ID: 1079097010

View in Genome Browser
Species Human (GRCh38)
Location 11:17517480-17517502
Sequence CAGGGAAAAGAGGAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1321
Summary {0: 1, 1: 3, 2: 16, 3: 148, 4: 1153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079096999_1079097010 27 Left 1079096999 11:17517430-17517452 CCAGGTCATCTGCGGGCTCGAGC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG 0: 1
1: 3
2: 16
3: 148
4: 1153
1079097004_1079097010 -8 Left 1079097004 11:17517465-17517487 CCCTGATCATCTACCCAGGGAAA 0: 1
1: 1
2: 0
3: 16
4: 139
Right 1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG 0: 1
1: 3
2: 16
3: 148
4: 1153
1079097005_1079097010 -9 Left 1079097005 11:17517466-17517488 CCTGATCATCTACCCAGGGAAAA 0: 1
1: 1
2: 0
3: 9
4: 179
Right 1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG 0: 1
1: 3
2: 16
3: 148
4: 1153
1079097001_1079097010 -3 Left 1079097001 11:17517460-17517482 CCACTCCCTGATCATCTACCCAG 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG 0: 1
1: 3
2: 16
3: 148
4: 1153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079097010 Original CRISPR CAGGGAAAAGAGGAGGAAGC TGG Intronic
900297968 1:1961783-1961805 CAGGGAAGAGAGGAAGGAGACGG + Intronic
900419724 1:2550686-2550708 CAGGAAGAGGAGGAGGCAGCCGG + Intergenic
900518973 1:3096549-3096571 CCGGCAAAAGAGGAAGAGGCAGG - Intronic
900538094 1:3188818-3188840 AAGGAGAGAGAGGAGGAAGCAGG + Intronic
900654442 1:3748102-3748124 CTGGGAAATGAGGACGCAGCAGG + Intergenic
900769403 1:4528789-4528811 CAGGTGACAGAGGAGGCAGCAGG - Intergenic
901036396 1:6338699-6338721 CATGGGGAAGAGGAGGAAACCGG + Intronic
901193399 1:7425872-7425894 CAGGGAGAAGATGGGGAAGCTGG - Intronic
901470570 1:9453336-9453358 CAGGGGTTAGTGGAGGAAGCTGG + Intergenic
901561440 1:10074732-10074754 CAGGGAAATGAAAAGGAACCAGG - Intronic
902200173 1:14827403-14827425 CAGGGCAAAGGGTGGGAAGCAGG - Intronic
902205800 1:14867225-14867247 AAGGCAAAAGAGGAGGGAGAGGG - Intronic
902444266 1:16452049-16452071 CAGGGAGAAGAGGAGCCGGCAGG - Intronic
902907164 1:19566815-19566837 CAGGGGGACAAGGAGGAAGCTGG + Intergenic
903011175 1:20331493-20331515 AAGGTGGAAGAGGAGGAAGCAGG + Intronic
903047294 1:20574465-20574487 CAGCTAAAAGAGGTGGAAGCTGG + Intergenic
903270552 1:22185607-22185629 CAAGGAGAAGAGGAAGAAGGAGG - Intergenic
903395294 1:22997435-22997457 AAGAGAAAATAGGAGGAAGAAGG - Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903610164 1:24605603-24605625 CAGGAAAATGAGGACGAGGCGGG + Exonic
903718703 1:25388594-25388616 GGGGTGAAAGAGGAGGAAGCAGG + Intronic
903728563 1:25471644-25471666 CAGGGAAAATACTAGGAAGCAGG + Intronic
903934090 1:26882866-26882888 CAGGAAAAGGAGGAGGGAGCAGG - Intronic
904045519 1:27606037-27606059 GAGAGAAAGGAGGAGGAACCTGG - Intergenic
904138011 1:28329023-28329045 AAGTGAGAAGAGGAGGAAGTTGG + Exonic
904332366 1:29768483-29768505 CAGGGAGAAGAGGCTGAGGCAGG + Intergenic
904357151 1:29947734-29947756 CAAGGAAAAGAAGAGGAGGAAGG - Intergenic
904367252 1:30021590-30021612 CTTGGAAAAGAGGAACAAGCAGG - Intergenic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
904910019 1:33927767-33927789 CAGGCAGAAGAGAAGGGAGCAGG - Intronic
905074885 1:35261706-35261728 GAGGAAGAAGAGGAGGAAGGAGG - Intergenic
905252831 1:36660526-36660548 CAGGGCTCAGAGGAGGGAGCAGG - Intergenic
905310108 1:37043157-37043179 CAGGGAAGAGAGGAGCATGAAGG + Intergenic
905312010 1:37055866-37055888 CAGGGAAGAGAGCAGCCAGCAGG - Intergenic
905415898 1:37803991-37804013 CAGGGCACTGAGGAGGAAACAGG + Exonic
905442004 1:38001593-38001615 CAGGGAAAAGGGCAGGGAGAGGG - Intronic
905471632 1:38196567-38196589 CAGGGCAAAGAGGAAGACACAGG - Intergenic
905835816 1:41119841-41119863 GAGGGAAAAAAGGAGGAGGCAGG - Intronic
905935123 1:41817377-41817399 CAGGGAAAAAAGGATGGGGCCGG + Intronic
906039580 1:42777867-42777889 GAGGGGACAGAGGGGGAAGCAGG - Intronic
906096505 1:43227822-43227844 GAGGGAAAACTGGAGGAAGGGGG - Intronic
906129170 1:43445857-43445879 GAGGGATAAGAGGATGAGGCAGG - Intronic
906153821 1:43602635-43602657 CAGAGAGAAGAGTGGGAAGCAGG - Intronic
906180881 1:43817743-43817765 GAGGAAGAAGAGGAGGAAGAAGG - Intronic
906436651 1:45802425-45802447 CAGGGAATAGAGGAGCAGGCTGG + Intronic
906661480 1:47585921-47585943 CAGCCAGAAGAGGAGGAAGAGGG + Intergenic
906690945 1:47792427-47792449 CAGGGAGGAGGGGAGGAGGCTGG + Intronic
907046768 1:51304462-51304484 CAGAGAAAAGGGGATGAGGCTGG + Intronic
907190955 1:52648510-52648532 CAGGGATAAGGAGAGGAAGGAGG - Intronic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907436371 1:54451705-54451727 TGGGGGACAGAGGAGGAAGCAGG + Intergenic
907745177 1:57206225-57206247 CAGGGAGAAAAGGAGGGAGAGGG + Intronic
907908642 1:58808116-58808138 CAGGTAAAATAGGACAAAGCTGG + Intergenic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
907936388 1:59046011-59046033 AAGGTGACAGAGGAGGAAGCAGG - Intergenic
908021214 1:59900888-59900910 AAGGGAAAACAGGAGAGAGCAGG + Intronic
908151863 1:61310749-61310771 GAAGGAAAAGAGGGAGAAGCAGG - Intronic
908607721 1:65818403-65818425 CAGGGACAATAGGAAGAAGGAGG - Intronic
909686539 1:78355188-78355210 GAGGGAGAAGAGGAGGAAGAGGG - Intronic
909800821 1:79805717-79805739 CAAGGAAGAAAGGAGAAAGCAGG - Intergenic
909830051 1:80176623-80176645 CAGGCAAGAGAGGTGCAAGCAGG - Intergenic
911465268 1:98244029-98244051 CAGGTCAAAGAGGAGAAAACAGG + Intergenic
911634772 1:100222744-100222766 CAGTGAAAGGAGGAGAAAGAGGG - Intronic
912040839 1:105388042-105388064 CAGGGCAAAAAGGTGGAATCTGG - Intergenic
912155344 1:106911845-106911867 AAGGGAAAAGAGAAGAAGGCAGG - Intergenic
912157375 1:106938434-106938456 ATGGGAAAAGAGAAGGATGCTGG - Intergenic
912491412 1:110064766-110064788 CCGGGGAAAGAGGAAGATGCAGG + Exonic
912560102 1:110545006-110545028 AAGGGAAAAGAGGAAGAAGGGGG - Intergenic
912699394 1:111865369-111865391 CAGGGATAAGGGGAGAGAGCTGG + Intronic
912744977 1:112238644-112238666 GAAGGAAATGAGGAGGAAGATGG - Intergenic
913059731 1:115194013-115194035 GAGGGAATAGAGGAGTAAGGAGG - Intergenic
913159541 1:116132766-116132788 CAGGCAGAAGAGGCAGAAGCAGG + Intronic
913387554 1:118276083-118276105 CAGGGAAAGGAGGAGACAGAAGG + Intergenic
913398171 1:118395966-118395988 GAAGGAAGAGAGGAGGAGGCTGG - Intergenic
913441496 1:118903072-118903094 CAGGGAAAAAATGAGCAAGAGGG - Intronic
913699884 1:121364289-121364311 AAGGAAAGAAAGGAGGAAGCAGG - Intronic
914137657 1:144915748-144915770 AAGGAAAGAAAGGAGGAAGCAGG + Intronic
914320559 1:146555431-146555453 CAGGAAAAAGGAAAGGAAGCAGG + Intergenic
914514568 1:148362882-148362904 GAGGGAAAAGAGGGAGAGGCAGG - Intergenic
914857286 1:151362060-151362082 GAAGGAAAAGAGGAAGAAGGAGG + Intergenic
914916095 1:151820126-151820148 CAGGGGAAGGAGGGGGGAGCAGG - Intronic
915123106 1:153644930-153644952 CAGGGCAAAGAGGAGAAATCTGG - Intronic
915223956 1:154397879-154397901 CAGGGAGAAGAGGAAGAAGGTGG - Intergenic
915459009 1:156058540-156058562 CAGAGAAGATAGGAAGAAGCAGG + Intergenic
915463278 1:156082054-156082076 AAGGGAAAAGAGGAGAGAGGAGG + Intergenic
915731260 1:158056076-158056098 CAGGGCAGAAGGGAGGAAGCAGG - Intronic
915834832 1:159168354-159168376 CAGTGAAAATCTGAGGAAGCAGG - Intergenic
916001365 1:160619541-160619563 CAGGAAAAAAATGAAGAAGCTGG - Intronic
916242911 1:162657790-162657812 AAGGGAAAAGAGGAAGGAGAGGG - Intronic
916300987 1:163274293-163274315 CTGGGAAAAGAGAAGGGAGCTGG + Intronic
916512251 1:165482668-165482690 CCAGGAAAAGAAGAGGAAGTTGG + Intergenic
916702377 1:167311025-167311047 CTGGGAAGAGAGGAGAAAGAGGG + Intronic
916832845 1:168510571-168510593 GTGGGAAGAGAGGAGGAAGCTGG + Intergenic
916841474 1:168605839-168605861 CAGGCAAAAAATGAGAAAGCTGG - Intergenic
916845494 1:168645749-168645771 CAGGGAGGAGAAGAAGAAGCAGG + Intergenic
916918162 1:169432925-169432947 CAGGTATAAGATGAGGATGCTGG + Intronic
916988062 1:170213038-170213060 AAGGGAAAGGAGGAGTAAGATGG - Intergenic
917038294 1:170773573-170773595 CAGGGGAAGGGGGAGGAAGGGGG + Intergenic
917379197 1:174385098-174385120 AAGGGAACAAAGGTGGAAGCAGG + Intronic
917536212 1:175876524-175876546 CAGGGAGAATAGGAGGAATCAGG - Intergenic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918239539 1:182609582-182609604 CAGGGAGAGGTGGAGGAAGCTGG - Intergenic
918431779 1:184468401-184468423 GGGGGAAAAAAGGAGGAAGGTGG + Intronic
918912606 1:190592851-190592873 CAGGGAGCAGAGGTAGAAGCAGG - Intergenic
918982697 1:191584217-191584239 CATGGAAAACAGGAAAAAGCAGG - Intergenic
919569905 1:199235238-199235260 AAAGGAAAAGAAGAGCAAGCTGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919728576 1:200899151-200899173 GAAGGAAAAGAGGAAGAAGAAGG + Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920091090 1:203453754-203453776 CCAGGAAGAGAGAAGGAAGCTGG - Intergenic
920441254 1:205982195-205982217 CGGGGAACAAAGGAGAAAGCAGG - Intronic
920441624 1:205984750-205984772 CAGGGAAAAAAGGAGAAAGCAGG - Intronic
920487298 1:206382998-206383020 AAGGAAAGAAAGGAGGAAGCAGG - Intronic
920510891 1:206551360-206551382 CAGGGTAACGTGGAGGGAGCGGG - Intronic
920561779 1:206944082-206944104 CAGTGGAGAGAGGAAGAAGCAGG + Intronic
920867912 1:209768674-209768696 CAGTGAAGAGAGGAGCAAGGCGG - Intronic
921334919 1:214076332-214076354 CTGGGAAAGGAAGAGGAAGAAGG + Intergenic
921382551 1:214539709-214539731 GAGGGAAGAGAGGAGGAGGGAGG + Intronic
921958084 1:221004623-221004645 CTGGGAAAAGAAGAAGAGGCAGG - Intergenic
922025356 1:221743474-221743496 CAGGGAGAAGAGTAGGGGGCGGG + Intergenic
922157597 1:223052279-223052301 GAGGGAGAAGAGGAGGGAGCAGG - Intergenic
922334456 1:224607366-224607388 AAGGGAAAAGAGCAGGCAGCAGG + Intronic
922357634 1:224791591-224791613 AAGGGAATAATGGAGGAAGCGGG - Intergenic
922532628 1:226356074-226356096 CAGGGAGAAGAGGCAGGAGCTGG + Intergenic
922554407 1:226521925-226521947 GAGGGAGATGAGGAGGAAGGGGG - Intergenic
922591319 1:226779411-226779433 TAGGGAAAGGAGCAGGAATCGGG + Intergenic
922606730 1:226894240-226894262 GAGGGACAAGAGCAGGGAGCGGG + Intronic
922633612 1:227140949-227140971 CAGGGAAATCAGGAGGGATCAGG + Intronic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
922900110 1:229130076-229130098 AATGGCACAGAGGAGGAAGCTGG + Intergenic
923246458 1:232137121-232137143 AGGGGAAAAGAGGAGGCACCAGG + Intergenic
923367976 1:233282205-233282227 CAGGGCAAAGAGGAGGCGTCGGG - Intronic
923616407 1:235541940-235541962 TATGGAAAAGAGGAGGCAGGCGG + Intergenic
923617642 1:235551036-235551058 GAGCCAAAAGAGGAGGGAGCAGG + Exonic
924110319 1:240692373-240692395 CTGGGTAAAGAGGAGGCTGCCGG - Intergenic
924196805 1:241616164-241616186 AAGGGAATAGAGGAAGAGGCAGG - Intronic
924802889 1:247340469-247340491 CAGCTAATAGAGGAGGAAGAAGG - Intergenic
924952193 1:248895372-248895394 AAGGACAAAGAGGAGGAAGAAGG + Intergenic
1063872088 10:10428658-10428680 CAAGGAAAAGAGTGGGAAGAGGG - Intergenic
1064216812 10:13407278-13407300 AAGGGAAAGGAGGAAGATGCCGG + Intergenic
1064633800 10:17343542-17343564 AAGGGAAAAGAAGAAGAAACAGG + Intronic
1064706112 10:18074164-18074186 GAGGGAGAAAAGGAGGAGGCAGG + Intergenic
1065390246 10:25175390-25175412 CAGAGAGAAGAGGAGGGAACGGG - Exonic
1065549843 10:26860108-26860130 CCCGGAGGAGAGGAGGAAGCGGG - Intronic
1065694287 10:28365661-28365683 AAGTGAAAAAAGGAGGAAGAAGG + Intergenic
1065788996 10:29242552-29242574 CAGTGAATACAAGAGGAAGCGGG + Intergenic
1065846181 10:29745488-29745510 CCAGGAACAGAGGAGGAAACGGG - Intergenic
1066144237 10:32540344-32540366 CATGGAAAACAGGAAAAAGCAGG - Intronic
1066191053 10:33056603-33056625 AAGGGAAATGTGGAGGAAGCAGG + Intergenic
1066239861 10:33523152-33523174 CAGGGAAAAAAGTGGGAAGCTGG + Intergenic
