ID: 1079106040

View in Genome Browser
Species Human (GRCh38)
Location 11:17573094-17573116
Sequence GGCCTGCAGCGTGCTCACGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079106030_1079106040 3 Left 1079106030 11:17573068-17573090 CCTTCCCCAGCCTCCTACTCAGT 0: 1
1: 0
2: 3
3: 93
4: 846
Right 1079106040 11:17573094-17573116 GGCCTGCAGCGTGCTCACGGGGG 0: 1
1: 0
2: 0
3: 10
4: 121
1079106032_1079106040 -2 Left 1079106032 11:17573073-17573095 CCCAGCCTCCTACTCAGTGCAGG 0: 1
1: 1
2: 0
3: 22
4: 192
Right 1079106040 11:17573094-17573116 GGCCTGCAGCGTGCTCACGGGGG 0: 1
1: 0
2: 0
3: 10
4: 121
1079106029_1079106040 12 Left 1079106029 11:17573059-17573081 CCTGTTCTTCCTTCCCCAGCCTC 0: 1
1: 0
2: 10
3: 191
4: 1183
Right 1079106040 11:17573094-17573116 GGCCTGCAGCGTGCTCACGGGGG 0: 1
1: 0
2: 0
3: 10
4: 121
1079106028_1079106040 19 Left 1079106028 11:17573052-17573074 CCTGGCTCCTGTTCTTCCTTCCC 0: 1
1: 1
2: 6
3: 88
4: 1007
Right 1079106040 11:17573094-17573116 GGCCTGCAGCGTGCTCACGGGGG 0: 1
1: 0
2: 0
3: 10
4: 121
1079106026_1079106040 28 Left 1079106026 11:17573043-17573065 CCCTGACTGCCTGGCTCCTGTTC 0: 1
1: 0
2: 2
3: 28
4: 378
Right 1079106040 11:17573094-17573116 GGCCTGCAGCGTGCTCACGGGGG 0: 1
1: 0
2: 0
3: 10
4: 121
1079106034_1079106040 -3 Left 1079106034 11:17573074-17573096 CCAGCCTCCTACTCAGTGCAGGC 0: 1
1: 1
2: 0
3: 20
4: 263
Right 1079106040 11:17573094-17573116 GGCCTGCAGCGTGCTCACGGGGG 0: 1
1: 0
2: 0
3: 10
4: 121
1079106036_1079106040 -10 Left 1079106036 11:17573081-17573103 CCTACTCAGTGCAGGCCTGCAGC 0: 1
1: 0
2: 4
3: 26
4: 238
Right 1079106040 11:17573094-17573116 GGCCTGCAGCGTGCTCACGGGGG 0: 1
1: 0
2: 0
3: 10
4: 121
1079106025_1079106040 29 Left 1079106025 11:17573042-17573064 CCCCTGACTGCCTGGCTCCTGTT 0: 1
1: 0
2: 3
3: 29
4: 368
Right 1079106040 11:17573094-17573116 GGCCTGCAGCGTGCTCACGGGGG 0: 1
1: 0
2: 0
3: 10
4: 121
1079106031_1079106040 -1 Left 1079106031 11:17573072-17573094 CCCCAGCCTCCTACTCAGTGCAG 0: 1
1: 0
2: 4
3: 28
4: 393
Right 1079106040 11:17573094-17573116 GGCCTGCAGCGTGCTCACGGGGG 0: 1
1: 0
2: 0
3: 10
4: 121
1079106035_1079106040 -7 Left 1079106035 11:17573078-17573100 CCTCCTACTCAGTGCAGGCCTGC 0: 1
1: 0
2: 0
3: 14
4: 206
Right 1079106040 11:17573094-17573116 GGCCTGCAGCGTGCTCACGGGGG 0: 1
1: 0
2: 0
3: 10
4: 121
1079106027_1079106040 27 Left 1079106027 11:17573044-17573066 CCTGACTGCCTGGCTCCTGTTCT 0: 1
1: 1
2: 2
3: 46
4: 415
Right 1079106040 11:17573094-17573116 GGCCTGCAGCGTGCTCACGGGGG 0: 1
1: 0
2: 0
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079106040 Original CRISPR GGCCTGCAGCGTGCTCACGG GGG Exonic
