ID: 1079101562

View in Genome Browser
Species Human (GRCh38)
Location 11:17545069-17545091
Sequence GTCGAGGTTCATGGCCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079101554_1079101562 8 Left 1079101554 11:17545038-17545060 CCACCGCGCCCGGCCTTCTCTGG No data
Right 1079101562 11:17545069-17545091 GTCGAGGTTCATGGCCCTCCTGG No data
1079101556_1079101562 5 Left 1079101556 11:17545041-17545063 CCGCGCCCGGCCTTCTCTGGATA No data
Right 1079101562 11:17545069-17545091 GTCGAGGTTCATGGCCCTCCTGG No data
1079101559_1079101562 -5 Left 1079101559 11:17545051-17545073 CCTTCTCTGGATACTCTTGTCGA No data
Right 1079101562 11:17545069-17545091 GTCGAGGTTCATGGCCCTCCTGG No data
1079101557_1079101562 0 Left 1079101557 11:17545046-17545068 CCCGGCCTTCTCTGGATACTCTT No data
Right 1079101562 11:17545069-17545091 GTCGAGGTTCATGGCCCTCCTGG No data
1079101558_1079101562 -1 Left 1079101558 11:17545047-17545069 CCGGCCTTCTCTGGATACTCTTG No data
Right 1079101562 11:17545069-17545091 GTCGAGGTTCATGGCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079101562 Original CRISPR GTCGAGGTTCATGGCCCTCC TGG Intergenic
No off target data available for this crispr