ID: 1079105982

View in Genome Browser
Species Human (GRCh38)
Location 11:17572740-17572762
Sequence GTGTATGAGGTGAGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 446}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079105982 Original CRISPR GTGTATGAGGTGAGGCAGGA GGG (reversed) Intronic
900080767 1:855782-855804 ATGTATGAGATGAGTCACGAGGG + Intergenic
900494258 1:2969339-2969361 GTGTATAAGATGAGGAAGGCAGG - Intergenic
900511113 1:3061647-3061669 GTGCAAGAGGGCAGGCAGGAGGG + Intergenic
900520872 1:3104962-3104984 GTGCATGGGAGGAGGCAGGATGG + Intronic
901002316 1:6154899-6154921 CTGTAGGGGGAGAGGCAGGAGGG + Intronic
902315707 1:15617249-15617271 GTGGAAGAGGAGAGGGAGGAAGG - Intergenic
903302725 1:22390705-22390727 GTGTGTGTGTTGGGGCAGGAAGG - Intergenic
903324979 1:22564264-22564286 GGCTTTGAGGGGAGGCAGGAAGG + Intronic
903376620 1:22870452-22870474 GTGGGTGTGGAGAGGCAGGAGGG - Intronic
904513251 1:31032026-31032048 CTGTAAGAGGTAGGGCAGGAGGG - Intronic
904564718 1:31421810-31421832 GAGTATGAGGTCAGACAGGCTGG - Intronic
904817176 1:33212786-33212808 GTGTTGGAGGTGAGGCCTGAAGG - Intergenic
905545195 1:38792251-38792273 GTGTTTGAGCAGAGACAGGATGG - Intergenic
906790196 1:48652478-48652500 GAGGAGGAGGTGAGGCAGGATGG + Intronic
907278527 1:53329854-53329876 GTGCCTCAGGTGAGGCTGGAGGG + Intergenic
907578885 1:55554234-55554256 GTGGGTGAGGAGAGGCAGGTTGG + Intergenic
908676076 1:66605551-66605573 GTGTATGAGAGGAGGCAGTCTGG + Intronic
908677255 1:66619343-66619365 GACTATGAGGTGAGTAAGGAAGG + Intronic
908825081 1:68125355-68125377 GTGTATGAGTTTTAGCAGGAGGG + Intronic
908959860 1:69683471-69683493 GAGTATGAGATGAGGCTGAATGG - Intronic
909333031 1:74437664-74437686 GTTTATGAGGTAAGGGAGGTGGG + Intronic
911247013 1:95529362-95529384 GTGAAGGAGGTGAGTCAGGTAGG - Intergenic
911315722 1:96354511-96354533 CTGAATGAGATGAGGCAGCATGG - Intergenic
911857561 1:102899810-102899832 GAGAATAAGGTGAGGCAGGAGGG + Intronic
912128061 1:106565032-106565054 GCGTATGAGATGACGGAGGAGGG + Intergenic
912589405 1:110799969-110799991 GCGTTTGAGCTGTGGCAGGAGGG + Intergenic
912938451 1:114024078-114024100 GAGAATGAGGTGAGGGAGGAGGG + Intergenic
914232477 1:145776227-145776249 GAGTATGCAGTGAGCCAGGATGG - Intronic
914377798 1:147087887-147087909 CTTTGGGAGGTGAGGCAGGAGGG - Intergenic
915141298 1:153770285-153770307 GTATTTGAGGTGCTGCAGGATGG - Exonic
915699800 1:157781060-157781082 GTGTCTGAGGGGAGGCAGAGAGG + Intergenic
915847679 1:159285090-159285112 GGGTGTGAGGTGAGTTAGGAGGG + Intergenic
916100460 1:161389721-161389743 GAGTATGAGGTGAGGTATGCAGG + Intergenic
916139632 1:161683922-161683944 GAGTATGAGGTGAGGCATTATGG - Intergenic
916414366 1:164578841-164578863 GTGCTTGAGGAAAGGCAGGAAGG - Intronic
917489859 1:175488846-175488868 GTGGAATAGGTGAGGGAGGAAGG + Intronic
918204990 1:182300306-182300328 GCTTATGAGGTCAGGGAGGAAGG + Intergenic
918260093 1:182787914-182787936 GTGTGTGTGAAGAGGCAGGAGGG - Intergenic
919020632 1:192100873-192100895 GTGTAAGAGTTGAAGAAGGAAGG + Intergenic
919243010 1:194939037-194939059 TTGTCTTAGGTGAGACAGGAAGG - Intergenic
919324558 1:196090290-196090312 CTGTCTGAGGTGAAGCAGAAAGG + Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920029844 1:203030275-203030297 AGGTGTGAGGTGAGGCTGGATGG + Intronic
920087063 1:203425167-203425189 GAGTATGAGTTTGGGCAGGAGGG - Intergenic
920666456 1:207966101-207966123 GGGCAGGAGGTGAGACAGGAGGG + Intergenic
920836778 1:209518443-209518465 GTGTTGGAGGTGAGGCCTGATGG + Intergenic
921334981 1:214076811-214076833 GTGGAGGAGGAGGGGCAGGAAGG - Intergenic
921797437 1:219362911-219362933 AGGCATGAGGTCAGGCAGGAAGG + Intergenic
922502111 1:226104858-226104880 GAGTAGGAGGTGTGACAGGAAGG - Intergenic
922516780 1:226213940-226213962 GTATGCGAGGTGAGGAAGGATGG + Intergenic
922770166 1:228177330-228177352 GGCTAGGAGGTGAGCCAGGAAGG + Exonic
923115763 1:230936048-230936070 GGGGATGGGGTGGGGCAGGAGGG + Intronic
923430041 1:233911108-233911130 TTGTATGAGGTGAGGGGGAAGGG + Intronic
923979776 1:239309211-239309233 GTGTATTATGTCAGGCAGGAAGG - Intergenic
924273889 1:242365216-242365238 CTGTATGAGGTGGTGCAGGAAGG + Intronic
924664618 1:246058318-246058340 GTGTTGGAGGTGGGGGAGGAGGG + Intronic
924944146 1:248834551-248834573 GTTTATGAAGTGAGACAGAAAGG - Intergenic
1063702586 10:8400110-8400132 GTGTGTGAAGTGAGGCAGGAAGG + Intergenic
