ID: 1079101561

View in Genome Browser
Species Human (GRCh38)
Location 11:17545060-17545082
Sequence GATACTCTTGTCGAGGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079101549_1079101561 27 Left 1079101549 11:17545010-17545032 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1079101561 11:17545060-17545082 GATACTCTTGTCGAGGTTCATGG No data
1079101557_1079101561 -9 Left 1079101557 11:17545046-17545068 CCCGGCCTTCTCTGGATACTCTT No data
Right 1079101561 11:17545060-17545082 GATACTCTTGTCGAGGTTCATGG No data
1079101554_1079101561 -1 Left 1079101554 11:17545038-17545060 CCACCGCGCCCGGCCTTCTCTGG No data
Right 1079101561 11:17545060-17545082 GATACTCTTGTCGAGGTTCATGG No data
1079101556_1079101561 -4 Left 1079101556 11:17545041-17545063 CCGCGCCCGGCCTTCTCTGGATA No data
Right 1079101561 11:17545060-17545082 GATACTCTTGTCGAGGTTCATGG No data
1079101550_1079101561 26 Left 1079101550 11:17545011-17545033 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1079101561 11:17545060-17545082 GATACTCTTGTCGAGGTTCATGG No data
1079101547_1079101561 30 Left 1079101547 11:17545007-17545029 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1079101561 11:17545060-17545082 GATACTCTTGTCGAGGTTCATGG No data
1079101558_1079101561 -10 Left 1079101558 11:17545047-17545069 CCGGCCTTCTCTGGATACTCTTG No data
Right 1079101561 11:17545060-17545082 GATACTCTTGTCGAGGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079101561 Original CRISPR GATACTCTTGTCGAGGTTCA TGG Intergenic
No off target data available for this crispr