1066260967 10:33729336-33729358 CATTTAACAGAGGAGGAAGCTGG - Intergenic
1066425980 10:35308243-35308265 CACGCAAAAGAGGAGGAGGTGGG + Intronic
1066706329 10:38183042-38183064 CAGGGAAAAGGGTGGGAAGGGGG - Intergenic
1067750064 10:48965628-48965650 GAGGGAGAAGAGGTGGAAGCTGG - Intronic
1067768027 10:49103664-49103686 CAGGGAAATGAGGAGAGACCAGG + Intronic
1068082369 10:52335368-52335390 CAGGGGAGACAGGATGAAGCAGG + Intergenic
1068241381 10:54305892-54305914 CAGAAAAAAGACCAGGAAGCAGG + Intronic
1068262456 10:54600246-54600268 CAGGAGAAAGAGGAGAAAGTGGG + Intronic
1068316531 10:55351019-55351041 GAGGGAGAGGGGGAGGAAGCAGG - Intronic
1068412668 10:56677743-56677765 AAGGAAGAGGAGGAGGAAGCAGG + Intergenic
1068994096 10:63182739-63182761 CAGTAAAAAGAGGAAGAAGGGGG - Intronic
1069025095 10:63531135-63531157 CAGGGAAAACAGTAGCAATCAGG + Intronic
1069437136 10:68395015-68395037 GAGAGAAAAGAGGAGCAAGGAGG + Intronic
1069771739 10:70904815-70904837 CAGGGAGTGGAGGAGGAAGCTGG + Intergenic
1069870030 10:71527443-71527465 CAGGGCCCAGAGGAGGAGGCTGG - Intronic
1070367996 10:75754725-75754747 CGGGGAAAAGGGGAGAAAGAAGG - Intronic
1070714813 10:78711739-78711761 GAGGGAAAAGAGAAGCAAACCGG - Intergenic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071203798 10:83251655-83251677 GAGAGAAAAGAGGAAGAAGAAGG + Intergenic
1071388925 10:85150379-85150401 TAGGAAAAAGAGGAGGAGGAAGG - Intergenic
1071441609 10:85702880-85702902 GAAGGAAAAGAGGAGGAAGACGG + Intronic
1071736417 10:88305502-88305524 AATGGAAAAGAGAAGAAAGCAGG + Intronic
1072006329 10:91253023-91253045 CAGGAAAAAAAGGAAGAATCAGG - Intronic
1072069136 10:91899738-91899760 CAGGGCAAGTAGGAGGAAGGAGG - Intergenic
1072443361 10:95477123-95477145 AAGGGAAAAGAGGAGGAGGTCGG - Intronic
1072534780 10:96353792-96353814 CAGGAAAAAGAGGAAGAATTAGG + Intronic
1072605164 10:96975218-96975240 CAGAAAAAAAAGTAGGAAGCTGG + Intronic
1072639587 10:97201878-97201900 GAGGGTGAAGAGGAGGGAGCAGG - Intronic
1072875660 10:99170358-99170380 CAGGCCAGAGAGGAGGGAGCTGG - Intronic
1073082299 10:100867919-100867941 CATTGAAAAGATGAGGAAACGGG + Intergenic
1073114067 10:101081080-101081102 GAGGGAAAAGCGGAGGGACCTGG + Intergenic
1073146703 10:101285976-101285998 CAAGGGAAAGAGGAGGCAGAGGG - Intergenic
1073325433 10:102642242-102642264 CAGGGAAAGGGGGAGGAGCCGGG + Intergenic
1073511896 10:104047719-104047741 CAGGTAACAGAGCAGGAAGAGGG - Exonic
1073793938 10:106967587-106967609 CAGGGAATAGGGGGAGAAGCTGG + Intronic
1073840547 10:107494396-107494418 AAGGGAAAAGAGAATGAAGGTGG - Intergenic
1074162806 10:110847749-110847771 CAGAGAGAAGAGGAAAAAGCGGG + Intergenic
1074189668 10:111124788-111124810 GAGGGAAGAGAGCAGGAAACTGG + Intergenic
1074447586 10:113533264-113533286 GAGGCACAAGAAGAGGAAGCTGG + Intergenic
1074577576 10:114684829-114684851 AAGGAAAAAGAGGAGGCAGAAGG - Intronic
1074781767 10:116807361-116807383 CAGGGGTAAGAGGGGAAAGCAGG - Intergenic
1074813929 10:117130893-117130915 AAGGAGAAAGAGCAGGAAGCTGG + Intronic
1075410757 10:122226212-122226234 CCAGGAAGAGAGGAGGAAGTGGG - Intronic
1076122195 10:127945109-127945131 CAGGGGAAGGGTGAGGAAGCTGG - Intronic
1076413548 10:130268376-130268398 CAGGGCAAAGGGGAGGACACAGG + Intergenic
1076457556 10:130611280-130611302 CAGGGAGAAGAAGAGGAGGGAGG + Intergenic
1076497662 10:130907536-130907558 GTGTGAAAACAGGAGGAAGCTGG - Intergenic
1076524189 10:131100956-131100978 AGTGGGAAAGAGGAGGAAGCAGG - Intronic
1076567367 10:131407910-131407932 GAGGGAGAAAAGGAGGATGCAGG - Intergenic
1076843852 10:133059604-133059626 CTGGGGAAAGTGGAGGGAGCTGG + Intergenic
1077064832 11:636564-636586 GAGGGAATGGAGGAGGGAGCGGG + Intergenic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077542350 11:3153011-3153033 CAAGGAGAAGAGGAGGAGTCTGG + Intronic
1077563784 11:3283287-3283309 AAGGGAAAAAAGGAGGGAGGGGG - Intergenic
1077569674 11:3329104-3329126 AAGGGAAAAAAGGAGGGAGGGGG - Intergenic
1077736091 11:4792802-4792824 CAGAGAAAAGAAGAAGGAGCGGG + Intronic
1077758037 11:5057089-5057111 CAGGGAAAAGAAGTGGAAACAGG + Intergenic
1078155647 11:8797744-8797766 CAGGAAAAAGAGTAGGGTGCTGG - Intronic
1078349018 11:10577264-10577286 AAGGAAGAAGAGGAGGAAGAGGG - Intronic
1078349593 11:10581683-10581705 CAGGAAGGACAGGAGGAAGCAGG - Intronic
1078401220 11:11029003-11029025 CAGGGCCAAGAGGAGATAGCAGG + Intergenic
1078619113 11:12891562-12891584 CCTGGAACAGAGGAGGAAGCAGG + Intronic
1079005461 11:16788746-16788768 CAGAGAGGAGAGGAGGAAGATGG - Exonic
1079095696 11:17508906-17508928 AAGGGAGGGGAGGAGGAAGCAGG - Intronic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079331297 11:19535193-19535215 CAGGGAAAACAGGAAGCTGCTGG + Intronic
1079357127 11:19738903-19738925 CTGGGAGAAGAGGCAGAAGCTGG + Intronic
1079444359 11:20545961-20545983 GATGGGAAAGAGGAGAAAGCAGG - Intergenic
1080159778 11:29159912-29159934 AAGAGAAAAGAGGAGGAGGATGG + Intergenic
1080603218 11:33841331-33841353 AAGGGAAAGGAGGAGGGAGAAGG - Intergenic
1080713425 11:34772521-34772543 AAGGTAAAAGATGAGGAACCTGG + Intergenic
1080862956 11:36166104-36166126 CAGCGGAAAGAGCAGGAACCAGG - Intronic
1081315698 11:41626506-41626528 CAGGGAAGAGAAGTGCAAGCAGG + Intergenic
1081567250 11:44267583-44267605 AAGGGCCAAGTGGAGGAAGCGGG - Exonic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081646327 11:44793003-44793025 CAGGGGGAAGGGGAGGGAGCTGG + Intronic
1081764860 11:45603527-45603549 CATGGAATAGATGAGGAAACTGG + Intergenic
1081964343 11:47160638-47160660 CAGGGGCAAGAGGAGAAGGCTGG - Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082717676 11:56634947-56634969 GAGGGAGAAGAGGAGGAACAAGG - Intergenic
1082790852 11:57345934-57345956 ATGAGAACAGAGGAGGAAGCGGG - Intronic
1083333761 11:61911367-61911389 CCTGGAAATGAGGAGGAAGAGGG - Intronic
1083629772 11:64089514-64089536 CATGGATAACAGGAGGAGGCTGG - Intronic
1084194776 11:67518238-67518260 AAGGTAAAGGGGGAGGAAGCAGG + Intergenic
1085034617 11:73292606-73292628 CAGGGGAAAGAGGGGGATGGGGG - Intronic
1085205772 11:74731185-74731207 GAGGGAGAGGAGGAGAAAGCAGG + Intronic
1085337380 11:75706487-75706509 GAGGGAGGAGAGGAGGCAGCGGG - Intergenic
1085658284 11:78337533-78337555 CAGGGAAAAGAGAAAGAAGGTGG + Intronic
1086951065 11:92890690-92890712 CCGGGAGAGGAGGAGGCAGCTGG - Exonic
1087056196 11:93938893-93938915 CAGGGGCAAAGGGAGGAAGCAGG - Intergenic
1087140965 11:94765772-94765794 GAGGGAGAAGAGGAAGAATCTGG - Intronic
1087466191 11:98509711-98509733 CAGGGGAAAGAGTGGGAAGGAGG - Intergenic
1087498734 11:98923655-98923677 GAGGGAAAGGAAGAGGAAGAAGG - Intergenic
1087666361 11:101053624-101053646 GAGGGAAGAAAGGAGGAAGAAGG - Intronic
1088264349 11:107975244-107975266 AAGGGAAAGAGGGAGGAAGCAGG + Intergenic
1088442667 11:109889011-109889033 CAAGGAAAAGAGGGGTAAGGAGG - Intergenic
1088489656 11:110374482-110374504 CAAAGAAAAAAGGAGGAAGGAGG - Intergenic
1088618795 11:111661345-111661367 GAGGGAAAAGAAAAGGAAGCAGG + Intronic
1088765435 11:112971129-112971151 AAGGAAAAAGGGGAGGAAGGAGG + Intronic
1089012053 11:115139517-115139539 ATGGGAAAAGATGAGAAAGCAGG - Intergenic
1089111742 11:116062723-116062745 CAGGGGAGAGAGGAGGAAACGGG + Intergenic
1089391148 11:118102778-118102800 CTGGTAAAAGAGGAGGAACCCGG - Intronic
1089498156 11:118918154-118918176 TAGGGAAAGCTGGAGGAAGCTGG - Intronic
1089535529 11:119158660-119158682 CATGGAGAAGAAGAGGCAGCCGG - Exonic
1089559588 11:119337109-119337131 CAGGGGAAAGAGCAGAAATCCGG - Exonic
1089702988 11:120256701-120256723 CAGGAAGAAGGGGAGGGAGCTGG + Intronic
1090529377 11:127574839-127574861 CAGGGAAAAGACCAGAAAGACGG + Intergenic
1090640457 11:128725294-128725316 CAGGAGAAAGGGGAGGAAGCGGG - Intronic
1090716814 11:129438442-129438464 CAGGCAAAAGAAGAGGAAGAAGG - Intronic
1090976852 11:131686567-131686589 GAGGCAGAAGAGGAGGAGGCAGG + Intronic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1091284942 11:134403291-134403313 CAGGGATGAGAGCAGGAGGCTGG + Intronic
1091308261 11:134554662-134554684 AAGGGAGAAGAGGAAAAAGCAGG - Intergenic
1091345974 11:134854398-134854420 CACAGAAAAGAGGAGGTGGCTGG + Intergenic
1091631761 12:2166834-2166856 CAGGGAGAAGACTAGGCAGCAGG + Intronic
1091652909 12:2323098-2323120 CAGGGAAGGAAGGAGGAAGGCGG - Intronic
1091778444 12:3199602-3199624 CAGGGACAGGTGGACGAAGCGGG - Intronic
1091805359 12:3352267-3352289 CAAGGAAGAGAGGACAAAGCTGG - Intergenic
1091900616 12:4141183-4141205 CAGGTGAAAGAGCAGGAAACGGG + Intergenic
1092034672 12:5322603-5322625 CTGGGAAAAGGGGAGGAAAGTGG + Intergenic
1092116755 12:6014378-6014400 CAGGGGACAAAGGTGGAAGCTGG + Intronic
1092228527 12:6764443-6764465 CAGGAAAAATAGGAGGAAGGTGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1093000316 12:13988720-13988742 GAGGGAAAAGAGGAGGCCACTGG + Intergenic
1093092289 12:14935660-14935682 CAGGGTGAAGAGGAGGGAGTTGG - Intronic
1093125252 12:15321712-15321734 CAGGCAGAGGAGGAGGAAGAGGG + Intronic
1093148056 12:15590184-15590206 TCGGGAGAAGAGGAGGAAGACGG - Intronic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1093740519 12:22680086-22680108 CTGGGAGAAGAGGAGGAAAGAGG - Intronic
1093772841 12:23037546-23037568 CAGGGAGAAAAAGGGGAAGCGGG + Intergenic
1094216944 12:27952439-27952461 CAGGGAAAGGGGGAGGGAGGGGG + Intergenic
1094229096 12:28082438-28082460 CAGGAAAAAGAAAAGGAAGTAGG + Intergenic
1094619521 12:32066815-32066837 AAAGGAAACAAGGAGGAAGCCGG + Intergenic
1094823941 12:34252213-34252235 CAGGTAAAAGTTGAGGAAACTGG - Intergenic
1095087755 12:38076241-38076263 CAGGTAAAAGTTGAGGAAACCGG + Intergenic
1095619804 12:44238372-44238394 AAGGGAAAATAGAAGGAAGGAGG + Intronic
1095702537 12:45205169-45205191 TAGGGGACAGAGGTGGAAGCAGG + Intergenic
1096024113 12:48346539-48346561 TATGGAAAAGAAGAGGAAGAAGG - Intronic
1096152472 12:49323302-49323324 AGGAGAAAAGCGGAGGAAGCTGG + Exonic
1096183234 12:49562516-49562538 GTGGGAAAAGAAGAGGAAGAAGG + Intronic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096677235 12:53232322-53232344 CAGGGCACAGAGGAGGGAGCCGG - Intronic
1096809813 12:54162078-54162100 CATGGCAAAGAGAAGGGAGCAGG + Intergenic
1096865754 12:54561646-54561668 CAGGGATGAGAAGAGGAAGGGGG + Intronic
1097094440 12:56535103-56535125 CAGGAAAATGAGGAGAAACCAGG - Intronic
1097182173 12:57177777-57177799 CAGGTAGAGGAGGCGGAAGCAGG + Intronic
1097790659 12:63811963-63811985 AAGGAAGAAGAGGAGGAAGGAGG + Intergenic
1097825644 12:64172447-64172469 GAAGGAAAAGAGGAGGGAGGAGG + Intergenic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098034505 12:66288356-66288378 CAAGGAAATGAGAAGGTAGCTGG + Intergenic
1098035478 12:66297518-66297540 GAGGGAGAAGAGAAGGAAGGAGG + Intergenic
1098188846 12:67926540-67926562 CAGGAGAACTAGGAGGAAGCTGG - Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098335993 12:69404948-69404970 CATGGAGAAGAGCAGAAAGCTGG + Intergenic
1098484703 12:71007051-71007073 CAGGGAAAACAGCAGGCACCAGG + Intergenic
1098522391 12:71448050-71448072 GAGGGAGACGAGGAGGAAGGGGG - Intronic
1098898293 12:76086659-76086681 CTGAAAAAAGAAGAGGAAGCTGG - Intergenic
1099712248 12:86242684-86242706 GAGGGAAAAATGGAGGAAGGGGG + Intronic
1100067668 12:90669668-90669690 CAGTGAAAAGAGGAAGAAGAGGG - Intergenic
1100392816 12:94158823-94158845 CTGGGAACATGGGAGGAAGCAGG + Intronic
1100456692 12:94758584-94758606 CAGGGGAAAGGGTAGGAAGGGGG - Intergenic
1101064533 12:101005920-101005942 CTGGAAGAAGAGGAGGAGGCAGG - Intronic
1101235322 12:102782917-102782939 GAAGGAACAAAGGAGGAAGCAGG - Intergenic
1101321640 12:103678099-103678121 CTGTGGAAAGAGGTGGAAGCAGG - Intronic
1101836833 12:108301834-108301856 CAGGGCAGAGAGGTGGAGGCTGG - Intronic