1066124661 10:32328840-32328862 GTATATTGGGTGTGGCAGGAAGG + Intronic
1066710824 10:38231460-38231482 CTGTATGAGGTGGTGCAGGAAGG - Intergenic
1067270614 10:44788435-44788457 GTGTGTGGCGTGAGGTAGGAAGG - Intergenic
1067982618 10:51104090-51104112 GTGTAGTAGGAGTGGCAGGAAGG + Intronic
1068681742 10:59827458-59827480 GAGTGTGAGGACAGGCAGGAAGG + Intronic
1069588808 10:69629766-69629788 GCGTTTGAGCTGGGGCAGGAGGG - Intergenic
1069822493 10:71236353-71236375 ATGTTTTAGGTGAGGCAGGGCGG - Intronic
1069839805 10:71332580-71332602 GAGTCTGAGGTCAGGCAGCATGG + Intronic
1070522056 10:77262546-77262568 GTGTTGGAGGTGAGGCCTGATGG + Intronic
1072005939 10:91247571-91247593 ATGAAGGAGATGAGGCAGGAAGG + Intronic
1072862441 10:99020641-99020663 GTGTATGTGTTGAGGGAGGGTGG + Intronic
1073300820 10:102470150-102470172 GTGTTTGGGGTGGGGAAGGAAGG + Intronic
1074105961 10:110389901-110389923 GTGGATGAGTTGAAGCCGGAGGG - Intergenic
1074223900 10:111464422-111464444 GGGTAGGGGGTGAGGCATGAGGG + Intergenic
1074503288 10:114044701-114044723 GTGCATGAGGATGGGCAGGAAGG - Exonic
1074786652 10:116848043-116848065 GTGTATGAGGAAAGGCAAAAAGG + Intergenic
1075370763 10:121932939-121932961 TTGTATGAGCAGAGGCAGGGAGG + Intergenic
1076807255 10:132865181-132865203 GTGTCTGAGGTGAGTTTGGAGGG + Intronic
1077101338 11:823877-823899 GGGGAGGAGGGGAGGCAGGAGGG + Intronic
1077658127 11:4041994-4042016 GAGAATGAGGTCTGGCAGGAAGG - Intronic
1078793546 11:14569386-14569408 GAGCATGAGGTGAAGCAGGGTGG + Intronic
1078881654 11:15455854-15455876 GTGTTTCTGGTGAGGCAGGATGG + Intergenic
1079105982 11:17572740-17572762 GTGTATGAGGTGAGGCAGGAGGG - Intronic
1080303399 11:30810559-30810581 GTGGTTGAGTTGAGGAAGGAAGG - Intergenic
1080407252 11:31990537-31990559 GTGTAGCTGGGGAGGCAGGATGG - Intronic
1081661839 11:44893187-44893209 GTCTGTGAGTTGAGCCAGGATGG - Intronic
1081667121 11:44923170-44923192 GTGTATGGGGTGGAGCTGGAGGG + Intronic
1082792032 11:57352771-57352793 GGGTATTTGGGGAGGCAGGACGG + Intronic
1083352515 11:62040982-62041004 GTTTAGGAGGTGGAGCAGGATGG + Intergenic
1083763865 11:64832980-64833002 GTGGATGAGGTGAGGCTGGGAGG + Intronic
1084529305 11:69717588-69717610 GTGTACAGGGAGAGGCAGGAAGG - Intergenic
1084815553 11:71643945-71643967 GTGCATGAGGGGATGGAGGATGG - Intergenic
1085440252 11:76555358-76555380 GTGTATGTGGTGGGGGAGGTAGG - Intergenic
1085522629 11:77147260-77147282 GCATATGAGCTGAGGCATGAAGG - Intronic
1085560860 11:77472421-77472443 CTGTAAGAGGAGAGACAGGATGG + Intronic
1085912027 11:80838404-80838426 GTGGATGAGGTGAGAGAGGAAGG + Intergenic
1086348741 11:85923972-85923994 GTGTAGGTGGTGAGTGAGGAGGG - Intergenic
1088705048 11:112454421-112454443 GTGCATGAGGTGATGCATGGTGG + Intergenic
1088754962 11:112878174-112878196 GTGTATTAGGTAAGGCTGCATGG + Intergenic
1088770549 11:113031736-113031758 GTATGAGAGCTGAGGCAGGAAGG + Intronic
1089529447 11:119116841-119116863 GAGCAGGAGGGGAGGCAGGAAGG - Exonic
1090876846 11:130797875-130797897 AAGTATGAGGAGAGACAGGAGGG + Intergenic
1091543279 12:1482235-1482257 CAGTATGAGGTGAGGCACAAAGG - Intronic
1091855492 12:3736053-3736075 AGGTATGGGGTGAGGCAGGGAGG + Intronic
1092260697 12:6951930-6951952 GTGCAGGAGTAGAGGCAGGAGGG - Intronic
1092294614 12:7188668-7188690 GTGCATGAGCGGAGGCAGGCAGG - Intronic
1092427458 12:8386109-8386131 GTGCATGAGGGGATGGAGGATGG + Intergenic
1092905288 12:13095706-13095728 GGGTAGGAGGAGAGGGAGGAGGG - Intronic
1093422332 12:18988669-18988691 GAGGCTGAGGTGAGGCAGGAGGG - Intergenic
1093816374 12:23553524-23553546 GTGGAAGAAGGGAGGCAGGAGGG + Intronic
1093855359 12:24095361-24095383 TTGTATGGGATGAGGAAGGAAGG - Intergenic
1093972044 12:25384552-25384574 TGGTATGAGGTGAGCCTGGAAGG + Intergenic
1094531907 12:31283737-31283759 GAGGATGAGATGAGGTAGGATGG - Intronic
1095977592 12:47950226-47950248 GGGTATGGGGTGGGGCAGGGCGG + Intergenic
1096844944 12:54401359-54401381 GTCTATGAGGTAAGGGGGGAAGG - Exonic
1097271324 12:57776343-57776365 ATGTTTGAGCTGAGGAAGGAGGG - Intronic
1097705835 12:62867428-62867450 GTCTATGGGAGGAGGCAGGAAGG - Intronic
1098841939 12:75487707-75487729 GAGTAGGAAGTGAGGCAAGAGGG - Intronic
1100056632 12:90519578-90519600 ATGTATGTGGAGAGGGAGGATGG - Intergenic
1100616641 12:96236186-96236208 GTGTTTAAGGAGAGCCAGGAGGG + Intronic
1101042600 12:100771817-100771839 GTGAGTGTGGTCAGGCAGGAGGG + Intronic
1101119248 12:101562115-101562137 GTTTTTCAGGTGAGGCTGGAGGG - Intergenic
