17799458-17799480 ATGACTTTGTCTTCTCTCCCTGG + Intergenic
1188043435 X:25397808-25397830 TTTACTTTTTCTCCTCTCTCTGG - Intergenic
1188886852 X:35561354-35561376 CTGGTTTTGTCTTATCTGTCTGG - Intergenic
1191162581 X:57347168-57347190 ATTATTCTCTCTCCTCTCTCAGG + Intronic
1191604727 X:63048750-63048772 CTTACTTTTTCTTCTCTCTCAGG + Intergenic
1191940393 X:66473861-66473883 CAGATTTTATTTCATCTCTCAGG + Intergenic
1192429837 X:71104358-71104380 CTGAATTCGTCTCCTCTCCAGGG + Exonic
1193617501 X:83708450-83708472 ATTATTTTCTCTTCTCTCTCAGG + Intergenic
1194029003 X:88788986-88789008 CTGATTCTTTCTCATCTTTCTGG + Intergenic
1194356750 X:92895399-92895421 CTGATTCTTTCTCATCTCTGTGG + Intergenic
1194596509 X:95865542-95865564 ATTATTTTCTCTTCTCTCTCAGG - Intergenic
1195469156 X:105213008-105213030 CTGATTTTTCCTCATCTCTGTGG - Intronic
1195614686 X:106903062-106903084 CTCATTTTCCTTCCTCTCTCAGG + Intronic
1195903695 X:109824095-109824117 GTGTTTTTGTCTCCTTTCCCTGG + Intergenic
1196492253 X:116281529-116281551 TTTATTTTGTCTCCTCACTGAGG + Intergenic
1196696306 X:118616559-118616581 TTGTGTGTGTCTCCTCTCTCAGG + Intronic
1197303008 X:124804112-124804134 ATGATTTTCTCTCTTCTCCCTGG + Intronic
1197875111 X:131094423-131094445 CTGTTTCTCTCTCCTCTTTCTGG + Intergenic
1198615305 X:138452141-138452163 CTGCTTTGGTCTAGTCTCTCTGG - Intergenic
1199099282 X:143780219-143780241 CTTATTCTCTCTCCTCTCACAGG + Intergenic
1200665084 Y:6012399-6012421 CTGATTCTTTCTCATCTCTGTGG + Intergenic