1102032739 12:109752461-109752483 CAGGGACAAGAGGAGAGATCTGG - Intronic
1102339327 12:112109174-112109196 CAGGGGAAAGTTGGGGAAGCGGG + Intergenic
1102764793 12:115423208-115423230 GAGGAAAAAGAGGAGGAGGGAGG + Intergenic
1103005088 12:117414632-117414654 CAGGAAGAGGAGGAGGAAGGAGG - Intronic
1103037339 12:117667198-117667220 CAGGGGAAAGAGCAGGAACTGGG + Intronic
1103348086 12:120264758-120264780 CAGGGGAATGAGGTGGAAGGTGG - Intronic
1103617313 12:122162514-122162536 GAGGGAAAAGAGGAGGGAGCAGG - Intergenic
1103896614 12:124277667-124277689 GAGGAGAAAGAGGAGGAAGGGGG - Intronic
1103896677 12:124277903-124277925 GAGGCAGAAGAGGAGGAAGAGGG - Intronic
1104160688 12:126177336-126177358 CAGGGAAAAGGGTGGGAAGAGGG + Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104481413 12:129111207-129111229 CAGGGAACAGGGGAGGAAGAGGG + Intronic
1104565925 12:129883043-129883065 CAGGGAAAAGGGAAAGAAGGAGG + Intronic
1104602775 12:130164126-130164148 CAGGGGAATGAGCACGAAGCCGG - Exonic
1104649708 12:130522706-130522728 CAGGGAGAGGAGGAGGAGGTGGG + Intronic
1105414104 13:20193777-20193799 TTGCGAAAAGAGGAGGAAGTTGG - Intergenic
1105863190 13:24435113-24435135 GAGGCAAAAGACAAGGAAGCAGG + Exonic
1106548265 13:30749327-30749349 CATGAGAAAGAGAAGGAAGCAGG + Intronic
1106644089 13:31614382-31614404 AAGGGCAAAGAGGTGGAAGTGGG - Intergenic
1107114216 13:36729234-36729256 CAGGGAAAGTGGGAGGAAGCTGG - Intergenic
1107655421 13:42588293-42588315 CAGGGAAGAAGGTAGGAAGCAGG + Intronic
1107836452 13:44415911-44415933 CACGCTACAGAGGAGGAAGCTGG + Intergenic
1108068462 13:46603289-46603311 CAGGGTCAGGAGGAGGAAACTGG - Intronic
1108944148 13:56000495-56000517 CAGGGAGATGAGGAGGCTGCAGG - Intergenic
1109062711 13:57638375-57638397 TAGGAAAGAGAGGAGGAGGCTGG + Intronic
1109704594 13:66073379-66073401 CAGGGAAAAGAGGATGGAGATGG + Intergenic
1110215509 13:73020609-73020631 CAGGTAATAGAGGAGGATGAAGG - Intergenic
1110367341 13:74701623-74701645 CAGTGAAATGAGGAACAAGCAGG + Intergenic
1111000261 13:82169736-82169758 CAGGGAAAAAGGGAGGAAGTAGG + Intergenic
1111403834 13:87776106-87776128 AGAGGAAATGAGGAGGAAGCTGG - Intergenic
1111425981 13:88082917-88082939 CAGGGAAAAGTGAAGCAACCAGG + Intergenic
1111854682 13:93622906-93622928 TGGGGAAAATAGGAGGAAGTGGG - Intronic
1112342536 13:98564529-98564551 AAGAGCAGAGAGGAGGAAGCTGG + Intronic
1113033357 13:106018953-106018975 CCGGGAAATGAGTAGGAAGGAGG + Intergenic
1113145678 13:107204481-107204503 TAGGGAATAGAGGAGGAATTAGG - Intronic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114338627 14:21719426-21719448 CAAGGAAAGAAGGAGGAAACTGG + Intergenic
1114412497 14:22514254-22514276 CTGGGATCAGAGGAGGAAACTGG - Intergenic
1114429020 14:22644681-22644703 GAGGGGACAGAGGAAGAAGCAGG - Intergenic
1114455149 14:22849160-22849182 AAGGGGAAAGAGGTGGAAGATGG + Intergenic
1114753969 14:25237667-25237689 CAGGAAAAGAATGAGGAAGCAGG - Intergenic
1115028124 14:28766414-28766436 CAGTACAATGAGGAGGAAGCCGG + Intergenic
1115498288 14:34027456-34027478 AAGGGAGGAGAGGAGGAAGAAGG + Intronic
1115761717 14:36582848-36582870 CAGGAGGAGGAGGAGGAAGCTGG - Intergenic
1116475137 14:45331204-45331226 GAAGGAGAAGAGGAGGAAGAAGG - Intergenic
1116992022 14:51286717-51286739 CAGGGAGATGAGGAGGAGTCGGG - Intergenic
1117194263 14:53323901-53323923 TAGGGACATGAGGATGAAGCTGG + Intergenic
1117661731 14:58013677-58013699 CAGGGAAAAGATGAGGAAACTGG + Intronic
1117667319 14:58070200-58070222 CAGCTCAAAGAGGAGGAAGAAGG + Intronic
1117895199 14:60477205-60477227 GAGCAAAAAGAGGAGAAAGCTGG - Intronic
1118378520 14:65198495-65198517 CAGGCAAAGGAGGGGGATGCTGG + Intergenic
1118474914 14:66107706-66107728 GAGGCAAATGAGGAGGGAGCAGG + Intergenic
1118819782 14:69337769-69337791 AAGGGCAGAGTGGAGGAAGCAGG - Intronic
1118979071 14:70701601-70701623 TAGGGAAAAGAGGGGGAAGAGGG + Intergenic
1119192258 14:72690962-72690984 CAGGGAAAAGAGGAGAGAAAGGG + Intronic
1119258500 14:73220964-73220986 CAGGCAAAAGAAGAAAAAGCTGG - Exonic
1119276589 14:73362379-73362401 GAGGGAAAAGAGGAGGAAAAGGG + Intronic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119999852 14:79290411-79290433 AAGGGAAAGGAGGAGGAGACAGG + Intronic
1120111021 14:80556512-80556534 GAGGGAAAAGTTGAGGAAGACGG + Intronic
1120525162 14:85568918-85568940 GAGGGAAAAGAGGAGACAGACGG - Intronic
1120901770 14:89581577-89581599 GAGGGAAAAGAGCAGGTACCGGG - Intronic
1120913673 14:89690743-89690765 AAGGGCAAAGAGGAGGAAGCAGG + Intergenic
1121083070 14:91124337-91124359 CAGAGAGAAGAGGAGGCATCAGG - Intronic
1121529672 14:94643662-94643684 CAGGGGCAAGATGAGGCAGCTGG + Intergenic
1121843768 14:97155714-97155736 AAGGGACAAGAGCAGGAAACTGG - Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122206875 14:100152075-100152097 CAGGGACAAGAAGAGAGAGCAGG + Intronic
1122248495 14:100421409-100421431 CACAGAAGAGGGGAGGAAGCAGG + Intronic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1122928996 14:104924815-104924837 CAGGACAAAGAGGAAGTAGCTGG + Exonic
1124156771 15:27233027-27233049 CAGGGACAAGAGGAGGTGCCTGG - Intronic
1124354572 15:28985162-28985184 CTGGGAGAAGAGGAGGAGGTGGG + Intronic
1124372186 15:29110223-29110245 CTGGGGACAGTGGAGGAAGCTGG + Intronic
1124512200 15:30336845-30336867 CAGGGAAAGTAAGAGGAGGCAGG + Intergenic
1124730714 15:32193906-32193928 CAGGGAAAGTAAGAGGAGGCAGG - Intergenic
1124850161 15:33329119-33329141 ATGGGAGAAGAAGAGGAAGCAGG - Intronic
1124866491 15:33497137-33497159 CTGGGAGAAGAGGAGGAATCTGG - Intronic
1124957730 15:34370763-34370785 AAGGGAAAGGAGGAGGAAGAAGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125423257 15:39525673-39525695 CAGGGCAAATATGAGGAAGGAGG + Intergenic
1125547284 15:40515320-40515342 AAAGAAAAAGAGGAGGAAGAGGG - Intergenic
1125608822 15:40957482-40957504 CTGGGCAATGAGGAGGAGGCTGG - Intergenic
1125684830 15:41558246-41558268 CTGGGAAAAGGGGTAGAAGCAGG + Intronic
1126350254 15:47738643-47738665 CAGGAAAGAGCAGAGGAAGCAGG + Intronic
1126455577 15:48858316-48858338 CAGGGAAAAGGGGTGGCAGCGGG - Intronic
1126698959 15:51350689-51350711 CAAGGAAGACAGGAGGGAGCTGG + Intronic
1127242657 15:57134917-57134939 CAGGAAAAGGAGGAGGAATGTGG - Intronic
1127397207 15:58552446-58552468 GAGGGCAGAGAGGAGGAGGCGGG - Intronic
1127559060 15:60117935-60117957 CAGGGAAAAAAGGTTGAAGGAGG + Intergenic
1127664285 15:61129828-61129850 CTGGGAAAAGAGGAACAAGGAGG + Intronic
1127723042 15:61721484-61721506 CAGGGAAAGGAGAAGACAGCTGG + Intergenic
1127867233 15:63042625-63042647 GAGGGAGGAGAGGAGGAAGGGGG + Intronic
1128142710 15:65313459-65313481 CAGGGAAAAGAACATGAAGATGG - Intergenic
1128237882 15:66079926-66079948 AACGGGAAAGGGGAGGAAGCAGG - Intronic
1128300219 15:66561998-66562020 CATGGCAAAGAGGGGGAAGCTGG - Intronic
1128342303 15:66830982-66831004 CTGGGTGAAGAGGAGGAATCAGG + Intergenic
1128780737 15:70357169-70357191 CAGGGAACAGAGGAGGGGGTGGG + Intergenic
1129071682 15:72956700-72956722 TTGGGAAAGGAGAAGGAAGCAGG - Intergenic
1129193168 15:73949287-73949309 GAGGGGAAAGAAGAGGCAGCTGG - Intronic
1129210437 15:74064983-74065005 GAAGGAAAAGGGGAGGAAGATGG - Intergenic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1129316714 15:74749704-74749726 CAGGGAAAAAAGGAGGGACCAGG - Intronic
1129360173 15:75019562-75019584 CAGGGAACAGATGAGGGAGGAGG - Exonic
1129403578 15:75300390-75300412 GAAGGAAAAGGGGAGGAAGATGG + Intergenic
1129450500 15:75648550-75648572 CAGGAGCAAGAGGAGGAAGGAGG + Exonic
1129707313 15:77802068-77802090 CGAGGAAAAGAGGGAGAAGCTGG + Intronic
1129738779 15:77979904-77979926 CAGGGTCAGGAGGAGAAAGCTGG - Intergenic
1129854719 15:78815033-78815055 CCTGGGACAGAGGAGGAAGCAGG - Intronic
1130042701 15:80418396-80418418 CAGGGACAGGAGGAAGCAGCCGG - Intronic
1130068405 15:80626253-80626275 CAGAGAAAGGAGGTGGAAGGAGG - Intergenic
1130109758 15:80954474-80954496 CAGGGAAAGGAGTAGGATGTGGG + Intronic
1130146530 15:81278516-81278538 CAGGGAGACAAGGAGGAAGGAGG + Intronic
1130408507 15:83624421-83624443 AAGCGCAAAGAGCAGGAAGCGGG + Intergenic
1130727336 15:86452849-86452871 CAGGGCAAAGAGAATGAATCTGG - Intronic
1130727965 15:86460693-86460715 CAAGGCAAAGAAGATGAAGCTGG + Intronic
1130894947 15:88162776-88162798 CTGGAGAAAGAGGAGGAAGCTGG - Intronic
1131217149 15:90547677-90547699 GAGGGCAGAGAGGAGGAAGTGGG + Intronic
1131418763 15:92285638-92285660 CAGCTAAAAGAAGAGGAAGTTGG - Intergenic
1131528623 15:93173089-93173111 AAGGGAGATGGGGAGGAAGCAGG + Intergenic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1131550412 15:93352232-93352254 CAAAGAAAAGAGGAGAAGGCTGG - Intergenic
1131689373 15:94809973-94809995 GAGGGAAATGAGAAGGGAGCAGG - Intergenic
1132016216 15:98319766-98319788 TATGGAAAAGAGGAGGAGGGAGG + Intergenic
1132225218 15:100135096-100135118 CAGGAGAAAGAGGAAGAAGGTGG + Intronic
1132284369 15:100650439-100650461 CAGGGATAGGAGGAGGCAGAGGG + Exonic
1132549737 16:549449-549471 CTGTGAGAAGAGGAGGCAGCCGG - Exonic
1132549765 16:549539-549561 CTGGGAGAAGAGGAAGCAGCCGG - Intronic
1132826338 16:1907467-1907489 CAGGGAAGGGAAGGGGAAGCCGG - Intergenic
1133189800 16:4125221-4125243 CAGGGGCAGGAGGTGGAAGCTGG + Intergenic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133657250 16:7877806-7877828 CTGGGTAAAGTGGAGGCAGCAGG - Intergenic
1133690458 16:8209662-8209684 GAGGAAAAAGAGGAGGAGCCAGG + Intergenic
1133870538 16:9681717-9681739 CAGGGCAGAGAAGCGGAAGCTGG + Intergenic
1133879824 16:9770862-9770884 CAGGGAAAACCGAAGGGAGCGGG - Intronic
1134038644 16:11051124-11051146 AAGGACAGAGAGGAGGAAGCAGG + Intronic
1134187860 16:12098618-12098640 CAGGCAAAAGAGGAGGAGAGGGG - Intronic
1134225310 16:12385488-12385510 CAGGGAGAAGTGAAGGAAGGAGG + Intronic
1134340859 16:13344439-13344461 AAGGGCATAGAGGAGGAAGAAGG - Intergenic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1134565037 16:15244186-15244208 AAGGGAAATGGGGAGGGAGCAGG - Intergenic
1134737459 16:16512510-16512532 AAGGGAAATGGGGAGGGAGCAGG + Intergenic
1134840721 16:17399433-17399455 CAGTGTAATGAGGAGGGAGCAGG - Intronic
1134930051 16:18199648-18199670 AAGGGAAATGGGGAGGGAGCAGG - Intergenic
1135061804 16:19277410-19277432 AAGGGAAAAGAGGGGGCAGGAGG + Intergenic
1135115797 16:19722529-19722551 CGGAGAAATGAGGAAGAAGCTGG - Intronic
1136054489 16:27678364-27678386 GAGGGAAAAGAAGACGAAGAGGG - Intronic
1136382169 16:29900757-29900779 CAGGGGAGCTAGGAGGAAGCGGG + Exonic
1136539924 16:30923567-30923589 GGGGGAAGAGAGGAGGAAGGAGG + Intronic
1136548368 16:30967913-30967935 CAGGCAAACTAGGAGGAAGGTGG - Intronic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1137270486 16:46899663-46899685 CAGGGAAATGAGGTGGGAGGAGG + Intronic
1137572285 16:49574737-49574759 GAGGGAAAGCAGGAGGGAGCAGG - Intronic
1137576193 16:49601889-49601911 GAGGGAGAAGAGGAGGACTCAGG - Intronic
1137686795 16:50392010-50392032 CAGGGAAGAGGTGGGGAAGCTGG + Intergenic
1137839520 16:51627112-51627134 CATGGAGGGGAGGAGGAAGCAGG - Intergenic
1137840513 16:51636651-51636673 CAGGGAAGAGAAGAGTAAGTGGG + Intergenic
1138153982 16:54685917-54685939 GAGGGAGAAGAAGAGGAAGAAGG - Intergenic
1138226408 16:55299279-55299301 CAGGGAAGACAGGAGCCAGCAGG - Intergenic
1138276608 16:55739612-55739634 CAGGAAAAGGAGGAGGAAATTGG + Intergenic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138319948 16:56103268-56103290 CAGGCAAAGGAGGAGTAACCAGG + Intergenic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138535761 16:57659544-57659566 CAGGGAGAAGTGCAGGAAGATGG - Exonic
1139365407 16:66429416-66429438 CAGGGGATAGGGGAGGATGCTGG + Intronic
1139495516 16:67314237-67314259 AAGGGAAGAGAGGGGGAAGGAGG - Intronic
1139605158 16:68013028-68013050 GAGAGAAAAGAGGAAGAAGAAGG + Intronic