1101509394 12:105379390-105379412 GTGTTTAAGCTGAGGAAGGAGGG - Intronic
1102576875 12:113861241-113861263 AGGTCTGAGGTGAAGCAGGAAGG + Intronic
1103393655 12:120591701-120591723 GTGTCTGAGCTGAGGCCTGAAGG + Intergenic
1103509982 12:121467427-121467449 ATGCATGAGGCGAGCCAGGAAGG + Intronic
1103859664 12:124002300-124002322 GTGCAGGAGGTGAGGTTGGAAGG + Intronic
1104295304 12:127506471-127506493 TTGTGCGAGGTGCGGCAGGATGG - Intergenic
1104788447 12:131466782-131466804 GAGGAAGAGGTGAGGCCGGAGGG - Intergenic
1104954873 12:132459448-132459470 ATGTAGGAGGTGAGGAAGGCAGG + Intergenic
1105409809 13:20161686-20161708 GTGTCTGAAGAGAAGCAGGATGG - Intergenic
1105558252 13:21466065-21466087 GGAGATGAGGTGGGGCAGGAAGG - Intergenic
1105610070 13:21960899-21960921 GTGTATGTGGTGAGGGATGTAGG - Intergenic
1105839373 13:24240475-24240497 GTCTATGATGTGAGGGAGGCAGG + Intronic
1106476450 13:30102423-30102445 GTGTATGTTGGCAGGCAGGAGGG - Intergenic
1107939124 13:45368847-45368869 GTGCCTGAGGGGAGCCAGGAAGG - Intergenic
1108212492 13:48152328-48152350 GGGTGTGAGGGGATGCAGGAGGG + Intergenic
1112616251 13:101008704-101008726 GAGTATGAGGTGGGGCATGGTGG - Intergenic
1113692371 13:112320325-112320347 GTGGGTGAGTTGAGGCTGGAGGG - Intergenic
1113955595 13:114098626-114098648 CGGGATGAGGGGAGGCAGGAAGG + Intronic
1114029259 14:18561551-18561573 ATGTGGGAGGTGAGGCAAGATGG - Intergenic
1117489136 14:56228775-56228797 GAGTGTGAGCTGAGGCAGGGTGG + Intronic
1118182607 14:63508185-63508207 GTGTGTGAGGTGTGCGAGGAGGG - Intronic
1118810330 14:69268510-69268532 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
1119275105 14:73348254-73348276 GTGTATGAGTTGGGGAGGGAAGG + Intronic
1119412616 14:74443403-74443425 GTGGATGAGGAGTGGCAGGGTGG + Intergenic
1120324302 14:83005886-83005908 GTGAATGAGGTGAGAAAGCAAGG + Intergenic
1120911286 14:89669266-89669288 GTGTGGGAGGTGGTGCAGGAAGG + Intergenic
1121173616 14:91874211-91874233 GTGTGGGAGGTGGGGCTGGATGG - Intronic
1121504760 14:94468366-94468388 GTGGATGAAGGGAGGGAGGAAGG + Intronic
1122243539 14:100384544-100384566 GTGTCAGAGGTGGGGCAGCATGG + Intronic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1122650340 14:103222541-103222563 GAGGCTGAGGTGGGGCAGGAGGG + Intergenic
1123172937 14:106391065-106391087 GAGTGTGAGGTGATCCAGGATGG - Intergenic
1123625630 15:22225140-22225162 GTGTCTGAGGTCAGGCACGGTGG - Intergenic
1123811857 15:23935014-23935036 GTGTTGGATGTGAGGCATGATGG + Intergenic
1124704707 15:31954180-31954202 GTCTTTGAGGAGATGCAGGAGGG + Intergenic
1125520689 15:40346350-40346372 CTGCATGAGGTGGGGCTGGAGGG + Intergenic
1125609584 15:40961292-40961314 GCGAAGGAGGAGAGGCAGGAAGG - Intergenic
1125854286 15:42934300-42934322 GAGTATATTGTGAGGCAGGAGGG + Intergenic
1126882554 15:53115009-53115031 GTGTATGGGGTGAGGCTGAGTGG - Intergenic
1128509658 15:68305643-68305665 GCATGTGAGATGAGGCAGGAGGG - Intronic
1128642280 15:69348482-69348504 GTGAATGAGATGAGACAGGCAGG + Intronic
1129265969 15:74393218-74393240 GGGTATCAGTTGAGGCAGGCTGG + Intergenic
1130100030 15:80886296-80886318 GGGTGAGAGGTGAGGCTGGAGGG + Intronic
1130349142 15:83075212-83075234 GTGTTGGAGGTGAGGCCTGATGG - Intergenic
1131431458 15:92392535-92392557 GTGTGTAAGGAGGGGCAGGAGGG - Intergenic
1132333031 15:101025757-101025779 GTGTTGGAGGTGAGGCCTGACGG - Intronic
1132344037 15:101096841-101096863 GGGTAGGAGGAGAGGGAGGATGG + Intergenic
1132789133 16:1675371-1675393 GGGGATGAAATGAGGCAGGAAGG - Exonic
1133370790 16:5244269-5244291 GTGCATGAGGGGATGGAGGATGG - Intergenic
1133994746 16:10739933-10739955 GGGCCTGAGCTGAGGCAGGAGGG + Intergenic
1134093494 16:11403956-11403978 AGGGATGAGGCGAGGCAGGAGGG - Intronic
1134253091 16:12588485-12588507 GTGTGTGAGGTGTGAAAGGAAGG - Intergenic
1135540268 16:23324685-23324707 GTGTGTGGGGTGGGGTAGGATGG - Intronic
1135673169 16:24392029-24392051 GTGTATGAGATGTGGGAGGCAGG + Intergenic
1135930539 16:26732589-26732611 GTGTTGGAGGTGAGGCTGGGTGG + Intergenic
1136945635 16:34648096-34648118 GTCTGTGAGGTGAGTCAGGTAGG - Intergenic
1137825852 16:51494159-51494181 GTGTCAGAGGAGAGGCCGGATGG + Intergenic
1138482578 16:57313321-57313343 GGGTATGAGGGGAGGCTGGTGGG + Intergenic
1138511046 16:57508551-57508573 GTGTTAGAGGGGAGGCAGGAGGG - Intergenic
1138534630 16:57653353-57653375 GGCTGTGAGGGGAGGCAGGAAGG + Intronic
