ID: 1079092312

View in Genome Browser
Species Human (GRCh38)
Location 11:17489584-17489606
Sequence CACCAAGTAGTGCAACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079092312_1079092315 0 Left 1079092312 11:17489584-17489606 CCCTGGGGTTGCACTACTTGGTG No data
Right 1079092315 11:17489607-17489629 GAATACATTTAGAATAGCAGAGG No data
1079092312_1079092317 19 Left 1079092312 11:17489584-17489606 CCCTGGGGTTGCACTACTTGGTG No data
Right 1079092317 11:17489626-17489648 GAGGCCATCTTGGCATCATGTGG No data
1079092312_1079092316 9 Left 1079092312 11:17489584-17489606 CCCTGGGGTTGCACTACTTGGTG No data
Right 1079092316 11:17489616-17489638 TAGAATAGCAGAGGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079092312 Original CRISPR CACCAAGTAGTGCAACCCCA GGG (reversed) Intergenic