1139782725 16:69365155-69365177 CCGGGAACAGATGAGGAAACAGG - Intronic
1139872411 16:70118189-70118211 AAGAGAAGAGAGGAGGAAGTGGG + Intronic
1140012974 16:71154675-71154697 CAGGAAAAAGGAAAGGAAGCAGG - Intronic
1140207982 16:72949054-72949076 TAGGGAAAGGAGGAGAAAGCAGG - Intronic
1140363360 16:74363106-74363128 AAGAGAAGAGAGGAGGAAGTGGG - Intergenic
1140684748 16:77422609-77422631 GAGAGAAAAAAGGAGGAAGAAGG + Intronic
1140830425 16:78745748-78745770 GGGGAAAAAGAGGAGGAAGAGGG - Intronic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1141294178 16:82751400-82751422 CAGGGAAGTGAGGAGGCAGGAGG - Intronic
1141427141 16:83951884-83951906 CAGGGAGAGAAGGAGGAAGGAGG - Intronic
1141439814 16:84022779-84022801 CAGTGAATAGATGAGGCAGCAGG + Exonic
1141741515 16:85896310-85896332 CAGGGAAGGGATGAGGAGGCCGG + Intergenic
1141862710 16:86728888-86728910 AAGTGAAAAGAGGTGGATGCTGG + Intergenic
1142228696 16:88889381-88889403 CAGGAAAAAGCAGAGGAGGCAGG + Intronic
1142581988 17:948880-948902 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142581996 17:948899-948921 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582004 17:948918-948940 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582012 17:948937-948959 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582096 17:949142-949164 CGGGGAGAGGAGGAGGCAGCGGG - Intronic
1142582124 17:949218-949240 CGGGGAGAGGAGGAGGCAGCGGG - Intronic
1142582152 17:949294-949316 CGGGGAGAGGAGGAGGCAGCGGG - Intronic
1142582180 17:949370-949392 CGGGGAGAGGAGGAGGCAGCGGG - Intronic
1142582208 17:949446-949468 CGGGGAGAGGAGGAGGCAGCGGG - Intronic
1142582250 17:949560-949582 CGGGGAGAGGAGGAGGCAGCGGG - Intronic
1142582299 17:949693-949715 CAGGGAGAGGAGGAGGCAGGGGG - Intronic
1142582307 17:949712-949734 CGGGGAGAGGAGGAGGCAGCAGG - Intronic
1142750082 17:1982314-1982336 AAGAGAAGAGAAGAGGAAGCCGG + Intronic
1142887291 17:2920635-2920657 CAGGGATTAAAGGAGGAAGCAGG + Intronic
1142891538 17:2947229-2947251 GAAGGGAAAGAGGAGCAAGCAGG + Intronic
1142994108 17:3750899-3750921 GATGGAGAGGAGGAGGAAGCTGG + Intronic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1143117789 17:4590519-4590541 CAGGGAGCTGAGGAGGTAGCTGG - Intronic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1143865792 17:9922263-9922285 CTTGGAAAAGATGAGGAAGAGGG + Intronic
1144096142 17:11902419-11902441 CATGGAAAAGAGGGGCAAGAAGG - Intronic
1144279619 17:13712409-13712431 GAGGGAAAAGAAGAGGAAGGTGG + Intergenic
1144300628 17:13920347-13920369 CAGGCAAAAGTGGAAAAAGCAGG + Intergenic
1144363158 17:14516014-14516036 GAAGGAAAAGAGAAGGAATCAGG - Intergenic
1144422846 17:15113855-15113877 CAGGGAAGAGATGAGGAGGCTGG + Intergenic
1144580527 17:16456490-16456512 GAGGAAGAGGAGGAGGAAGCTGG + Intronic
1144886302 17:18464923-18464945 CAGAGAAGAGATGAGGAAGCAGG - Intergenic
1145145903 17:20479388-20479410 CAGAGAAGAGATGAGGAAGCAGG + Intergenic
1145763166 17:27439350-27439372 CAGAGAAGGGATGAGGAAGCAGG - Intergenic
1145798608 17:27669772-27669794 CAGGGCCAAGAGGAGGAAGCAGG + Intergenic
1145883347 17:28367220-28367242 CTGGGTAAAGGAGAGGAAGCTGG - Intronic
1146414787 17:32621853-32621875 TGGGGAAGAGAGGAGGAAGCAGG - Intronic
1146620285 17:34391796-34391818 CAGGGGCAAGATGAGGAAGAGGG + Intergenic
1146650178 17:34601727-34601749 GAGGGAAGAGAAGAGGAAGGAGG + Intronic
1147165689 17:38592054-38592076 CAGGGCAGGGAGGAGGAAGTAGG - Intronic
1147426669 17:40348990-40349012 CAGGGAAAGGAGGAGAAGCCGGG - Intronic
1147440685 17:40445521-40445543 CAGGGAAAACAGGAAGGAGGTGG + Intronic
1147816707 17:43215832-43215854 CAGGAAAAAGACGATGAAGGAGG - Exonic
1147963793 17:44182251-44182273 CTGGGACAAGAGGAAGAAGTTGG - Intergenic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148157411 17:45431986-45432008 CGGGGAATAGAGGGGGAAGGCGG - Intronic
1148220962 17:45861419-45861441 GAGGGAAATGAAGAGTAAGCAGG + Intergenic
1148322569 17:46766449-46766471 CACTGAACAGAGGAGGAAACTGG + Intronic
1148392073 17:47279937-47279959 CAGGGACAACAGGAGGAGTCTGG + Intronic
1148749395 17:49935810-49935832 CAGGGGAAAGAGCCAGAAGCTGG + Intergenic
1148973461 17:51505516-51505538 ATGGGAAAAGGGGAGGAAGTAGG - Intergenic
1149370468 17:55989208-55989230 CTGGGAAGAGAGGAGAAAGGAGG - Intergenic
1149525304 17:57350991-57351013 GAGGGGCAAGAGGAGGGAGCAGG + Intronic
1149603647 17:57909750-57909772 CAGGGAACAGGGGAGGAGCCTGG - Intronic
1149923398 17:60679279-60679301 AAGGGAAAAAAGGAGGAAGTAGG - Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150435011 17:65146990-65147012 CAGGGAACTGAGGAGGCAACAGG - Intronic
1150702276 17:67458193-67458215 AAGGAAAAAGAGGAGGAAGCAGG - Intronic
1151183444 17:72346424-72346446 AAAGGAAAAGAGGTGTAAGCTGG - Intergenic
1151185088 17:72358057-72358079 CAGGGCATAGAGGAGAAAACAGG - Intergenic
1151185616 17:72361893-72361915 GAGGGAAAAGAGGAGGGAGCTGG - Intergenic
1151241683 17:72763170-72763192 GAGGGAGAAGGGGAGGAAGGTGG - Intronic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151362952 17:73599573-73599595 GAGGGAAAAGAGGAGGAGAGAGG + Intronic
1151454554 17:74218195-74218217 GAGGGAAAAGAGGAGCAGGTAGG - Intronic
1151683481 17:75633867-75633889 GAGGGAGAGGAGGAGGAAGGAGG + Intronic
1152418092 17:80175896-80175918 CAGGGATGAGAGAGGGAAGCAGG + Intronic
1152551652 17:81033375-81033397 CAGGGAACACAGCAGGAAGCTGG + Intergenic
1152640824 17:81448504-81448526 CAGGGAAGACGGCAGGAAGCGGG - Intronic
1152856488 17:82667605-82667627 CAGGAGACAGAGGAGGATGCGGG - Intronic
1152912250 17:83011678-83011700 TTGGGAAAAGAGGAGGCACCTGG + Intronic
1152942284 17:83178959-83178981 CAGGGAGAGGAGGCAGAAGCCGG - Intergenic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153321243 18:3776104-3776126 GAGGGAAAAGACGGGGAAGATGG + Intronic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1154345800 18:13542644-13542666 CAGGGAGAAGATAAGGAGGCGGG + Intronic
1155067520 18:22280456-22280478 CAGGGAGAAGGGGAGAAGGCTGG + Intergenic
1155187661 18:23401637-23401659 CAGGGCATTGAGGAGGAAGGAGG + Intronic
1155495687 18:26439620-26439642 CAAGAAAAAGAGGAGGAAGCTGG - Intergenic
1155989191 18:32261558-32261580 AAGTTAAAAGCGGAGGAAGCCGG + Intronic
1156461090 18:37321694-37321716 GAGGGGCAAGAGGAGGAGGCGGG + Intronic
1156512639 18:37654077-37654099 CAGGAAAAAGAGAAGAAACCAGG + Intergenic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1157247634 18:46068596-46068618 CTGGGATAAGAGGTGTAAGCCGG - Intronic
1157415678 18:47500774-47500796 CAGGGAAACAAGGATGAAGGGGG + Intergenic
1157439131 18:47696878-47696900 CAGGGCAAAGAGGAGGGGGTGGG - Intergenic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1157618732 18:49003220-49003242 CAGGTAGAAGGGGAGGAAGAGGG - Intergenic
1157731959 18:50011694-50011716 GAGGGAAAGGAGGAGGAACAGGG - Intronic
1158079886 18:53577278-53577300 CAGGAGAAAGAGAGGGAAGCAGG - Intergenic
1158309838 18:56145906-56145928 GAAGAAAAAAAGGAGGAAGCGGG + Intergenic
1158411257 18:57208110-57208132 CAGGGCAAAGAGGATAAAGGAGG + Intergenic
1158467806 18:57707004-57707026 CAGGAAGAAAATGAGGAAGCAGG + Intronic
1158588827 18:58762853-58762875 CAGGGAATACAGGAGGAAAATGG - Intergenic
1158622178 18:59042403-59042425 CAGTGCTAAGAGGAGGAAGCAGG - Intergenic
1159594802 18:70372321-70372343 CAAGGAAGAGAGGAGGCTGCAGG + Intergenic
1159796092 18:72846153-72846175 CAGAGCCAAGAGGAGCAAGCAGG + Intronic
1160312050 18:77803243-77803265 CAGGGGAAAGATGAGGAACGTGG - Intergenic
1161152756 19:2718201-2718223 CTGGGAAGAGAGGGGGAAGCTGG - Intronic
1161221409 19:3119836-3119858 TAGGGCACAGAGGAGGATGCAGG - Intronic
1161357311 19:3826192-3826214 CAGGGGAAAGAGGAATGAGCAGG - Intronic
1161544821 19:4874060-4874082 CAGGGGAAAAAAGATGAAGCTGG + Intergenic
1161597380 19:5157520-5157542 CATGGAGAAGAGGAGGAGACGGG - Intergenic
1161795094 19:6381779-6381801 CAGGAAAAAGAAGAAGAAGAAGG - Exonic
1162227638 19:9237199-9237221 AAGGGAAAAGAGAAGTAAGAAGG - Intergenic
1162404049 19:10462829-10462851 CAGAGAACAGAGGAGGTAACGGG - Intronic
1162715928 19:12633481-12633503 CAGGAAAATGAGCAGGAAGCAGG - Intronic
1162739377 19:12765445-12765467 CAGGTAAAAGAAAAGAAAGCAGG + Intronic
1162812492 19:13172667-13172689 CGGGTAGAGGAGGAGGAAGCAGG - Intergenic
1162897646 19:13774899-13774921 GAGGGGTAAGAGGTGGAAGCTGG + Intronic
1162943516 19:14028462-14028484 CAGAGATAAGAGGAGGTTGCTGG + Intronic
1163157152 19:15445785-15445807 CGGGGGACAGAGGAGGCAGCGGG + Intronic
1163179966 19:15592348-15592370 CAGGGAAAAGAGGAGAGTACAGG - Intergenic
1163241338 19:16065722-16065744 CATGACAAAGAGAAGGAAGCTGG + Intergenic
1163516268 19:17765770-17765792 CAGGCAGAAGTGGAGGCAGCAGG + Intronic
1163548577 19:17952807-17952829 TAGGGAAAAGAACAGGAACCCGG - Intronic
1163864289 19:19759502-19759524 AAGAGAGAAGAGGAGGAAACAGG - Intergenic
1164564303 19:29314921-29314943 CAGGGTGGAGAGGAGGAGGCTGG + Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1164803594 19:31098698-31098720 CATGGGAACCAGGAGGAAGCAGG - Intergenic
1164858223 19:31541920-31541942 CATGGAAAAGAGGAGGCAGAAGG + Intergenic
1164869261 19:31629521-31629543 CAGGGAGAAGAAGAGAAAGGAGG + Intergenic
1165421251 19:35723042-35723064 CGGGGAAAGGTGGAGGCAGCAGG + Exonic
1165745787 19:38229019-38229041 GAGGAAAAAGGGGAGGCAGCGGG + Intronic
1165957993 19:39514095-39514117 CAGGTAAAGGAGGAGTTAGCTGG - Intergenic
1166554087 19:43686596-43686618 CAGGCAGGAGAGAAGGAAGCAGG - Intergenic
1166788248 19:45382438-45382460 CAGGAAAAAGAAGAGGCAACAGG - Intronic
1167304135 19:48697017-48697039 CAGAGGGGAGAGGAGGAAGCCGG + Intronic
1167608146 19:50492729-50492751 AAGAGGAAAGAGGAGGAAGGGGG + Intergenic
1167608200 19:50492902-50492924 GAGGGAAAGGAGGAGGAAGGAGG + Intergenic
1167706388 19:51083642-51083664 CAGGGAACAGAAGAGGCAGACGG + Intronic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
924988165 2:289036-289058 CAGGGGGAAGAGGAGGAGACGGG - Intergenic
925280762 2:2682994-2683016 CAGGGAGAAGCAGAGGAAGTAGG + Intergenic
925496192 2:4452279-4452301 GAAGGAGAAGAGGAAGAAGCAGG - Intergenic
925898753 2:8493886-8493908 CAGGTCAGAGAGGAGGAAGGAGG - Intergenic
925921010 2:8637873-8637895 CAGGAAAGAGAGGAGAGAGCTGG + Intergenic
926213070 2:10885792-10885814 CAGGGAGAAGAGGAGAGACCAGG - Intergenic
926628846 2:15118801-15118823 CAGGGCAGAGTGGATGAAGCTGG - Intergenic
926688968 2:15719646-15719668 CAGTGAAGAGAGGATGGAGCGGG - Intronic
926690795 2:15731988-15732010 CAGGGAAAAGCAGAGGAAGGAGG - Intronic
926803424 2:16682830-16682852 CAGGGAAAAGGAGAGGATGACGG + Intergenic
926881384 2:17548294-17548316 CAGGAAATAGAGGAAGAAGGGGG - Intronic
927034360 2:19158295-19158317 CACTGAAAAGAGGAAGAAACTGG - Intergenic
927733130 2:25493537-25493559 GTGGGAAAAGAGGTGAAAGCAGG - Intronic
928015299 2:27650597-27650619 CAGGGTCAAGAGCAAGAAGCTGG - Exonic
928704334 2:33931410-33931432 CAGGAAAAAGAGCAGCAAGATGG - Intergenic
928704497 2:33933378-33933400 CAGGCAAAAGAGCAGCAAGATGG - Intergenic
928731751 2:34239930-34239952 AAGGCAAAAGAGGAAGAAGCAGG + Intergenic
928997935 2:37315597-37315619 CAGAGAAAACAGGAGGTAGAGGG - Intronic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929408407 2:41669177-41669199 TAGGGAAAGGAGGAGGAAGGAGG - Intergenic
929449732 2:42028693-42028715 CAGGGAGCAGAGGAGGCAGGAGG + Intergenic
929572767 2:43033100-43033122 AGGGGAGAAGAGGAGGAAACGGG - Intergenic
929602416 2:43212718-43212740 GAGGGAAGAGGCGAGGAAGCAGG + Intergenic
929777829 2:44939470-44939492 AAGGGGCAGGAGGAGGAAGCGGG - Intergenic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
931025596 2:58110682-58110704 AAGATAAAAGGGGAGGAAGCAGG + Intronic