1138726011 16:59139986-59140008 GTGATGGAGGTGAGGCATGAGGG - Intergenic
1138907413 16:61353949-61353971 CTGTGTTAAGTGAGGCAGGAAGG - Intergenic
1138981728 16:62277345-62277367 TTGTATGAGGTGCAGCAGTAAGG + Intergenic
1139173818 16:64662798-64662820 GTGGATGAGGGAAGGAAGGAGGG - Intergenic
1139250645 16:65492222-65492244 GTGTGTGTGGTGTGGCAGGAGGG - Intergenic
1139301707 16:65950383-65950405 AAGGATGAGGTCAGGCAGGAAGG + Intergenic
1139346312 16:66306168-66306190 GTGAATGAGAAGAGGCAGGTTGG + Intergenic
1139410302 16:66753260-66753282 GTGGATGACCTGAAGCAGGAAGG + Intergenic
1139451256 16:67029477-67029499 GAGTGTGAGGTGAGGCAGGCGGG + Exonic
1141158229 16:81611581-81611603 GAGAAAGAGGAGAGGCAGGAGGG - Intronic
1141982532 16:87559344-87559366 GTGTGTGTGGTGGGGCGGGATGG + Intergenic
1142547815 17:717196-717218 GTGGATGGGGTGAGGCAAGAGGG - Intronic
1142622160 17:1172077-1172099 GTGTGTGTGGGGAGGAAGGAAGG + Intronic
1143368525 17:6423996-6424018 GTGTGTGGGGTGGGGCAGGGGGG - Exonic
1143558507 17:7677311-7677333 GTGTATCAGGTGGGGAAGGGTGG - Intronic
1143843148 17:9750764-9750786 GTGAATGAGGTAAGGGGGGATGG - Intergenic
1144184628 17:12785481-12785503 GAGGAGGAGGTGAGGAAGGACGG - Intergenic
1144643188 17:16950721-16950743 GGGTGTGAGGTCAGGCAGGGAGG - Intronic
1144643195 17:16950743-16950765 GGGTGTGAGGTCAGGCAGGGAGG - Intronic
1144705547 17:17365386-17365408 CTGTGTGAGGTGAGCCAGGAGGG - Intergenic
1144773533 17:17772404-17772426 GTGGCTGCAGTGAGGCAGGATGG - Intronic
1144994989 17:19261696-19261718 GTGTTTGAGGTGTATCAGGATGG + Intronic
1145205546 17:20983277-20983299 GGGTGTGAGGTCAGGCAGGGAGG + Intergenic
1145398061 17:22511733-22511755 GTGGGTGGGGTGGGGCAGGAGGG - Intergenic
1146032200 17:29375949-29375971 GTGTATGTGGGGTGGTAGGAAGG + Intergenic
1146522827 17:33539575-33539597 GTATATGTGGTGATGCACGATGG - Intronic
1147032294 17:37649131-37649153 GTGTAGGAAGTGAGGGAGTAAGG + Intergenic
1147457212 17:40545356-40545378 GGGTAGGGGGTGGGGCAGGATGG + Intergenic
1148026639 17:44593431-44593453 CTGCATGGGGTGGGGCAGGAGGG + Intergenic
1148074816 17:44929148-44929170 CTGTCTGGGGTGAGGCAGGAGGG - Intronic
1148698136 17:49573323-49573345 GTTGCTGTGGTGAGGCAGGAAGG - Intergenic
1148782812 17:50130942-50130964 GACTAGGAGGTGAGGGAGGAGGG + Intergenic
1149430449 17:56593135-56593157 GTGCTTGAGGTGGGGCTGGAGGG - Intergenic
1149469293 17:56902797-56902819 GTGTTGGAGGTGGGGCAGGGTGG + Intronic
1150035893 17:61796898-61796920 TTGGATGAGGTGAGGCAGTAAGG + Intronic
1150652533 17:67019343-67019365 GAGGAGGAGGTGAGGGAGGAAGG - Intronic
1151310388 17:73289049-73289071 GAGGTTGAGGTGGGGCAGGAGGG - Intronic
1151772560 17:76173874-76173896 CCCTAAGAGGTGAGGCAGGAAGG + Intronic
1152289906 17:79434155-79434177 GTGTGAGAGCTGAGGCTGGAAGG + Intronic
1152300765 17:79494306-79494328 GTGTAAGGGGTGAGGCCTGAAGG + Intronic
1203167043 17_GL000205v2_random:106965-106987 GTCTATGAGGAAAGGTAGGATGG - Intergenic
1153402340 18:4694879-4694901 GAGTGTGAGCTGAGGCAGGGCGG + Intergenic
1154009698 18:10564406-10564428 AGGGATGAGGTGAGCCAGGATGG - Intergenic
1155071682 18:22322260-22322282 GTGTCTGATGTGAGGCACAATGG + Intergenic
1155666527 18:28315987-28316009 GTGTATTAGATGAGGCACAATGG + Intergenic
1156401694 18:36745458-36745480 GTGTCTGGTGTGAGGCAGGGAGG - Intronic
1156907399 18:42370307-42370329 ATGGAGGAGGTGAGGCATGAAGG + Intergenic
1157113752 18:44844312-44844334 GTGTGTGGGGTGGGGCAGGGTGG - Intronic
1157743107 18:50110571-50110593 ATTTAAGAGGAGAGGCAGGAGGG - Intronic
1158113814 18:53972354-53972376 AAGAATGTGGTGAGGCAGGAAGG - Intergenic
1159961529 18:74559080-74559102 GTATAGAAGGTCAGGCAGGACGG - Intronic
1160012241 18:75115025-75115047 GAGTCTGGGGTGAGGCTGGAAGG - Intergenic
1160317586 18:77861873-77861895 GTGGAAGAGAGGAGGCAGGAGGG - Intergenic
1160720863 19:596396-596418 GTGTGAGAGCTGAGGCCGGAAGG + Intronic
1160752189 19:739589-739611 GAGAATGGGGTGAGCCAGGAAGG + Intronic
1160892413 19:1386220-1386242 GTGGGTGAGGTGAGGCCCGATGG - Intronic
1161094197 19:2379538-2379560 CTGTGAGAGGTGAGGCAGGAAGG - Intergenic
1161270627 19:3387618-3387640 GTCTTTGAGGTGAGGCTTGAAGG + Intronic
1162017041 19:7851569-7851591 ATGTATGAGGTGAGGACCGATGG + Exonic
1162975591 19:14205900-14205922 GTGGAAGAGGGGAGGCGGGAAGG - Intronic
1163238008 19:16040491-16040513 GTGGAGGAGGGGAGGGAGGAAGG + Intergenic
1163312483 19:16522569-16522591 GGGCAAGAGGTGAGGCAAGAAGG - Intronic
