ID: 1079091626

View in Genome Browser
Species Human (GRCh38)
Location 11:17484625-17484647
Sequence CTCTGGCCAAGTACCAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079091626_1079091628 -4 Left 1079091626 11:17484625-17484647 CCTTCTCTGGTACTTGGCCAGAG No data
Right 1079091628 11:17484644-17484666 AGAGAAGAACCTCTCCAGTCAGG No data
1079091626_1079091632 16 Left 1079091626 11:17484625-17484647 CCTTCTCTGGTACTTGGCCAGAG No data
Right 1079091632 11:17484664-17484686 AGGGCAAACAGAAACCTGAAAGG No data
1079091626_1079091629 -3 Left 1079091626 11:17484625-17484647 CCTTCTCTGGTACTTGGCCAGAG No data
Right 1079091629 11:17484645-17484667 GAGAAGAACCTCTCCAGTCAGGG No data
1079091626_1079091633 17 Left 1079091626 11:17484625-17484647 CCTTCTCTGGTACTTGGCCAGAG No data
Right 1079091633 11:17484665-17484687 GGGCAAACAGAAACCTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079091626 Original CRISPR CTCTGGCCAAGTACCAGAGA AGG (reversed) Intergenic
No off target data available for this crispr