931037002 2:58254917-58254939 GTGGGAAAAGGGAAGGAAGCCGG - Intergenic
931163791 2:59723254-59723276 CTGGAAAAGGAGGAGGAAGTAGG + Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931316509 2:61137754-61137776 CTGGGAAAAGAAGAGGATGCAGG - Intronic
931340731 2:61398468-61398490 CGGGGGAAGGAGGCGGAAGCGGG + Intronic
931340737 2:61398487-61398509 CGGGGGAAGGAGGCGGAAGCAGG + Intronic
931340744 2:61398506-61398528 CAGGGGAAGGAGGCGGAAGCGGG + Intronic
931340757 2:61398543-61398565 CGGGGGAAGGAGGCGGAAGCGGG + Intronic
931671714 2:64653822-64653844 CAGGCAGCGGAGGAGGAAGCAGG + Exonic
931691470 2:64837990-64838012 AAGGGAAAGGAAAAGGAAGCAGG + Intergenic
931893496 2:66702511-66702533 GAAGGAGAAGAGGAGGAAACTGG - Intergenic
932738931 2:74276907-74276929 CAGGGACAAGCAGAAGAAGCTGG + Intronic
932783319 2:74577753-74577775 CAGAGGAAATAAGAGGAAGCTGG - Intronic
932893104 2:75612882-75612904 AAGGGACAAAAGGAGGAAGATGG + Intergenic
933003984 2:76966314-76966336 CAGGGAGCAAAGGAGGAAGTGGG + Intronic
933292881 2:80456827-80456849 CAGGGAAGATTGGAGGAAGCAGG + Intronic
933701006 2:85255544-85255566 CAGGGGACAGAACAGGAAGCAGG - Intronic
933723640 2:85413876-85413898 GTGGGAGAAGAGGAGGGAGCGGG + Intronic
933951908 2:87338348-87338370 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
933982951 2:87568480-87568502 AAAGGAAAAGAGGAGGGGGCAGG - Intergenic
934134150 2:88979124-88979146 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934139087 2:89027824-89027846 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934145158 2:89085831-89085853 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934224094 2:90114724-90114746 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
934236150 2:90234682-90234704 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
934579400 2:95426563-95426585 AAGGGACAAGAGCAGGAAGGAGG - Intergenic
934600043 2:95650161-95650183 AAGGGACAAGAGCAGGAAGGAGG + Intergenic
934678444 2:96265996-96266018 GAGGCAGAGGAGGAGGAAGCCGG - Intergenic
935433017 2:102998284-102998306 CAGGGACAAAAGGAGGAATGAGG + Intergenic
935523238 2:104135553-104135575 CAGGAAAGAGAGAAGGCAGCAGG + Intergenic
935604013 2:104951626-104951648 CAGGGCTAAGGGGAGGAGGCGGG - Intergenic
935687888 2:105700394-105700416 CAGATATAAGAGGAGGAAGATGG - Intergenic
935712830 2:105914237-105914259 CAGGGAAATGAGCAGGGAGGCGG - Intergenic
936023373 2:109012584-109012606 TAAGGAAAAGAGGAGAAAGCAGG - Intergenic
936310890 2:111382315-111382337 AAAGGAAAAGAGGAGGGGGCAGG + Intergenic
936533388 2:113292165-113292187 AAGGGACAAGAGCAGGAAGGAGG + Intergenic
936547969 2:113409180-113409202 CAATGAAAAGAAGAGGAGGCAGG + Intergenic
937027450 2:118711265-118711287 CAGGGAGAAGAGGAGGTTGGTGG - Intergenic
937425917 2:121798226-121798248 GAAGGAAAAGAGAAGGAAGGGGG + Intergenic
937505147 2:122528354-122528376 CAGGGACAGGAGAAAGAAGCTGG + Intergenic
937854527 2:126662865-126662887 CAGGGCAGTGGGGAGGAAGCTGG - Intronic
937953746 2:127407999-127408021 CAGGGGGAAGAGGAGGGGGCGGG - Intergenic
938582952 2:132663782-132663804 CAGGGACAAATGGAGGACGCTGG + Intronic
938979668 2:136514257-136514279 TGGGGGAAAGGGGAGGAAGCTGG + Intergenic
939784778 2:146495455-146495477 CAGGGGAGAGAAGAGCAAGCAGG + Intergenic
940079727 2:149787527-149787549 CAGGGAAAAGAAGAAGGGGCAGG + Intergenic
940195429 2:151089148-151089170 CAGGGAAGAGATGAGGGAGTAGG - Intergenic
940255531 2:151724301-151724323 CAGGGGCATCAGGAGGAAGCAGG + Exonic
940259501 2:151765576-151765598 AAGGGAAAAGTGGAGGAAATAGG + Intergenic
940405133 2:153292700-153292722 CAGGGAAAAGAGATGGAACCAGG + Intergenic
940434398 2:153633632-153633654 CATGGCAAAGAGGAACAAGCTGG - Intergenic
940441185 2:153718627-153718649 CAGTGACATGAGGAGGCAGCAGG + Intergenic
940626308 2:156179747-156179769 CAAGTAAAAGAGAAGGAAGGTGG + Intergenic
940658706 2:156520112-156520134 GAGAGAAAAGAAGAGGCAGCTGG - Intronic
941736318 2:168980923-168980945 CAGGGTAGAGAGGAGGAGACTGG - Intronic
942183517 2:173402859-173402881 AGGGAAAAAGAGGAGGAAACGGG - Intergenic
942494663 2:176527121-176527143 CAGAGAAAAGAGGAAAAAGGAGG - Intergenic
942775514 2:179576767-179576789 CAGGGAAGAGACCAGGAAGCAGG + Intronic
942809802 2:179984675-179984697 CAGGAAAATCAGGAGAAAGCTGG + Intronic
943044076 2:182837522-182837544 CAGGAAAAAGAGGAGGTAAAAGG - Intronic
943263151 2:185692035-185692057 GAGGGAGAAAAGGAGAAAGCAGG - Intergenic
943627063 2:190213544-190213566 GGGGGAAAAGGGGACGAAGCGGG - Intronic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
944231559 2:197399046-197399068 GAGAGAAAAAAGGAGGCAGCTGG + Intronic
944818918 2:203409137-203409159 CAGTGAAAAGAGAAGGTAGTTGG - Intronic
945024887 2:205610848-205610870 AGGGGAAAAGAGGAGAAAGTGGG - Intronic
945969510 2:216222037-216222059 GAGGCAAAAGAGGAGGAGTCTGG - Intergenic
946074739 2:217064500-217064522 CTGGGAACAGAGGAGCAAGTAGG + Intergenic
946137136 2:217656715-217656737 GAGGGAGAAGAGGGGGAAACAGG - Intronic
946148554 2:217748927-217748949 CAGGAAGAGGAGGAGGCAGCAGG - Intronic
946226980 2:218269477-218269499 GAGGAAGAAGAGGAGGAAGAGGG - Exonic
946708655 2:222484715-222484737 CAGGCAGTAGAGGAGGAATCAGG - Intronic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947805151 2:232961416-232961438 CAGCTAAAAGAGCAGGCAGCAGG - Intronic
947982953 2:234425720-234425742 CAGGTGAAAGAGGAAGAGGCAGG - Intergenic
948014595 2:234677717-234677739 AAAGGAAAATAGGAAGAAGCAGG + Intergenic
948814015 2:240500489-240500511 CAGGGAGAAAAGGAGGCAGTGGG - Exonic
949049258 2:241888462-241888484 GAGGGAGAATGGGAGGAAGCAGG - Intergenic
949049283 2:241888538-241888560 GAGGGAGAATGGGAGGAAGCAGG - Intergenic
949049307 2:241888613-241888635 GAGGGAGAATGGGAGGAAGCAGG - Intergenic
949049332 2:241888689-241888711 GAGGGAGAATGGGAGGAAGCAGG - Intergenic
1168996576 20:2137537-2137559 TAGGAAAAAGAGGAGCAAGAGGG - Intronic
1169506381 20:6215340-6215362 CAGGGAAAAGGGGTCGAGGCTGG + Intergenic
1169863222 20:10173222-10173244 CAGGGAAAAGCAGTGGATGCAGG - Intergenic
1169958453 20:11131911-11131933 CAAAGGAAAGAGGAGGAAACAGG - Intergenic
1169966369 20:11222245-11222267 TAGGGAAAAGATGAGGAAGGGGG + Intergenic
1169975129 20:11316674-11316696 CATGGAGAAGAGGAGGAAGTTGG + Intergenic
1170034309 20:11973845-11973867 AAGGAAGAAGAGGAGGAAGAAGG + Intergenic
1170120151 20:12902578-12902600 CATTGAAAGGTGGAGGAAGCAGG - Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170414130 20:16122022-16122044 CAGGGAAGAGTGTATGAAGCTGG + Intergenic
1170509451 20:17061387-17061409 CAGGTAAGTGAGGTGGAAGCAGG - Intergenic
1170596033 20:17806634-17806656 CAGGGTAAGGAGGAGAAAGAAGG + Intergenic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1170835317 20:19878895-19878917 CAAGGTACAGGGGAGGAAGCAGG - Intergenic
1170948857 20:20915948-20915970 CAAGGAAAAGAGAGAGAAGCAGG - Intergenic
1171163611 20:22951391-22951413 CAAGGCAAAGAGGAAGAAGATGG + Intergenic
1171351996 20:24510031-24510053 GAAGGAAAAGAGGAGCAGGCAGG - Intronic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1171466190 20:25329409-25329431 CAGTGAAAACTGGGGGAAGCAGG - Intronic
1172031551 20:31985433-31985455 CAGGGAGAGGAGGAGCAGGCAGG + Intronic
1172039878 20:32036309-32036331 CAGGGAAGTGGGGAGGAGGCTGG + Intergenic
1172100996 20:32483829-32483851 GGGGGAGAAGAGGAGGAAGGAGG + Intronic
1172173942 20:32961110-32961132 CAGGGAACAGAGTGGGGAGCGGG - Intronic
1172435570 20:34926769-34926791 CAGGGACTTGAGGAGGAAACAGG + Intronic
1172572916 20:35984386-35984408 CAGGCCAGAGGGGAGGAAGCTGG - Intronic
1172689415 20:36779914-36779936 CAAGGAGAAGAGGAGGCAGGAGG + Exonic
1173006453 20:39143107-39143129 CGGGGAGAAGAGGAGGGAGTGGG - Intergenic
1173112831 20:40209957-40209979 AAGGGAAGAAAGGAGGAGGCAGG + Intergenic
1173126412 20:40340162-40340184 AAGGGAAGAGAGGAGTAAGATGG + Intergenic
1173352282 20:42256160-42256182 TAGGGAAAAGATGAAGATGCTGG + Intronic
1173575025 20:44107352-44107374 CAGGGAGAAGAGAAGGATGTGGG - Intergenic
1173604898 20:44324862-44324884 CAGTGACCAGAGGAGGAAGCTGG - Intergenic
1173838154 20:46139125-46139147 CTGGGCAAAGAGGAGGGAGAGGG - Intergenic
1174122236 20:48274710-48274732 CAGGGAAAAGACCTTGAAGCAGG - Intergenic
1174476859 20:50801885-50801907 CAGGGGAAAGATGAGGGACCGGG + Intronic
1175140451 20:56857025-56857047 AAGGGAAAGGAGAAGGGAGCGGG + Intergenic
1175298882 20:57928758-57928780 AAGAGAAAGGAGGAGGAAGATGG - Intergenic
1175335775 20:58195322-58195344 CAGGCGATGGAGGAGGAAGCTGG + Intergenic
1175335966 20:58196543-58196565 TAGGGAAATGGGGAGGAGGCAGG - Intergenic
1175490330 20:59376193-59376215 CAAGGACAAGGGGAGGTAGCAGG + Intergenic
1175491547 20:59383926-59383948 CAGGGATGAGTGGAGGAAGGAGG + Intergenic
1175571525 20:60026424-60026446 GAGGGAGAAGAGGAGGCAGAAGG + Intronic
1175573037 20:60038543-60038565 CAGGGATCAGAGGAGAAATCTGG - Intergenic
1175601343 20:60276267-60276289 CAGGGTAGGGAGGAGGGAGCTGG - Intergenic
1175649080 20:60701628-60701650 CTAGGAAAAAAGTAGGAAGCAGG + Intergenic
1175861349 20:62151917-62151939 GAGGGAAAAGAGGAGAACGGGGG - Intronic
1176094849 20:63335902-63335924 CAGGAAGAAGAGGAGGGAGAAGG + Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176307499 21:5131587-5131609 CAGGGAAAAGAGGAAAAAAATGG - Intronic
1176605229 21:8824717-8824739 CAGGTAAAAGAGGAGGTGGATGG - Intergenic
1177004044 21:15648725-15648747 CAGTGAGAAAAGGAGGAAGAGGG - Intergenic
1177013454 21:15755862-15755884 AAGGGAGAAGTGGAGGATGCAGG + Intronic
1178055670 21:28796009-28796031 CAGAGAAAACAGGAGGTAGAGGG - Intergenic
1178096835 21:29224068-29224090 CAGGAAAGAGAGGAGCACGCAGG - Intronic
1178286688 21:31331413-31331435 CAGGGGAAAAATGAGGAAGGAGG + Intronic
1178894548 21:36548135-36548157 CAAGGAAAAGAGGAGACAGAGGG - Intronic
1179573162 21:42290153-42290175 CATGGAGAAGAAGAGGAAGCCGG - Exonic
1179768209 21:43590843-43590865 CAGGGAGAGGAGCAGGAAGGAGG + Intronic
1179849561 21:44130443-44130465 CAGGGAAAAGAGGAAAAAAATGG + Intronic
1179875106 21:44263105-44263127 CAGGGAAGGGAGCAGGAAGGTGG + Intergenic
1179887702 21:44321474-44321496 CAGGCAACAGAGGAGGCAGAAGG - Intronic
1180147175 21:45928126-45928148 CGGGGGCAGGAGGAGGAAGCAGG - Intronic
1180568178 22:16692867-16692889 CAGGGGACAAAGGTGGAAGCTGG + Intergenic
1180728848 22:17966221-17966243 CAGGGAAAGTGGGATGAAGCTGG - Intronic
1180877493 22:19181492-19181514 CTGAGAAATGAGGAGGAAGCAGG + Intronic
1180998121 22:19975563-19975585 CAGGGAACAGATGGGGAAACAGG - Intronic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181507319 22:23368663-23368685 CATGGAAAAGAGGAGGACTGGGG - Intergenic
1181550543 22:23636730-23636752 AAGGGAAAGGAGGAGGCAGGAGG + Intergenic
1181797736 22:25321962-25321984 AAGGGAAAGGAGGAGGCAGGAGG - Intergenic
1181976226 22:26732290-26732312 CAGGGAAAAGGGGAAGCAGCTGG - Intergenic
1182342179 22:29632319-29632341 TTGGGGAAAGAGGAGCAAGCAGG - Intronic
1182366249 22:29781347-29781369 AAGGGAAGAGAGTAGGAAGCTGG - Intergenic
1182366257 22:29781378-29781400 AAGGGAAGAGAGTAGAAAGCTGG - Intergenic
1182681776 22:32085111-32085133 AAAAAAAAAGAGGAGGAAGCGGG - Intronic
1183061837 22:35340889-35340911 CAGGGCAAGGTGGAGGACGCTGG + Intronic
1183144275 22:35974852-35974874 TAGGGAAAAGATGAGGCTGCAGG - Intronic
1183354507 22:37351018-37351040 CATTTAAAAGAGGAGGAACCGGG - Intergenic
1183363980 22:37397543-37397565 CAGGGAAAGGAGGGGGAACGTGG + Intronic
1183843942 22:40524724-40524746 CAGTTAAAAGAGGAAGAAGATGG - Intronic
1183933886 22:41250825-41250847 CAGGGAGAAGAGCAGCCAGCTGG + Intronic
1184190602 22:42892040-42892062 GAGGAAGGAGAGGAGGAAGCAGG + Intronic
1184265117 22:43342610-43342632 CCGGGGAAGGAGGAGGAGGCCGG - Intronic
1184281377 22:43439533-43439555 CACAGCAAAGAGGAGGAAACAGG - Intronic