1164510178 19:28890085-28890107 GCATTTGGGGTGAGGCAGGATGG + Intergenic
1165461309 19:35945714-35945736 ATGGTAGAGGTGAGGCAGGAGGG + Exonic
1165809149 19:38600211-38600233 GTGTTTGAGGTCAGACAGGTGGG - Intronic
1166155646 19:40909391-40909413 GTGTATGTGATGAGGCGGGTTGG + Intergenic
1166367826 19:42286183-42286205 GTGTTTGTGGTGGGGGAGGAAGG + Intronic
1166870027 19:45865326-45865348 TTGTCTGAGGTGAGACTGGATGG - Intronic
1167785201 19:51630276-51630298 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167787300 19:51646700-51646722 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1168520160 19:57043703-57043725 GTGTCAGAGGTCAGTCAGGAGGG - Intergenic
924980648 2:217595-217617 GTGTATGACGTAAGGCAGTGAGG + Intergenic
926146864 2:10401633-10401655 TTGTTTGACGAGAGGCAGGAAGG - Intronic
926660672 2:15462612-15462634 GTGGAGGAGGTGAGGGAGGGAGG + Intronic
926744192 2:16137212-16137234 CAGGCTGAGGTGAGGCAGGAGGG + Intergenic
927341513 2:21989044-21989066 GTGTATGAGACTAGACAGGAAGG + Intergenic
927478533 2:23432729-23432751 GTGCAGGTGCTGAGGCAGGAGGG + Intronic
928504784 2:31939738-31939760 GTATATGAAGTGAGTCAGTAGGG - Intronic
931181704 2:59908335-59908357 GTGTGTGTTGTGGGGCAGGAGGG - Intergenic
931440445 2:62286786-62286808 GTGGATGAAGTGGGGGAGGAGGG - Intergenic
932457797 2:71860700-71860722 GTGTGTGCAGTGAGACAGGAGGG + Intergenic
932574208 2:72954009-72954031 CTGTAAGTGGGGAGGCAGGAAGG + Intronic
933655322 2:84881814-84881836 GGGTAGGAGGTGCGGCAGGCGGG - Intronic
933749224 2:85592458-85592480 GTGTTTGAGATGAGTCAGGCTGG + Intronic
934710352 2:96510090-96510112 GTGTATGGGGTGAGGGGGCACGG - Intergenic
935388242 2:102523712-102523734 GTGTGAGAGGTGAGACTGGAGGG - Intronic
936106506 2:109629523-109629545 GTGTATGAGGCGAGGCACAATGG + Intergenic
937004791 2:118501439-118501461 GTGAGTGTGGTGAGGCAGGTGGG + Intergenic
937293090 2:120793776-120793798 GTGAATGTAGTGAGGGAGGAGGG - Intronic
937400187 2:121575740-121575762 GTGGGTGAGGAGAGGCAGAAAGG + Intronic
938310326 2:130285150-130285172 GTGGAAGGGGTGAGGCAGGGAGG - Intergenic
938389035 2:130890242-130890264 GTGTAAGAGAAGAGACAGGAAGG - Intronic
938821575 2:134965871-134965893 GTGTATGTGGTGGGGCAGGGAGG - Intronic
939097467 2:137851020-137851042 GTGTGTGTGAGGAGGCAGGACGG + Intergenic
940308579 2:152252974-152252996 GTGACAGAGTTGAGGCAGGAGGG - Intergenic
941517131 2:166493865-166493887 GTGTATGGGATGGGGCAGGTGGG + Intronic
942977454 2:182035520-182035542 GTGTTTGAGGTGAGGCCTGGTGG + Intronic
943268907 2:185772650-185772672 GTGTTGGAGGTGAGGCCTGATGG - Intronic
943321972 2:186455741-186455763 GTGCATCATGTGAGGCAGAAAGG - Intergenic
944015153 2:195026952-195026974 GTGGATGGATTGAGGCAGGAAGG + Intergenic
944882149 2:204024279-204024301 GAGTATGAAGTGGGGGAGGAGGG + Intergenic
946394033 2:219434548-219434570 GGGTCTGAGATGAGGGAGGAAGG + Intergenic
947002364 2:225471284-225471306 GTGAATGTGGTGACGCAGAATGG + Intronic
947706693 2:232282086-232282108 GAGTAGGAGGTGAGGAGGGAGGG - Intronic
948540685 2:238689830-238689852 GTGTAGGAAGGGAGGGAGGAGGG + Intergenic
948754088 2:240149223-240149245 GTGTCTTGGGAGAGGCAGGAAGG - Intergenic
1168785828 20:539485-539507 GTGTCAGAGATGAGGCAGAAGGG - Intronic
1170566858 20:17612468-17612490 GTGTGTGAGGTGAGGGAGGCTGG - Intergenic
1170842222 20:19933295-19933317 GTGCAGGAGGAGAGGCAGGCAGG - Intronic
1170910443 20:20561399-20561421 ATGTATGAAAGGAGGCAGGAAGG - Intronic
1171046604 20:21813988-21814010 GGGAATGAGATGAGGCTGGAGGG - Intergenic
1171077462 20:22143093-22143115 GTGAAGGAGGAGAGGGAGGAAGG - Intergenic
1172564074 20:35914719-35914741 CTTTGTGAGGTGAGGCAGGTGGG + Intronic
1172624274 20:36338218-36338240 GTGCAAGGGGGGAGGCAGGAGGG + Intronic
1173912212 20:46678801-46678823 GTGTAGGAGGTGGGGCTGGTGGG + Intronic
1174139909 20:48405629-48405651 GTGTATGAGCTCAAGGAGGAAGG - Intergenic
1174410141 20:50330068-50330090 ATGTATGATATGAGGGAGGAAGG + Intergenic
1175458922 20:59136220-59136242 GGGTAGGAGATGAGGCAGGAGGG - Intergenic
1176404716 21:6352134-6352156 GTCTATGAGGAAAGGTAGGATGG + Intergenic
1176432441 21:6636970-6636992 GTCTATGAGGAAAGGTAGGATGG - Intergenic
1179032878 21:37735640-37735662 GTGTATGGGCTGTGGGAGGAAGG + Intronic
1179088579 21:38242607-38242629 GTGTGTCAGGAGAGGCACGAGGG - Intronic
1179192639 21:39136585-39136607 GTGGATGAGAAGTGGCAGGAAGG - Intergenic