900709608 1:4105298-4105320 TCCCTGCAGCCTGCACACGGAGG - Intergenic
901602791 1:10435069-10435091 GAGCTGCAGCGTGTCCACGGTGG + Intronic
904559669 1:31387953-31387975 GGCCTGCAGCTGGCCCATGGTGG + Intergenic
907779599 1:57553782-57553804 GGACTGCAGGGCGCTCACTGAGG + Intronic
908314332 1:62918017-62918039 GGGCTGCAGAGTGCTCACCACGG - Intergenic
913258011 1:116972862-116972884 TGCCTGCAGCGTTTTCAGGGAGG + Intronic
915757294 1:158275055-158275077 GGCCTGCAGAATGCTTACTGGGG + Intergenic
916679967 1:167094908-167094930 GGCCTGCACCGCCCTCACGTTGG - Exonic
919854407 1:201695658-201695680 GGCCTGCATCCAGCCCACGGTGG - Intronic
923198973 1:231693844-231693866 CACCTGCAGCGTGCTTTCGGAGG + Exonic
1062760132 10:11626-11648 GGCATTCAGCGCGCTCCCGGGGG + Intergenic
1062843981 10:690420-690442 GGCCTGCAGCCTGTTCCGGGAGG - Intergenic
1063563472 10:7150566-7150588 AACCTGCAGCGTGCTGAGGGAGG - Intergenic
1072188011 10:93060647-93060669 GGGCAGCGGCGCGCTCACGGAGG - Intergenic
1076164749 10:128272724-128272746 GGCCTGCAGCGTGGTCCCTGAGG - Intergenic
1076461562 10:130650673-130650695 GGCCTCCAGCGGGCACCCGGAGG + Intergenic
1076618978 10:131775033-131775055 GGTCTGGAGCGAGCTCAGGGAGG - Intergenic
1076811598 10:132889116-132889138 GGCCTGCAGAGTGCTGGGGGAGG - Intronic
1076894423 10:133302877-133302899 AGCCTGCTGCGTGTCCACGGAGG - Exonic
1077377317 11:2211125-2211147 TGCCTGCAGCCCGCTCACTGAGG - Intergenic
1077501943 11:2913275-2913297 GGCCTGCTGCCTGCCCACTGTGG - Intronic
1079106040 11:17573094-17573116 GGCCTGCAGCGTGCTCACGGGGG + Exonic
1081567460 11:44268871-44268893 GGTCTGCAGCGTGCTGTCTGAGG - Intronic
1084934958 11:72581924-72581946 GTCCTGCAGCATGCTCAGGATGG + Exonic
1091092160 11:132781479-132781501 GGTCTGCAGCTTGCCCACTGTGG + Intronic
1093473914 12:19534148-19534170 GGCCTGAAGCGTGGGGACGGGGG + Intronic
1096458483 12:51807187-51807209 GTCCTGCAGCGTGCCTACCGGGG + Exonic
1097574485 12:61374158-61374180 GGCATGCAGAGTGCTCAAGCTGG + Intergenic
1101573153 12:105973693-105973715 GGCATGCTGTGTGCTGACGGTGG + Intergenic
1105934361 13:25085588-25085610 GGCCTGCAGCGTTCTCAGAAGGG - Intergenic
1123025783 14:105423090-105423112 CGCCTGCAGCTTGCTCATGTGGG + Intronic
1125430013 15:39584150-39584172 GTCCTGCAGCGTGGTCACAATGG - Exonic
1126593409 15:50361936-50361958 GGGCTTCAGGCTGCTCACGGTGG - Intergenic
1128721824 15:69955740-69955762 GGCATGCAGCGTGCTCTTGGAGG + Intergenic
1129117646 15:73374212-73374234 GGCCTGCAGCATTCTCACAGTGG + Intergenic
1129679605 15:77650766-77650788 GTCCTGCAGGGTGGTCACAGAGG + Intronic
