ID: 1079101556

View in Genome Browser
Species Human (GRCh38)
Location 11:17545041-17545063
Sequence TATCCAGAGAAGGCCGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079101556_1079101562 5 Left 1079101556 11:17545041-17545063 CCGCGCCCGGCCTTCTCTGGATA No data
Right 1079101562 11:17545069-17545091 GTCGAGGTTCATGGCCCTCCTGG No data
1079101556_1079101561 -4 Left 1079101556 11:17545041-17545063 CCGCGCCCGGCCTTCTCTGGATA No data
Right 1079101561 11:17545060-17545082 GATACTCTTGTCGAGGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079101556 Original CRISPR TATCCAGAGAAGGCCGGGCG CGG (reversed) Intergenic
No off target data available for this crispr