1179339082 21:40487455-40487477 TTGCATGAGGTGAGGCTGGAGGG + Intronic
1179643631 21:42762372-42762394 CTGGAGGAGGTGAGGAAGGAGGG - Intronic
1179889606 21:44328845-44328867 GTGCATGATGTGGGGCAGGAGGG + Intergenic
1180453375 22:15488614-15488636 ATGTGGGAGGTGAGGCAAGATGG - Intergenic
1180939059 22:19645033-19645055 GCACAGGAGGTGAGGCAGGAGGG - Intergenic
1181404395 22:22672447-22672469 GTGCAGGAGGTGGGGCAGGGAGG + Intergenic
1181466803 22:23114806-23114828 GTGGGTGAGGACAGGCAGGAGGG - Intronic
1182564407 22:31186643-31186665 GTGAATCTGCTGAGGCAGGAAGG - Intronic
1183083344 22:35471397-35471419 GGGTTTGAGCTGAGGCTGGATGG - Intergenic
1184430598 22:44439786-44439808 GGGTAGGGGGTGAGGGAGGAAGG - Intergenic
1184563145 22:45275020-45275042 GGGAATGAGGTAAGACAGGAAGG + Intergenic
1184818813 22:46893330-46893352 GTGTATGATGGGAGGCAGGCGGG + Intronic
1185074059 22:48673711-48673733 ATGTAGGAGGTGAGGGAGGGTGG + Intronic
1185186340 22:49402836-49402858 GAGTTTGCGGTGAGGCAAGATGG + Intergenic
949706211 3:6820263-6820285 GTGTATGTGGTGGGGCTGGGGGG + Intronic
949963349 3:9333509-9333531 GTGTATCAGGTAAGGCAGAAAGG - Intronic
951900206 3:27650112-27650134 GTATAAGAGGTGAAGCAAGAAGG - Intergenic
952512497 3:34071255-34071277 CTGTATGAGGAGAGCCAGGGTGG + Intergenic
952841967 3:37654179-37654201 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
952990147 3:38824514-38824536 GAGTATGAGGTGAAGTAGAAAGG + Intergenic
953018185 3:39097960-39097982 GAAGATGAGGTGAGGAAGGAAGG - Exonic
953491049 3:43351432-43351454 GTGTATGAAGGAAGGGAGGAAGG - Intronic
956227322 3:66974513-66974535 GGGAAGGAGATGAGGCAGGAAGG + Intergenic
957309464 3:78500978-78501000 GTGTTGGAGGTGAGGCATAATGG + Intergenic
957358589 3:79124561-79124583 GTGTATGAGGTGGGGTAGTTAGG - Intronic
958429385 3:94019747-94019769 TTGTAGGAGGTGAGGTCGGAGGG - Intronic
958906472 3:99947452-99947474 GTGAAGGGGGTGGGGCAGGAAGG - Intronic
959082596 3:101817690-101817712 ATGGATGAGGTAAGGAAGGAGGG + Intronic
959216344 3:103455175-103455197 GTGTATGAGGCGTGGCTGGTAGG - Intergenic
959387704 3:105732769-105732791 CTGCATGAGTTGAGGAAGGATGG - Intronic
959412640 3:106044571-106044593 GTGTATGAGCTGAAGCTGCAAGG + Intergenic
959496780 3:107061014-107061036 GTGTTTGAGGGTAGGGAGGAAGG + Intergenic
961281975 3:125771282-125771304 GTGCATGAGGGGATGGAGGATGG - Intergenic
963060470 3:141221029-141221051 CTGTATGAGGTGACCAAGGAGGG + Intergenic
964607389 3:158572501-158572523 GGGCATGAGGTGTGGGAGGAGGG + Intronic
966126655 3:176585226-176585248 TTGGATGAGGACAGGCAGGAAGG - Intergenic
966224932 3:177588007-177588029 GTGTTGGAGGTGGGGCCGGATGG - Intergenic
966629012 3:182051088-182051110 GTGTGGGAAGTGAGGCAGGAAGG - Intergenic
967701111 3:192593188-192593210 GTGTTAGAGAGGAGGCAGGAAGG - Intronic
968889196 4:3358969-3358991 GTGTAGGAGGAGAGGGAGGAGGG - Intronic
969015752 4:4103124-4103146 GTGCATGAGGGGATGCAGGATGG + Intergenic
970740755 4:19234959-19234981 GTGTGTGAAGGGAGGAAGGATGG - Intergenic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
972612439 4:40668188-40668210 GTGGATGAGGTGAGGCTGTGAGG - Intergenic
972835497 4:42865529-42865551 GTCTTGGAGGAGAGGCAGGAGGG + Intergenic
974125980 4:57696296-57696318 GAGTATGGGGTGGGGGAGGAGGG - Intergenic
974509978 4:62826796-62826818 GGCAATGAGGTGAGGCAGGGAGG + Intergenic
975123063 4:70750114-70750136 GGGGCTGAGGTAAGGCAGGAAGG - Intronic
975585393 4:75943098-75943120 GTGGCTTAGCTGAGGCAGGAAGG - Intronic
976546786 4:86344654-86344676 GAATATGAGGGGAGGGAGGAAGG + Intronic
977957844 4:103051061-103051083 TTACATGAGCTGAGGCAGGAAGG + Intronic
979019779 4:115481628-115481650 GTGTTTGAGGTGAGGCCTGGTGG + Intergenic
979994511 4:127414519-127414541 GTGAATGAGATGATGAAGGATGG - Intergenic
980710374 4:136558554-136558576 GTGTCTCAGATGAGGAAGGATGG - Intergenic
982677630 4:158394299-158394321 GTGTTTGAAGTGAAGGAGGAAGG + Intronic
986806301 5:11311764-11311786 GTGTGTGAGGTGAGGGTGCATGG - Intronic
987995034 5:25265259-25265281 GTGTATGTGTTGGGGAAGGATGG - Intergenic
989096060 5:37782259-37782281 CAGTATGAGGAGAGTCAGGAGGG + Intergenic
989613547 5:43317506-43317528 CAGTATGAGGAGAGCCAGGAGGG + Intergenic
990971366 5:61510205-61510227 GTGTGTGAGGTGGGGCAAAATGG + Intronic
992195626 5:74336272-74336294 GTGGAAGAGGTGACCCAGGAGGG - Intergenic
992290817 5:75277715-75277737 ATGTCTTAGGTGAGGCAGGCAGG - Intergenic