1184377820 22:44125609-44125631 CAGTGAAAAGAAGCGGAGGCGGG + Intronic
1184509358 22:44924073-44924095 GAGGGAAGAGGGGAGGAAGGAGG + Intronic
1184746842 22:46461156-46461178 GAGGGAAAAGGGGAGGAAGAGGG + Intronic
1184786331 22:46673718-46673740 CTGGGTAAAGAGGAGGACGCCGG + Exonic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
949163559 3:910516-910538 AAGGGCAAAGAGGAGGTAGAAGG + Intergenic
949360071 3:3222154-3222176 CAGGGAACCGAAGAGGAGGCAGG + Intergenic
949379749 3:3431493-3431515 AAGGTTAAAGGGGAGGAAGCAGG + Intergenic
949729722 3:7094538-7094560 CAGGGAAAAGAGTATAAACCTGG - Intronic
949892149 3:8741420-8741442 AAGGTAATAGGGGAGGAAGCTGG + Intronic
949925653 3:9038929-9038951 CAGAGAAATGAGGATGTAGCTGG - Intronic
950107767 3:10399070-10399092 GAGGGAAAAGGGGAGGATGCTGG - Intronic
950121592 3:10485520-10485542 CAGGGAGAAGCGGAGGGAGCGGG - Intronic
950386275 3:12663349-12663371 CGGGTAAGAGAGGAGGAAACTGG - Intronic
950395043 3:12727796-12727818 CAGGGAAACGGGGAGGGAGCTGG + Intergenic
950708193 3:14796760-14796782 CTGAGAAAGGAGGAGGGAGCTGG - Intergenic
950733220 3:14980857-14980879 CTGAGAAAAGAGGAAGAACCTGG + Intronic
951092533 3:18591266-18591288 CAGGAAAAAGCTGAGGGAGCAGG + Intergenic
951157194 3:19370075-19370097 CAAGGCAAAGAGGAAGAAGGTGG - Intronic
951233750 3:20210874-20210896 CAAGGAAAAGTGAAGGAAGCAGG - Intergenic
951906684 3:27713904-27713926 GAGGGAAAAAAGGAAGAAGGGGG - Intergenic
952002350 3:28800646-28800668 AAGGGAGAGGAGGAGGAAGAAGG - Intergenic
952418890 3:33114019-33114041 AAGGGAAAAGGGGAGGGAGAAGG - Exonic
952616518 3:35279486-35279508 CAGGGATAAGAGAACGAAGTTGG + Intergenic
952739206 3:36719572-36719594 CAGGGATGAGAGAAGGAAGGAGG - Intronic
952989230 3:38817052-38817074 CAGTTAATAGAGGAGGAAACTGG + Intergenic
952999926 3:38923201-38923223 AAGGGAGAAGAGGAGAAACCAGG - Intronic
953082720 3:39635618-39635640 CACGCAGAGGAGGAGGAAGCAGG + Intergenic
953436559 3:42881875-42881897 CAGGAAAAACAGAAGGAACCTGG - Intronic
953578950 3:44136135-44136157 AAGGGTAAAGGGGAGGAAGCAGG - Intergenic
953628817 3:44593733-44593755 CAGGGAGTAGAGGATGAGGCAGG + Intronic
953783644 3:45894283-45894305 CAGGGTAAAGAGGAGAAAGGTGG + Intronic
953856566 3:46503800-46503822 CAGGGAAAGGGGGAGGGTGCAGG - Intergenic
953928073 3:46992417-46992439 CAAAGAAGAGAGGAGGAAGATGG - Intronic
953999254 3:47543006-47543028 CAGCGAAGGGAGGAGGGAGCCGG + Intergenic
954196558 3:49000580-49000602 CAGGAACAAGGGAAGGAAGCAGG + Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954787413 3:53104105-53104127 CAGGGAAGAGGGAAGGAAGTTGG + Intronic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
955633386 3:60999698-60999720 AGGGAAATAGAGGAGGAAGCAGG + Intronic
955796755 3:62645194-62645216 CAGGGGAAAGAGTGGGAAGGGGG + Intronic
956196697 3:66660245-66660267 CAGGGAATAGATGAAGTAGCAGG + Intergenic
956685671 3:71825195-71825217 CAGGGGACAGTAGAGGAAGCTGG + Intergenic
957640776 3:82850374-82850396 AAGAGAAAAGAAGAGGAAGAAGG - Intergenic
957771629 3:84700474-84700496 AAGGGAAAAGGGGAGTAAACAGG + Intergenic
957851923 3:85819203-85819225 CAGGAAAAGGTGGAAGAAGCTGG - Intronic
958963036 3:100528504-100528526 CAAGGGACAGAGGAGGAGGCAGG + Intronic
959578213 3:107957703-107957725 CAAGGAAAGGAGGAGGAGGAGGG + Intergenic
959911853 3:111772407-111772429 GAAGGAAAAGAAGAGGAAGAAGG + Intronic
960284370 3:115810718-115810740 CAGGGCCAACAGGAGGAGGCTGG - Intronic
960300224 3:115994236-115994258 CAGGGAAAGAGGGAGGAACCAGG + Intronic
960589167 3:119348903-119348925 GAGTGAGAAGAGGAGTAAGCAGG + Intronic
960610000 3:119547010-119547032 AAGTGAAAAGGGGAGGAATCAGG - Intronic
960744992 3:120877662-120877684 AAGGAAAAAGAGGTGGAAGAGGG - Intergenic
960874529 3:122283906-122283928 CAGGGAGAAGAGGAGGAGGTAGG - Exonic
960942819 3:122945783-122945805 AGGGGAAAAGAAGAGGAAACAGG + Intronic
961033211 3:123624402-123624424 CAGAGAAGAGATGAGGAAACAGG - Intronic
961504012 3:127358239-127358261 CAGGGGAAAGAGGAGGCAAGGGG - Intergenic
961653481 3:128429002-128429024 CAGGGAAAAGTGGAGGTCCCTGG + Intergenic
961908050 3:130283115-130283137 CAGGGAAAAGAGGAGAAACCAGG + Intergenic
962694750 3:137937016-137937038 AGGGGAAAAGAGGATGAGGCAGG + Intergenic
963471082 3:145742658-145742680 GAGGGGAAAGAGAAAGAAGCAGG - Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
964444597 3:156745446-156745468 GAAGGGAAAGAGGAGGAAGCAGG - Intergenic
964704796 3:159606665-159606687 GAGGGACTCGAGGAGGAAGCAGG + Intronic
965039519 3:163488626-163488648 CAGGAGAAAGAGGAAGAAGGGGG + Intergenic
965524525 3:169702004-169702026 AAAGGAAAAGAGGAGGAAGAAGG - Intergenic
966602737 3:181791117-181791139 AGGGGAAAAGAGGGGAAAGCAGG + Intergenic
967298752 3:187991320-187991342 CAGGTGAAAGAGCATGAAGCTGG - Intergenic
967553829 3:190831508-190831530 TAGGGAAAGGAGGGGGAAGAAGG - Intergenic
967664886 3:192159079-192159101 TAGAGAAATGAGGAGGGAGCTGG - Intronic
967877042 3:194274582-194274604 CAGGGAAAAGAGGACAAAAGTGG + Intergenic
968181910 3:196601681-196601703 AAGGGAAAGGAGGAGGAAGCTGG - Intergenic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
969164931 4:5299293-5299315 CAGTGAAAAGGGAAGGAAACAGG + Intronic
969239798 4:5890676-5890698 CAGGGAGAAGAGGAAGGAGTAGG + Intronic
969275237 4:6130198-6130220 CAGGGGAAGAAGGAGGGAGCGGG + Intronic
969321652 4:6416597-6416619 CAGGGACAAGAGGAGCCTGCAGG - Intronic
969464968 4:7350905-7350927 CAGGGAAGAGAAGATGAAGTTGG - Intronic
970017189 4:11525314-11525336 CAGGGCAAAGAGGACAAGGCTGG - Intergenic
970247852 4:14081948-14081970 AAAGGAAAAGGGGAGGAAACAGG + Intergenic
970641321 4:18069488-18069510 CAGGGAAGAGAGGTGGAGGGAGG - Intergenic
970822848 4:20239214-20239236 AGGGGAAAAGAGCAAGAAGCAGG + Intergenic
971195168 4:24466395-24466417 TGGGGATAAGAAGAGGAAGCTGG + Intergenic
971454611 4:26832627-26832649 GAGGAAAAAGAGGAAGGAGCTGG + Intergenic
971570946 4:28210010-28210032 GAGGGGAAGGAGGAGGAAGAGGG - Intergenic
972164567 4:36266664-36266686 GAGAGAAAAGGGGAGGTAGCTGG - Intergenic
973769744 4:54195480-54195502 AATGGAAGAGAGGAGGAAGAGGG + Intronic
973884859 4:55310281-55310303 CAGTGAAAAGAGAAAAAAGCAGG + Intergenic
974349413 4:60724892-60724914 CAGGGAAGAGCTGAGAAAGCAGG + Intergenic
974745773 4:66073817-66073839 AAGAGAAAAGAGAAGAAAGCAGG - Intergenic
975193133 4:71489936-71489958 CAGGGAAAAGAGCAGGAGAGAGG + Intronic
975546726 4:75568032-75568054 CAGGAAACAAAGTAGGAAGCAGG - Intergenic
975580133 4:75899006-75899028 TGGGGAAAATAGAAGGAAGCAGG - Intronic
976428716 4:84937360-84937382 CAGGGAGAAGAGGAGGAACTAGG - Intronic
976455777 4:85245746-85245768 GAAGGAAATGAGGAAGAAGCTGG + Intergenic
976823280 4:89231721-89231743 CAGGGAAGAGAAGTGCAAGCAGG - Intergenic
977361907 4:96016105-96016127 AAGGGAAAAGAGGAATAAGCTGG + Intergenic
977731857 4:100363273-100363295 TAGGGAAAAGCAGAGGAAGCTGG - Intergenic
977900241 4:102414122-102414144 CAAGCAAAAGAGGAGGGGGCAGG - Intronic
977937271 4:102821427-102821449 CAGGGAATAAATGAGGAAGATGG - Intronic
978145799 4:105369787-105369809 AAGGGATAAGAGGAGGGAGAAGG + Intronic
978362929 4:107949933-107949955 CAGGCAAAAGTGGAGGAAAGAGG + Intronic
978394020 4:108258648-108258670 CAGGGAAAAGAGGAACATGATGG + Intergenic
978628770 4:110718818-110718840 GAAGGAAAAGAGGAGCAAGGAGG - Intergenic
978857091 4:113405505-113405527 CTGGGAAAAGAGAAGAAACCAGG - Intergenic
979333243 4:119440103-119440125 AAAGAAAAAGAGGAAGAAGCAGG + Intergenic
979998948 4:127466128-127466150 CAAGGAAATGAGGAGAAAACTGG + Intergenic
980269681 4:130567912-130567934 AAGAGAAAATAGGAGGAAGAAGG + Intergenic
980479461 4:133368883-133368905 CAGGGAGAAGTGGGGGAAGAGGG + Intergenic
980571839 4:134630009-134630031 CAGCAAAAAGAGGAAGGAGCTGG - Intergenic
980998825 4:139808567-139808589 AAAGGCAAAAAGGAGGAAGCAGG + Intronic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
982058477 4:151577922-151577944 AAGGGAGAAGATGAGGAAGTTGG - Exonic
982260258 4:153488437-153488459 CAGGGCCCAGAGGAGGCAGCCGG + Intronic
982721379 4:158863490-158863512 CAGGGAAGAGGGAGGGAAGCCGG + Intronic
983001024 4:162413877-162413899 GAGAGAAAAGTGGAGGAGGCGGG + Intergenic
984096000 4:175435674-175435696 GAGGGAAAAGGGGAGGTATCGGG + Intergenic
984320531 4:178190200-178190222 CAGGGAAAAGAAGGGGACGCAGG + Intergenic
984326626 4:178262551-178262573 GAGGGAGAAAAGTAGGAAGCAGG + Intergenic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984456661 4:179977686-179977708 GAGGGAGAAGAGGATGAAGAGGG - Intergenic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
985210371 4:187586457-187586479 CAGTGAGATGAGGAAGAAGCAGG - Intergenic
985644058 5:1076816-1076838 CAGGGAGAAGGGCAGGAAGATGG + Intronic
985670032 5:1202257-1202279 CAGGGAGCAGAGGAGGTAGCTGG + Intronic
986061736 5:4198167-4198189 CAGGGAAAATAGAAGGCATCTGG + Intergenic
986063342 5:4212342-4212364 CAGGAAGTTGAGGAGGAAGCTGG + Intergenic
986202776 5:5593023-5593045 GAGGAAAAAAAGAAGGAAGCTGG - Intergenic
986283831 5:6345593-6345615 CAGAGAACAGAGGAGGAGGGAGG + Intergenic
986719051 5:10547099-10547121 CAGTGAAAAGGGGAGAAAACAGG + Intergenic
987425991 5:17773049-17773071 AGGGGAAAAGAGTGGGAAGCGGG - Intergenic
987608802 5:20175343-20175365 CAGGAAAAATAGGAGGCAGCAGG - Intronic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988050102 5:26016462-26016484 CATGAAAAAGAGAATGAAGCTGG + Intergenic
988404706 5:30809435-30809457 AAGGGAAAATAAGTGGAAGCTGG - Intergenic
988654167 5:33189750-33189772 TAGGGAAGGGAGGAGAAAGCAGG - Intergenic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
988918792 5:35921874-35921896 CAGTTAAAAGAGGAGGAAACAGG - Intronic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
989606432 5:43248519-43248541 AATAGAAAAGAGGAGGGAGCTGG + Intronic
990302145 5:54459844-54459866 AAGGGATGGGAGGAGGAAGCAGG + Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
990937707 5:61167811-61167833 CAGGGAAAATAGGCTGAAACAGG - Intergenic
991163476 5:63533044-63533066 CAGGGAAAACTAGAGGAGGCTGG - Intergenic
991198541 5:63962257-63962279 AAGGGAAGTGAGGAGGAAGAGGG - Intronic
991482175 5:67092543-67092565 CAGGGAAAAAAGGATTAAGTAGG - Intronic
991585944 5:68202030-68202052 CATGAAAAACAGGAGGAACCAGG - Intergenic
991747910 5:69765950-69765972 CAGGGAAACGAGGAAGAATTTGG + Intergenic
991799486 5:70345798-70345820 CAGGGAAACGAGGAAGAATTTGG + Intergenic
991829111 5:70664240-70664262 CAGGGAAACGAGGAAGAATTTGG - Intergenic
991891845 5:71345227-71345249 CAGGGAAACGAGGAAGAATTTGG + Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992024260 5:72654939-72654961 GAGGGAAAAGAGGAGGAAAATGG - Intergenic
992132686 5:73709349-73709371 CAGGGATTAGAGGTGGGAGCAGG - Intronic
992142615 5:73814403-73814425 CATGGAAACAAGGAGCAAGCTGG + Intronic
992258664 5:74948199-74948221 CACTGCAAACAGGAGGAAGCAGG + Intergenic
992689032 5:79225493-79225515 GAGGAAAATGAGAAGGAAGCTGG - Intronic
993196772 5:84758463-84758485 CAGGTAAAAGAGAAGTGAGCAGG - Intergenic
993948087 5:94138680-94138702 CAGGGAAAAGAGTGGGCAGGGGG - Intergenic
994134958 5:96275551-96275573 CAGGGAAAGGAGGTGGAGACAGG - Intergenic
994440137 5:99791528-99791550 AAGGTAAGAGAGGAGGAAGGAGG + Intergenic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
994784043 5:104132832-104132854 CATGCTGAAGAGGAGGAAGCTGG - Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995751489 5:115457300-115457322 CAGGGAAAAGAGGTGGCACTGGG + Intergenic
995866550 5:116697864-116697886 CATAGAAAAGAGGAGAAGGCCGG + Intergenic
995879757 5:116831158-116831180 CAGGGAACTTAGGAGCAAGCAGG + Intergenic
995936812 5:117526721-117526743 CAAGGAAAAGAGAAGAAAGAAGG + Intergenic