992438165 5:76774998-76775020 GTATGGGAGCTGAGGCAGGAGGG + Intergenic
994146698 5:96403042-96403064 GTGCATGTGTGGAGGCAGGAAGG + Intronic
994225839 5:97250608-97250630 GTGTATGGGGTGGGGTGGGAAGG + Intergenic
994767289 5:103934954-103934976 GTATCTGCAGTGAGGCAGGAGGG - Intergenic
995347294 5:111135333-111135355 GTGTATGGGGTATGGCAAGATGG + Intergenic
997202157 5:132017295-132017317 GTGTATGTGGTGAGGGGGGTGGG + Intergenic
997681090 5:135751212-135751234 GGGCCTGAGCTGAGGCAGGAGGG - Intergenic
997817561 5:137033587-137033609 GTGAATGAGGTGAGGGAGAGGGG - Intronic
998800508 5:145864317-145864339 GTGTAAGAGATGATGCTGGAGGG + Intronic
999117063 5:149173524-149173546 GTGGATGAGATGGGGCAGAAGGG + Intronic
999427189 5:151498586-151498608 GTGAAGGAGGTGAGGAATGAAGG - Intergenic
999780644 5:154847387-154847409 GGGAATAAGGTGAGGCTGGAAGG + Intronic
1000525199 5:162349024-162349046 TTGTATGAGGTGAGAGATGAGGG + Intergenic
1001280711 5:170384397-170384419 GGGTTTGAGTTGAGCCAGGATGG + Intronic
1002172948 5:177385571-177385593 GTGTGTGTGGTGAGGATGGAGGG + Intronic
1002458404 5:179359542-179359564 GTGTGTGAGGTGTGGAAGGTAGG - Intergenic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003751274 6:9059753-9059775 GAGGGTGAGATGAGGCAGGAGGG + Intergenic
1004092705 6:12520836-12520858 GTATATGATGTGAAGTAGGAGGG + Intergenic
1004116514 6:12773420-12773442 GTGAATCAGGTGAGGCTAGATGG - Intronic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006612899 6:35305636-35305658 GCGGTTGAGGTGAGCCAGGAAGG - Intronic
1006790363 6:36697430-36697452 GGGCCTGAAGTGAGGCAGGATGG + Intergenic
1006958485 6:37901094-37901116 GTGTTAGAGGTGAGGGAGCAAGG + Intronic
1007910656 6:45510864-45510886 CTGTAAAAGGTGAGGAAGGAGGG - Intronic
1009979132 6:70705672-70705694 GTGTTTAAGGAGTGGCAGGATGG + Intronic
1013226898 6:108125754-108125776 GGGTAGGAGGTGAGGACGGAGGG + Intronic
1014871997 6:126608412-126608434 GAGTCAGAGGGGAGGCAGGATGG - Intergenic
1015255516 6:131175260-131175282 GTGGAAGTGGGGAGGCAGGAGGG + Intronic
1015891759 6:137976785-137976807 GTGTGTGTAGGGAGGCAGGATGG - Intergenic
1015982950 6:138857441-138857463 GTGTGGGAGGTGAGGATGGAGGG - Intronic
1016909109 6:149179395-149179417 GTGGAGAAGGTGAGGCAGGGAGG + Intergenic
1017301619 6:152867593-152867615 GTATGTGAGGTGAGGGTGGATGG - Intergenic
1017577130 6:155817553-155817575 ATGCATGCAGTGAGGCAGGAGGG - Intergenic
1019342084 7:513079-513101 GGCCATGAGGAGAGGCAGGAGGG + Intronic
1019516619 7:1442982-1443004 GTGCCTGAGGGAAGGCAGGAAGG - Intronic
1020719677 7:11726310-11726332 GTAGATGAGGTGAGGCGTGATGG - Intronic
1020855523 7:13416731-13416753 GTGTATCACGTGATGCTGGATGG + Intergenic
1021256035 7:18393529-18393551 ATGGATGAGGTGAGGCAGGGAGG + Intronic
1021628748 7:22622909-22622931 GTGGATGAGGTGAAGCAAGCAGG - Intronic
1021827316 7:24568369-24568391 CTGTTTGAGGTGAGGCAGAAAGG + Intergenic
1022370849 7:29769995-29770017 GTGTATTGGGTGATCCAGGAGGG - Intergenic
1024353814 7:48394419-48394441 GTGTCTGAGAAGAGCCAGGACGG - Intronic
1024541669 7:50479932-50479954 GTGCCTGAGCTGAGGCAGGTGGG - Intronic
1024944957 7:54799192-54799214 CTGTGTGAGGAGACGCAGGATGG - Intergenic
1026207222 7:68268395-68268417 ATGAATGAGCTGAGGCATGAAGG - Intergenic
1026223194 7:68418225-68418247 GTATATGAGGAGAGGGAGGATGG - Intergenic
1026771922 7:73207583-73207605 GTGTGTGGGCTCAGGCAGGAGGG - Intergenic
1026895387 7:74007300-74007322 GAGAATGAGCTGAGGCAGGTGGG - Intergenic
1027012790 7:74760979-74761001 GTGTGTGGGCTCAGGCAGGAGGG - Intergenic
1027075250 7:75185074-75185096 GTGTGTGGGCTCAGGCAGGAGGG + Intergenic
1027455845 7:78390759-78390781 ATAACTGAGGTGAGGCAGGAAGG - Intronic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1028243784 7:88451930-88451952 GGGTATGAGGGGAGGGAGGGAGG - Intergenic
1028262250 7:88680612-88680634 GAGTATGAGGTGAGACAGCAAGG + Intergenic
1029074424 7:97924758-97924780 GTGCATGAGGGGATGGAGGATGG + Intergenic
1032200837 7:129821644-129821666 TTGGATGAGGTGAGGGAGGCAGG + Intergenic
1032442937 7:131956039-131956061 GTGAATGTGGGGAGGCAGGAAGG - Intergenic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1032575157 7:133045732-133045754 GTGTTGGAGGTGAGGCCTGATGG + Intronic
1032729986 7:134631280-134631302 ATGCATGAGGTGAGTCAGGCTGG + Intergenic
1032877841 7:136056822-136056844 GGGTGGGAGGTGAGGCAGGTTGG + Intergenic
1033537890 7:142328839-142328861 GAGTCTGGGGTGAGGGAGGAGGG - Intergenic
1033595806 7:142856883-142856905 GTGTATGAGATGAGGTGGGCGGG - Intronic
1033778512 7:144641572-144641594 ATGAATGAGGAGAGGCAGGCAGG + Intronic
1035095662 7:156352735-156352757 CTGTACTAGATGAGGCAGGATGG - Intergenic
1035359034 7:158297743-158297765 GGGTATGTGGTTAGGTAGGATGG - Intronic
1035524500 8:301680-301702 ATGTATGAGATGAGTCACGAGGG - Intergenic
1039803870 8:40982531-40982553 GTGTGTGGGGTGAGGCATGGGGG - Intergenic
1041456269 8:58064178-58064200 GTGTTGGAGGTGAGGCCTGATGG - Intronic
1041974795 8:63785209-63785231 CTGCATTTGGTGAGGCAGGAGGG + Intergenic
1042045877 8:64651024-64651046 GTGTTTGAGGTGGGGGAAGACGG + Intronic
1042571470 8:70170139-70170161 GTGTATGAGGCAGGGCAGGTGGG + Intronic
1044553770 8:93540054-93540076 GTTTATGAGGCGAAGAAGGAAGG - Intergenic
1044906013 8:97003786-97003808 TTGTGGTAGGTGAGGCAGGATGG + Intronic
1044983964 8:97741842-97741864 GAGTTTGAGGTGAGCCAAGATGG + Intergenic
1045294157 8:100859570-100859592 GAGTACGAGGAGAGGCAGGTGGG - Intergenic
1046187577 8:110743359-110743381 GTGTAAGAGATGAAGCAAGAAGG - Intergenic
1046615320 8:116471160-116471182 GTGCATTAGCTGAGGCAGGGAGG + Intergenic
1046829583 8:118729858-118729880 GTGCATGAGATAAGGAAGGAAGG - Intergenic
1047179436 8:122573197-122573219 GTGAGTGAGGTGAGGCATGCAGG - Intergenic
1047454577 8:124997942-124997964 GTGTATGTGGAGAGGGCGGAAGG - Intergenic
1047688100 8:127321762-127321784 GTGTTGGAGGTGAGGCATGTAGG + Intergenic
1047691179 8:127356268-127356290 GTGTAAGAGCTGAGGCAGGAAGG + Intergenic
1047930751 8:129726369-129726391 ATGGAAGAGGGGAGGCAGGAGGG + Intergenic
1048323328 8:133418819-133418841 GTGAATGAGATGTGGCAGGAGGG + Intergenic
1048599645 8:135906202-135906224 GTGTTTGTGGTGAGGCACCAAGG - Intergenic
1048791429 8:138107508-138107530 GTGAATTAGGTCAAGCAGGAAGG + Intergenic
1051272092 9:15365532-15365554 GTGTCTGAGGTGAAGCTGGCTGG - Intergenic
1051612858 9:18978453-18978475 GAGTTTGAGCTCAGGCAGGAAGG - Intronic
1052802661 9:32984617-32984639 GAGTATGAGGTAAGCCAGGTGGG - Exonic
1052870999 9:33506527-33506549 GAGGATGAGGTCAGGCATGAAGG + Intergenic
1053159837 9:35806290-35806312 GTGCATGAAGTGGGGCAGGTGGG + Intronic
1054810932 9:69433302-69433324 GTGTGTGAGGTAAGGGTGGAGGG - Intronic
1056514108 9:87333731-87333753 GTGTAGCAGGTGAAGCAGCAGGG - Intergenic
1057820671 9:98328139-98328161 GTTTGTGAGATGAGGCTGGAGGG - Intronic
1059084771 9:111288254-111288276 GTGTGTGAGGTGGGGCATGGTGG + Intergenic
1059578811 9:115521296-115521318 GGAAATGTGGTGAGGCAGGAGGG + Intergenic
1060146753 9:121259603-121259625 GGGGATGAGATGAGGCTGGAGGG + Intronic
1060205435 9:121680163-121680185 GTGTAGGAGGTGAGGCTGGGAGG + Intronic
1062391375 9:136335293-136335315 GTGGATGACGCCAGGCAGGAAGG - Intronic
1062533576 9:137012063-137012085 GGGGATGAGGTGGGGCAGGTGGG - Intronic
1203439094 Un_GL000195v1:171742-171764 GTCTATGAGGAAAGGTAGGATGG + Intergenic
1185672820 X:1825735-1825757 GTGTTGGTGGTGAGGCTGGATGG - Intergenic
1185673021 X:1826660-1826682 GTGTTGGTGGTGAGGCTGGATGG - Intergenic
1186997007 X:15134360-15134382 GTGTAAGAGGGTAGGAAGGAAGG + Intergenic
1187556236 X:20354805-20354827 GTGGGTGAAGTGAGGAAGGAGGG + Intergenic
1187733184 X:22277572-22277594 CTGTAAAACGTGAGGCAGGAAGG - Intergenic
1187829960 X:23370996-23371018 GGGGAGGAGGAGAGGCAGGAGGG + Intronic
1187944464 X:24412693-24412715 GTGGATGACAGGAGGCAGGAGGG - Intergenic
1188418724 X:29971064-29971086 GTGAATGAAGTAAGGAAGGAAGG - Intergenic
1189297643 X:39930088-39930110 GGCTGAGAGGTGAGGCAGGAGGG + Intergenic
1189391411 X:40580088-40580110 GCCTATGATGTGAGGCAAGAAGG - Intergenic
1189701148 X:43717022-43717044 GTGGTTAAGGTGAGGCAGGATGG + Intronic
1189981442 X:46514736-46514758 GTGTAGTGGGTGAGGAAGGAAGG - Intronic
1189994916 X:46629105-46629127 GTGTATGAGGTCTGGAAGGAAGG + Intronic
1189999950 X:46676197-46676219 GTGTCTGAGGTGGGGCGGGGGGG + Intronic
1192428764 X:71098812-71098834 TACTATGAGGTGAGGCCGGATGG + Intronic
1192740943 X:73892376-73892398 GAGTATGAGCCGAAGCAGGATGG + Intergenic
1193660373 X:84249696-84249718 GTATTTGAGGTCAGGCATGATGG - Intergenic
1195000626 X:100639831-100639853 GAGAAAGAGGTGAGGAAGGAGGG - Intronic
1195474118 X:105264592-105264614 GCGTATTAGTGGAGGCAGGATGG + Intronic
1196909513 X:120471411-120471433 ATGTATGAGTTTAGACAGGATGG + Intergenic
1198728378 X:139700995-139701017 GTGGATCTGGGGAGGCAGGAGGG - Intronic