995942691 5:117602987-117603009 AAGAGAAGAGAGGAGGAAGAAGG + Intergenic
996100978 5:119445607-119445629 CGGGGAAAGAAGGAGGGAGCGGG - Intergenic
996311211 5:122107866-122107888 CAGCAAAATGTGGAGGAAGCAGG - Intergenic
996354580 5:122581605-122581627 CTGGGAAAAAAAGAGGAAGAGGG + Intergenic
996398238 5:123034441-123034463 GAGCCAAGAGAGGAGGAAGCTGG - Intronic
996570439 5:124928037-124928059 AAGGGAGAAAGGGAGGAAGCAGG + Intergenic
996791937 5:127302791-127302813 AAAGGAAAGGAGGAGGAAGCAGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998379373 5:141713117-141713139 CAGGGAAAAGAGAAGGCCTCTGG - Intergenic
998813217 5:145986888-145986910 CAGGGAAAAGGGAAGGAAGTAGG - Intronic
998975529 5:147642251-147642273 CAGGGAACAGAGTAGCTAGCGGG + Intronic
999008348 5:148006520-148006542 AAGGGAAAAAAGGGGGAAACAGG - Intergenic
999050953 5:148523421-148523443 GAGAGAAAAGGGGAGGAAGAGGG + Intronic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999316699 5:150588671-150588693 CAGGGGAGAGAAGAGGAGGCTGG + Intergenic
999451564 5:151682129-151682151 CAGGAAATAGAAGTGGAAGCAGG - Intronic
999875720 5:155803577-155803599 CAGAGAAGAGAGAGGGAAGCAGG + Intergenic
1000030184 5:157394742-157394764 CAGGGAAGAGAGAAGGGAGGAGG + Intronic
1000290432 5:159865053-159865075 CAGAGAAAAGGGGAGGATTCGGG + Intergenic
1000489833 5:161897672-161897694 GAGAGAAAAGAGGGGGAAGATGG + Exonic
1000634140 5:163624386-163624408 CAAGGAAAAAGGGAGAAAGCAGG + Intergenic
1001012083 5:168107732-168107754 CTGAGCAAAGAGGAAGAAGCAGG - Intronic
1001150548 5:169223875-169223897 GAGGGAAAGGAGGAGGCTGCAGG + Intronic
1001329587 5:170752733-170752755 CAGGGAAGAGGAGAGGAAGTAGG - Intergenic
1001825486 5:174741882-174741904 CATGAAGTAGAGGAGGAAGCAGG + Intergenic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1002094773 5:176824266-176824288 CAGGGACAAGCGGAGGGAGGAGG + Intronic
1002331195 5:178442122-178442144 CAAGGGGAAGAGGAGAAAGCAGG - Intronic
1002563496 5:180097771-180097793 CCTGCAAAAGAGGAGGAGGCAGG + Intergenic
1002656531 5:180753240-180753262 CAGGGAAAAGGTGAGCAAGAGGG + Intergenic
1002870688 6:1164932-1164954 CAGGAAAAAAAGGAGAAACCAGG + Intergenic
1002941442 6:1720152-1720174 CAAGGAAAAAAGGAGGAAGTTGG + Intronic
1002980068 6:2127597-2127619 CAAGGAAGTGAGGAGGAAGCCGG - Intronic
1004127391 6:12887014-12887036 CAAGGGGAAGAGGAGGAAGAGGG - Intronic
1004285760 6:14318980-14319002 CAGGGAAAAGTTAAGGAAGCTGG - Intergenic
1004688177 6:17968220-17968242 CAGGAGAAAGAAGAGTAAGCAGG + Intronic
1004988463 6:21109971-21109993 AAAGGATATGAGGAGGAAGCCGG - Intronic
1005444479 6:25907509-25907531 CAGATAAAAGAAGAGGGAGCAGG + Intergenic
1005487000 6:26310085-26310107 CAGAGAAAAGAGCAAGAAGCGGG + Intergenic
1005497282 6:26398806-26398828 CAGGGAAGATGGGAGGAAGGAGG - Intergenic
1005881716 6:30067373-30067395 CAGGGAGGAGAGGAGGAAGGGGG - Exonic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1005925357 6:30440198-30440220 CAGGAAAAAAAGGAGGACCCAGG + Intergenic
1005973316 6:30778438-30778460 AAGGGAAGAGAAGGGGAAGCAGG + Intergenic
1005987491 6:30884006-30884028 CAGGGCACAGAGGAAGAAGCAGG - Intronic
1006170466 6:32089054-32089076 CAGGTTAAAGAGGAGGACTCAGG + Intronic
1006263169 6:32894165-32894187 GAGGGGAAAGAGGGGGAAGGGGG - Intergenic
1006459609 6:34150733-34150755 AAAGGAAAAGCAGAGGAAGCAGG + Intronic
1006524215 6:34589938-34589960 AAGAGAAAAGAGGAGGAAAAGGG + Exonic
1007339556 6:41181868-41181890 CAGGGAAGAGAAGAGGGATCTGG + Intergenic
1007666317 6:43515412-43515434 GATGGAAAAGAAGAGGAAGATGG + Intronic
1007874417 6:45079467-45079489 AGGGGAAAGGAGGAGGAAGGAGG + Intronic
1007917211 6:45572799-45572821 CAGGGAAGAGAAGAGGAGCCTGG + Intronic
1008148736 6:47924077-47924099 CAGGGAATAAAGGATGTAGCCGG - Intronic
1008228433 6:48952576-48952598 GAGGAAAAAGAAGAGGAAGATGG + Intergenic
1008805729 6:55425391-55425413 CAGGGGAAAATGGAGGAATCTGG - Intergenic
1008898191 6:56581544-56581566 GAGGAAAAAAAGGTGGAAGCAGG + Intronic
1009318375 6:62253484-62253506 AAGGCCAAAGAGGAGGAGGCAGG - Intronic
1010291164 6:74139784-74139806 CAGGAGAAAGACGAGCAAGCAGG - Intergenic
1010368091 6:75076076-75076098 AAGGGAAAAGAAAAGGAAACAGG + Intergenic
1010928393 6:81770981-81771003 CAGGGAAATGAGAAGGAAAGGGG + Intergenic
1011274153 6:85612901-85612923 CAGGGAAAAGGGGTCGAGGCCGG - Exonic
1012121192 6:95368648-95368670 AAGGGGAAAGAAGAGGAAGAAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012304779 6:97640808-97640830 CATGGAAAAGAGAAGAAATCAGG - Intergenic
1012627466 6:101421371-101421393 CGGAAGAAAGAGGAGGAAGCAGG + Intronic
1012630007 6:101454111-101454133 CAGGAAAGAGAGGAGGCAACAGG - Intronic
1012724780 6:102796775-102796797 CAGTGAAAAGGGTAGGAAGTGGG + Intergenic
1013087997 6:106873004-106873026 CTGTGAAAAGGGGAAGAAGCAGG + Intergenic
1013480210 6:110546520-110546542 CAGGAAGATGAGGAGGAAGGGGG - Intergenic
1013862449 6:114652156-114652178 AAGGAAAAAGAAGAGGAAGCAGG - Intergenic
1014215287 6:118746899-118746921 CAGGGAGATGTGGAGGAAGCTGG - Intergenic
1014725037 6:124962866-124962888 GAGGAGGAAGAGGAGGAAGCTGG + Exonic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1015041687 6:128728158-128728180 CAGAGAAAAGAGGAGAGAGATGG - Intergenic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015969456 6:138729819-138729841 CAGGGAAAAGAGGATAGAGTTGG + Intergenic
1016531715 6:145065689-145065711 CAGGGAAAAGAGGAGGAGTTTGG + Intergenic
1016712158 6:147186142-147186164 TGGGGAGAAGAGGAGGAAACAGG + Intergenic
1016840588 6:148520466-148520488 CAGGAGAGAGGGGAGGAAGCCGG - Intronic
1017018373 6:150119431-150119453 GAGGGACCACAGGAGGAAGCTGG + Intergenic
1017485765 6:154900714-154900736 CAAGGAAAGGAGGGGGAAGATGG + Intronic
1017772341 6:157652910-157652932 AAGGGGAGAGAGGAGGAAGGGGG + Intronic
1017786808 6:157763252-157763274 CAGGGAAAAGGGGAGGGCGGCGG + Intronic
1018205841 6:161436311-161436333 GAGGGCAGAGAGGAGGAGGCGGG + Intronic
1018415943 6:163602133-163602155 GAGGACAAAGAGGAGGAAGAGGG + Intergenic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018809430 6:167287178-167287200 CAGCGAGCAGTGGAGGAAGCCGG - Intronic
1018842130 6:167524986-167525008 CAGGGGAAGGAGGGGGCAGCAGG - Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019659546 7:2216358-2216380 CACGGCTAAGAGAAGGAAGCCGG + Intronic
1019786816 7:2982440-2982462 CTGGGAAATAGGGAGGAAGCCGG + Intronic
1020094551 7:5361288-5361310 CGTGGAAAAGAGGAGGAATTAGG + Intronic
1020668097 7:11072869-11072891 CAGAGAAAAGAGGAGGTGTCAGG + Intronic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1021178897 7:17483341-17483363 CAGGGTGGTGAGGAGGAAGCTGG - Intergenic
1021576509 7:22110140-22110162 CAGGGAAAGGATGGAGAAGCAGG - Intergenic
1021616150 7:22505096-22505118 AAGGGAGAAGAGGAAGAAGGAGG + Intronic
1022071885 7:26923884-26923906 CAGGAAAATGATGAAGAAGCTGG + Intronic
1022441272 7:30435489-30435511 CAGGTACAGGAGGAGGAAGTGGG - Intronic
1022473329 7:30694853-30694875 AAGGGAAGAAAGGAGGAAGGAGG + Intronic
1022491473 7:30823423-30823445 CAAGGAAAAGAGAAAGAAGATGG - Intronic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1022639212 7:32165555-32165577 CAGGAAAGAGAAGAGTAAGCAGG + Intronic
1022925941 7:35056312-35056334 AAGGGAGAAGAGGAAGAAGGAGG + Intergenic
1023031743 7:36095642-36095664 GAGGGAAGAGAGAAGGAAGCGGG + Intergenic
1023284853 7:38608435-38608457 CAGTGAAAAAAGGTGGAAGAAGG - Intronic
1023375476 7:39551205-39551227 TAGGCTGAAGAGGAGGAAGCGGG - Intergenic
1023376498 7:39561337-39561359 TAGGGAAGGGAGGAAGAAGCAGG - Intergenic
1023534813 7:41197031-41197053 CAGGGAACAGGAGAGGAAGCTGG + Intergenic
1023656650 7:42429218-42429240 TAGGGAGAAGTGGAAGAAGCAGG - Intergenic
1023863124 7:44227164-44227186 CAGGGGACAGAGGAGGGTGCAGG + Intronic
1023863130 7:44227183-44227205 CAGGGGACAGAGGAGGGTGCAGG + Intronic
1024847191 7:53660301-53660323 CAGGAAGAAGAGGAAAAAGCAGG + Intergenic
1024883100 7:54111807-54111829 CAGGGAAAAGGGAAGGAAAAGGG + Intergenic
1025086689 7:56029113-56029135 CAATGAAAAGAGGAGGAAATTGG - Intronic
1025198730 7:56949510-56949532 GAGGGAGAAGAGGAGGGAGAGGG - Intergenic
1025986413 7:66456666-66456688 GAGGCAAAAGAGGAGGACACAGG - Intergenic
1026285041 7:68955400-68955422 CAGAGAAAAGGGGAAGAGGCAGG + Intergenic
1026297958 7:69072298-69072320 GAGCCAAAAGAGGAGGAAGAAGG + Intergenic
1026300846 7:69096769-69096791 AAGGGAAGAGAAGAAGAAGCAGG + Intergenic
1026379010 7:69780526-69780548 TAGGGCAAAGAGGAGGAGGGCGG + Intronic
1026578521 7:71594650-71594672 CAGGCAGAAGGGGAGGAGGCAGG + Intronic
1026638625 7:72105750-72105772 CAGGGAGAAGAGGAAGAAGAAGG + Intronic
1026849132 7:73714060-73714082 ATGGGAGAAGAGGAGGAAGATGG - Intronic
1027588467 7:80087880-80087902 CTAGGAAAAGAGGAGGCAGCAGG + Intergenic
1028376321 7:90149239-90149261 AAGGGAGAAGAGGAAGAAGGAGG - Intergenic
1028417330 7:90595195-90595217 CAGGGGAGAGAGAAGGAAGGTGG - Intronic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1028962255 7:96761923-96761945 CAGGGAAGTGGGGAGAAAGCTGG + Intergenic
1029241602 7:99167171-99167193 CAGGGCACAGAGGTGGGAGCTGG - Intergenic
1029644550 7:101845546-101845568 GAGGGAATAGAGGAGGAGGCTGG + Intronic
1029823947 7:103171002-103171024 AAGGGAGAAGAGGAAGAAGGAGG + Intergenic
1030047197 7:105508250-105508272 GAGGAAGAAGAGGAGGAAGATGG - Exonic
1030307199 7:108030943-108030965 CAGGGAAATGAAGAGTGAGCTGG - Exonic
1030699567 7:112622904-112622926 GAGGGAAGAGGGGAGGAAGGAGG + Intergenic
1031380256 7:121077006-121077028 AAGGGCAAAGAGGAGGATACAGG - Intronic
1031696177 7:124857676-124857698 AAGTGAAAAGAGGATGGAGCAGG - Intronic
1031981662 7:128130913-128130935 CAGGGAGAAAAGGAGGAAGGAGG - Intergenic
1032439760 7:131933401-131933423 GAGGAAAAAGAGGAAGAAGAAGG + Intergenic
1032456424 7:132076457-132076479 CAAGGAACACAGGAGGCAGCTGG - Intergenic
1033015964 7:137672054-137672076 CAGGGAACAGAGTAGGTAGATGG - Intronic
1033454645 7:141491862-141491884 CAGGGGAGAGATGAGGAGGCAGG - Intergenic
1033608940 7:142947167-142947189 CAGGGACAGGAGGAGGTAGCTGG + Intronic
1033665147 7:143433980-143434002 CAGGGAAAGGTGGAGGAAAAAGG - Intergenic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034160150 7:148987876-148987898 CAGGGACAAAAGGCAGAAGCAGG + Intergenic
1034286694 7:149888647-149888669 CAGGGAAGGAAGGAGGAAGTGGG + Intergenic
1034394083 7:150807022-150807044 CTGGGAGAAGGGGAGGAAGCAGG - Intergenic
1034426355 7:151016239-151016261 CATGGAAAGGAGGAGGAATGAGG + Intronic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1034828472 7:154288254-154288276 CAGGGATGAGAGGAGGCAGCAGG + Intronic
1034859170 7:154581483-154581505 CAGGGAAAGGAGGAGAACACGGG + Intronic
1034906821 7:154956392-154956414 GAGAGAAAAGATGAGGAACCTGG + Intronic
1035158082 7:156930336-156930358 CTGGGAGAAGGGGAGGAAGACGG - Intergenic
1035669826 8:1408853-1408875 CAGGGCACAGAGAAGAAAGCTGG + Intergenic
1035905817 8:3509064-3509086 CCAGGTAAAGAGGAGGAAACTGG - Intronic
1036076903 8:5512425-5512447 CAGGAGAAAGAGGAAAAAGCAGG - Intergenic
1036185945 8:6622409-6622431 CTGGGGAATGCGGAGGAAGCAGG + Intronic
1036387171 8:8292552-8292574 AAGGGGAAAGAGGAGCAGGCCGG - Intergenic
1036465400 8:8992685-8992707 CAGAGAAAAAGGAAGGAAGCAGG + Intergenic
1036603304 8:10283585-10283607 AGGGGGAAAGAGGAGGAAGGGGG - Intronic
1036640439 8:10580104-10580126 CAGGGAAAGGGGGAGGCAGGTGG + Intergenic
1036746959 8:11416739-11416761 CAGGCAGAAGAGGAGGAAGTTGG - Intronic
1036796051 8:11757568-11757590 GTGGGGAAGGAGGAGGAAGCTGG + Intronic
1037165138 8:15817973-15817995 AATGGAAAAAAGGAGGAAGCTGG + Intergenic
1037622079 8:20573089-20573111 CAGGGAGCAGAGGAGGAAGCAGG - Intergenic
1037669593 8:21002664-21002686 CTGGGCAAACAGGAAGAAGCTGG + Intergenic
1037824160 8:22151105-22151127 CCGGGAAATGAGGAGGAGACAGG - Intronic
1037954287 8:23042135-23042157 CAGGGTCAAGACCAGGAAGCAGG - Intronic
1038338570 8:26664735-26664757 AAGGGAAGACAGGAGGAAGCTGG - Intergenic
1038421012 8:27434070-27434092 CTAGGAAGAGAGGAGGAAGGAGG - Intronic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1039102904 8:33959392-33959414 CAGGGAAAAAAGGAGAAAACAGG + Intergenic
1039790338 8:40870860-40870882 CAGGCTAAAGAAGAGGATGCTGG + Intronic
1039884077 8:41645657-41645679 CGGGGAAAAGGGGAGGGTGCAGG - Exonic
1040404191 8:47084277-47084299 AATGGAAAACAGGAGAAAGCAGG - Intergenic
1040976457 8:53198938-53198960 TGAGAAAAAGAGGAGGAAGCCGG + Intergenic
1041023694 8:53662365-53662387 CAGGGGGAAGAGGAGGAAATTGG + Intergenic
1041645069 8:60243276-60243298 CCTGGAAAAGAGGAGGAGGGAGG - Intronic
1041916753 8:63146261-63146283 GAGGAAAAAGAGGTGGAATCAGG + Intergenic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1043243488 8:77967406-77967428 CATGGAAAAGAGGTGGGAGGAGG + Intergenic
1043267391 8:78283551-78283573 CAGGGCAAAGAATAGGAAGGAGG - Intergenic
1043386432 8:79752561-79752583 GAGGAAAAGGAGGAGGAAGAAGG + Intergenic
1043782983 8:84360566-84360588 CAGGTAAGACAAGAGGAAGCAGG + Intronic
1044769366 8:95613888-95613910 CAGGGAAAAGGGCAGGAAGGGGG - Intergenic
1044805659 8:96005812-96005834 TTGGGAAAAAAAGAGGAAGCAGG + Intergenic
1045030508 8:98130659-98130681 TAGAGAAAAGAGTAGGAACCAGG + Intronic
1045327594 8:101127996-101128018 CAAGGAAAAGGGGTGGAAGTAGG + Intergenic
1045409750 8:101904920-101904942 TGGGCAAAAGAGGAGGAAACTGG - Intronic
1045474140 8:102538708-102538730 CGGGGAGAAGCAGAGGAAGCAGG + Intergenic
1045503048 8:102757955-102757977 CAGGTAAGAGAGGAGGGAGAGGG + Intergenic
1045777711 8:105825247-105825269 AAAGGCAAAGAGGAGGCAGCAGG + Intergenic
1046342956 8:112882532-112882554 AAGGGAAAAGAGTGGGAAGGAGG - Intronic
1047326655 8:123845037-123845059 TAGTGGAAAGAGGAAGAAGCAGG + Intergenic
1047428305 8:124766859-124766881 GAGAGCAAAGAGGAGGATGCTGG + Intergenic
1047446863 8:124927617-124927639 CAAAGGAAGGAGGAGGAAGCCGG + Intergenic
1047562705 8:126007109-126007131 CAATAAAAAGAGGAGGAAGTAGG + Intergenic
1047577180 8:126169423-126169445 CAGGGAAATGAGGAGTGAGGAGG - Intergenic
1047811930 8:128420063-128420085 CAGGGAAAGGAGGAAGAAAGAGG - Intergenic
1047851546 8:128862963-128862985 CAGGGATAAGGGGAGGAGTCAGG - Intergenic
1048047970 8:130791239-130791261 CAGGGAAAAGGGGAGAATGCTGG + Intronic
1048062260 8:130932475-130932497 TGGGGAAAAGAGAAGGAAGTGGG - Intronic
1048284838 8:133133672-133133694 CTGGGACAAGTGGAGGGAGCTGG + Intronic
1048317290 8:133371593-133371615 GAGGGAAGAGAAGAGGAAGCAGG + Intergenic
1048557919 8:135499088-135499110 CAGGTAAAAGAGGTGGAACATGG + Intronic
1049023107 8:139971049-139971071 CAGAGAAAAGAGGTGGATTCCGG - Intronic
1049181599 8:141225858-141225880 GAGGGCAAAGGGGAGGAGGCTGG - Intronic
1049306940 8:141908950-141908972 GAGGGACAGGAGGAGGAAGCTGG - Intergenic
1049329503 8:142042785-142042807 CAGAGAAAACGGGAGGAAGCGGG + Intergenic
1049340484 8:142109728-142109750 CAGGGTGCAGAGGAGGCAGCTGG - Intergenic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1049403689 8:142442375-142442397 CTGGGAGAGGAGGAGGAGGCAGG - Intergenic
1049550598 8:143256528-143256550 CAAGGAAAAGATGAGAGAGCTGG + Intronic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049665560 8:143841151-143841173 CTGGGAGACGAGGAGGAAACAGG - Intergenic
1049672578 8:143876522-143876544 AAGGGAAGGGAGGAGGAAGCAGG - Intronic
1050230995 9:3525997-3526019 GAGGGAAGAGGGGAGGAGGCGGG + Intronic
1050441545 9:5669279-5669301 CAGGGAAAAGGGTGGGAGGCGGG - Intronic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051301846 9:15660463-15660485 GAGGGAAAAGGGCAGGAAGGGGG - Intronic
1051328435 9:15998159-15998181 CTGGGAACCGAGGATGAAGCAGG - Intronic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051596129 9:18825971-18825993 CAGTACAAAGAGGAGGAAACAGG - Intronic
1052095697 9:24381092-24381114 CAGGGAAGAGAAGAGGAGTCAGG + Intergenic
1053161649 9:35817668-35817690 GAGGGATAAGAGTAGGGAGCAGG - Exonic
1053361895 9:37493972-37493994 CAGGGCACAGAGGAGGGAGAAGG + Intronic
1053900931 9:42794875-42794897 CAGGGAGAAGAGTGGGCAGCAGG + Intergenic
1054877646 9:70113227-70113249 CAGGGAAGAGAGGAGGGAGGAGG + Intronic
1054952735 9:70871116-70871138 AAGGGAGAAGAGGAGGAAAGTGG + Intronic
1055068229 9:72140380-72140402 GCGGGAAAAGAGGAGGAAAGAGG + Intronic
1055106988 9:72523250-72523272 AAGGAAGAAGAGGAGGAAGGAGG + Intronic
1055307705 9:74947378-74947400 CTGGGAAAACAGGGGGAAGCAGG + Exonic
1055416426 9:76089123-76089145 CAGGGATAAGGGGAAGAAGTTGG - Intronic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055913946 9:81380955-81380977 CATGGAACAGAGAAGGAAGGCGG + Intergenic
1055928598 9:81536474-81536496 GAGGGCATAGAGGAGGAAGAGGG + Intergenic
1055950976 9:81729440-81729462 CAAGGTAAAAAAGAGGAAGCAGG - Intergenic
1056597669 9:88021016-88021038 GAAGGAAAAGAGGAAGAAGAAGG - Intergenic
1056999577 9:91495216-91495238 TATGGAAATGAAGAGGAAGCAGG - Intergenic
1057012308 9:91615588-91615610 CAGAAAAAAGAAGATGAAGCTGG + Intronic
1057078440 9:92153996-92154018 AGTGGGAAAGAGGAGGAAGCAGG - Intergenic
1057412028 9:94825288-94825310 CAGGCAAAACAGCAGGATGCGGG - Intronic
1057414166 9:94846603-94846625 CTGGGCAAAGAGAAAGAAGCTGG + Intronic
1057759571 9:97861313-97861335 AAGGGAGCAGGGGAGGAAGCAGG - Intergenic
1057936781 9:99246668-99246690 CAGGAAAAAGAGGAAGAGGTTGG + Intergenic
1058171547 9:101687048-101687070 CTGGGTAAGGAGGAGGAAGTCGG + Exonic
1058742183 9:107954904-107954926 GAGAGGAAAGAGGAGGAAGGAGG - Intergenic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1058941962 9:109821764-109821786 GGGGGAGATGAGGAGGAAGCAGG - Intronic
1059341789 9:113601452-113601474 CAGGGAAGGGAGGAGGAAAGTGG + Intergenic
1059578595 9:115519199-115519221 GAGAGAAATGAGGAGGAAGAAGG - Intergenic
1059730291 9:117050457-117050479 CTGGGAGCAGGGGAGGAAGCAGG - Intronic
1059751932 9:117255778-117255800 CAGGGAGGGGAGGAGGAAGAAGG + Intronic
1059772806 9:117443723-117443745 CAGGGATGAGTGGAGGAGGCAGG + Intergenic
1059812026 9:117865957-117865979 AAGGGTAAAGGGGAGGAAGCAGG + Intergenic
1059824302 9:118009798-118009820 CAGGGAGAAGGAGAGGAAGGAGG - Intergenic
1059931406 9:119264528-119264550 CAGGGCAATGAGGAAGGAGCTGG - Intronic
1060055916 9:120412898-120412920 CAGGGGAGAGTGGAGGAAGATGG - Intronic
1060751061 9:126169860-126169882 CTGGGGACAGAGGAGGAACCTGG + Intergenic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061440528 9:130600124-130600146 AAGGGAAAAGAGGGGGAAAGAGG - Intronic
1062190777 9:135246841-135246863 CATGCAAGAGAGGAGGAAGAGGG + Intergenic
1062432936 9:136533996-136534018 CGGGGAAGAGGGCAGGAAGCTGG + Intronic
1062488210 9:136791512-136791534 CAGGGAAGAGTGGCGGAGGCTGG + Intronic
1062633866 9:137479655-137479677 CAGGGAGCAGAGGAGGGAGACGG + Intronic
1062695777 9:137875650-137875672 CAGGAACAAGGGGAGGACGCAGG + Intergenic
1185499177 X:584471-584493 CAGGAAGAAGAGGAGGAAAAAGG + Intergenic
1185545400 X:939789-939811 AAGAGAAAAGAGGAGGAGGGGGG - Intergenic
1185726529 X:2426387-2426409 AAGGAAAAAGAGAAGGAAGGAGG - Intronic
1185784729 X:2881114-2881136 CGAGGAAGAGAGGAGGAAGTGGG + Exonic
1185839491 X:3375420-3375442 CAGGGCAAAGAGGAAGGAGAAGG + Intergenic
1185943571 X:4348774-4348796 AAGGGAAAAGAGAAGGGAGGTGG - Intergenic
1186004677 X:5056301-5056323 CTCTGAAAAGAGGAGGAGGCTGG - Intergenic
1186366851 X:8904537-8904559 GAAGGAAAAGAGGAGGAGGTTGG - Intergenic
1186452134 X:9682846-9682868 GAGGCAAATGAGCAGGAAGCAGG - Intronic
1186740254 X:12509579-12509601 CAGAGGAAAGAGTGGGAAGCAGG + Intronic
1186826579 X:13346434-13346456 CAGGATAAAGGGGAGGAAGCAGG + Intergenic
1186864149 X:13702247-13702269 ATGAGAAAAGAGGAGGGAGCAGG - Intronic
1187046592 X:15653494-15653516 GAGGAAAAAGAGGAGGAAGAAGG - Intronic
1187096017 X:16149305-16149327 AAGGAAAAAGGGGAGGAAGTAGG - Intronic
1187562876 X:20418946-20418968 GAGGGAACAAAGGAAGAAGCTGG + Intergenic
1187658084 X:21503887-21503909 CAGGTAAAAGAGAAGAAAGGCGG - Intronic
1187905483 X:24061979-24062001 CAGGCAACAGAGGATGAAGCAGG + Intronic
1188106655 X:26155469-26155491 CAGGAAACAGAAGAGCAAGCAGG + Intergenic
1188380154 X:29481677-29481699 CAGGAAAAACAGGAGCAACCAGG - Intronic
1189439137 X:41018805-41018827 CTGGGAAGAAAGGAAGAAGCAGG + Intergenic
1189649655 X:43175841-43175863 AAGGGAAAAGAGAAAGAAGAGGG + Intergenic
1189996212 X:46641189-46641211 CAGGGACCAGAGGAGGAATGTGG + Intronic
1190236072 X:48616758-48616780 AAAGGGAAGGAGGAGGAAGCAGG + Intergenic
1190259367 X:48788209-48788231 CAGGGAAGAGAGGGAGAAACAGG + Intronic
1190291772 X:48997735-48997757 CAGGGAGAAGAGGAGGGGTCAGG + Intronic
1190303914 X:49071876-49071898 CTGGGACAAGAGCAGGAGGCTGG - Exonic
1190737069 X:53262600-53262622 CAGGGGAGAGAGGAGGCAGGGGG + Intronic
1191255306 X:58277090-58277112 CAGGGAAAGGTTGAGGAGGCCGG - Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1192091225 X:68158651-68158673 CAGGGGAAGGGGGAGGGAGCAGG - Intronic
1192169014 X:68843057-68843079 CAGAGGAAAGAGGAAGAAGAAGG + Intergenic
1192260630 X:69504331-69504353 CACGGAGAGGAGGAGGGAGCGGG - Intergenic
1192423254 X:71052869-71052891 CAGGCAACAGAGGCGGCAGCTGG + Intergenic
1192657435 X:73005408-73005430 CAGGGAAAAGGACAGGAAGTGGG - Exonic
1192664689 X:73077609-73077631 CAGGGAAAAGGACAGGAAGAGGG + Exonic
1193005397 X:76612797-76612819 AAGGGTAAAGGGGAGGAAGACGG + Intergenic
1194173064 X:90612570-90612592 CAGTGAAAAGGGGAGGAAGTAGG - Intergenic
1194312031 X:92322461-92322483 CAAGGAAAATAGGAAGAAGTGGG + Intronic
1194930558 X:99882059-99882081 CAGGGAAAACAGAACCAAGCTGG + Intergenic
1195149996 X:102057581-102057603 CAGGAAAAAGAAGTGCAAGCAGG - Intergenic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1195652909 X:107304340-107304362 CAGTGAGATGAGGAAGAAGCAGG + Intergenic
1196130134 X:112146590-112146612 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196554325 X:117069748-117069770 CGGGGGAAGGGGGAGGAAGCTGG + Intergenic
1196717190 X:118823456-118823478 TAGGGAAAAGACGGGGAAGAGGG - Intergenic
1196865202 X:120065075-120065097 CAGGGGGCAGAGGAGGAAGCAGG + Intergenic
1196877891 X:120171205-120171227 CAGGGGGCAGAGGAGGAAGCAGG - Intergenic
1196899204 X:120366657-120366679 GAGGAAAAGGAGGAGGAAGAGGG + Exonic
1197734826 X:129843176-129843198 CAGGGAAACGAGAAGGTAGAAGG + Intronic
1198075098 X:133186339-133186361 CAGGGAAAGGAGCAGGAAAGAGG + Intergenic
1198088868 X:133307969-133307991 CTGGGAATGGAGGGGGAAGCTGG + Intronic
1198122237 X:133605675-133605697 AGAGGAAAAGAGGAGGAAGAGGG + Intronic
1198231990 X:134698952-134698974 TAAGGAAAAGAGGAGAAACCGGG - Intronic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199462368 X:148098754-148098776 CAGAGAACAGAGCAAGAAGCAGG + Intergenic
1199724735 X:150568873-150568895 CGGGGAGAACGGGAGGAAGCCGG - Intronic
1199886645 X:152027414-152027436 GATGGAAAAGAGGAGGAAAGTGG + Intergenic
1199932297 X:152535909-152535931 CAGGAAGATGAGGAGGAATCAGG + Intergenic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1200519288 Y:4190293-4190315 CAGTGAAAAGGAGAGGAAGTAGG - Intergenic
1200620301 Y:5436576-5436598 CAAGGAAAATAGGAAGAAGTGGG + Intronic
1201236321 Y:11915443-11915465 CAGGGCAAAGAGGAAGGAGAAGG - Intergenic
1201365764 Y:13204773-13204795 CACAGGAAAGAGGAGGAAACTGG - Intergenic
1201453008 Y:14136324-14136346 AAGGGAAAAGAGAAGGAAAATGG - Intergenic
1201567933 Y:15385920-15385942 CAGGAGAAAGAGGGGGAAGGGGG - Intergenic
1202070737 Y:20989449-20989471 CTGGGAAAAGAGGAGAAATAAGG - Intergenic