1131268941 15:90935081-90935103 GACCTGCAGGGAGCTCGCGGCGG - Intronic
1132339924 15:101071834-101071856 GGCCTGCAGCCTGCACCAGGAGG + Intronic
1132686527 16:1164560-1164582 GGCCTGCAGCGTGGGCACAGGGG + Intronic
1133031571 16:3013704-3013726 GGCCCGTATCGTGCTCACCGCGG + Exonic
1133270738 16:4609785-4609807 GGCCTCCAGCTGGCCCACGGCGG - Exonic
1139383293 16:66548241-66548263 GGCCCCCAGCGTACTCAGGGTGG - Intronic
1139477126 16:67208369-67208391 GGCCCGCAGCGTGAGCAGGGAGG + Exonic
1142317187 16:89355207-89355229 GGCGGGCAGAGGGCTCACGGAGG + Intronic
1142474318 17:180592-180614 GGCCTCCCGCGTGGTCCCGGCGG - Intronic
1143765955 17:9137935-9137957 TGCCTGCAGTGAGCTCAGGGCGG + Intronic
1146572073 17:33961541-33961563 TGCCTGCATCGTCCTCACAGGGG + Intronic
1148440225 17:47708409-47708431 GGCCTACACCGAGCTGACGGAGG + Exonic
1149494013 17:57105712-57105734 TGCAGGCAGCTTGCTCACGGTGG - Exonic
1152248930 17:79201426-79201448 GGCCTGCTGTGAGCTCAGGGAGG + Intronic
1152630672 17:81409465-81409487 GGCCAGGAGCGGGCTCAGGGTGG + Intronic
1152953039 18:11980-12002 GGCATTCAGCGCGCTCCCGGGGG + Intergenic
1160490894 18:79336025-79336047 GGCATGGAGGGTGCACACGGCGG - Intronic
1160862296 19:1242529-1242551 GACCTGCAGCGTGGGCACGTGGG - Exonic
1163590830 19:18193374-18193396 GGGCTGCGGCGCGCTCATGGCGG + Exonic
1164243425 19:23409870-23409892 GGCCTGCAGGGTGGACACGTTGG - Intergenic
1165320105 19:35079948-35079970 GGCCTGCTTCCTGCTCACCGGGG + Intergenic
1166862888 19:45819937-45819959 GGCCTGCAGCGTGCACGCCTGGG + Intronic
1167307679 19:48718773-48718795 GGCTAGTAGCATGCTCACGGGGG - Intronic
1167323092 19:48808118-48808140 GGCCTGCAGCGTGGTCTTGCTGG + Intronic
1167377247 19:49118828-49118850 GGCCTGCAGGGTTCCCCCGGCGG - Exonic
1167657855 19:50777988-50778010 GGCTTGCAGAGCGCTCGCGGCGG - Intergenic
1168076452 19:53982941-53982963 AGTCTCCAGCGCGCTCACGGGGG - Exonic
1168354005 19:55691208-55691230 GGCCTGCAGCGCGATGACTGCGG + Intronic
929760319 2:44801461-44801483 GGCCTAGAGCGGGCTCACGAGGG - Intergenic
930243049 2:48955906-48955928 GGCCTGTAGTGTGCACACTGTGG + Intergenic
933876276 2:86623899-86623921 GGCCTGCAGGGTGCGCCCGCAGG + Intronic
933892353 2:86783545-86783567 GGCCTAAAGCATGCTCATGGTGG - Intergenic
935400391 2:102654079-102654101 GGCCTGCAGCATGCCATCGGAGG - Intronic
935692662 2:105745005-105745027 GGCCGGCAGCGTCCGCCCGGCGG + Exonic
938288995 2:130139754-130139776 GGCCTGCATGGCCCTCACGGGGG + Intronic
938467535 2:131533184-131533206 GGCCTGCATGGCCCTCACGGGGG - Intronic
948632102 2:239308888-239308910 GGCCTGCAGCGTGCTTCCGAGGG - Intronic
1171252271 20:23657395-23657417 GGGCTGCAGCTTGCTCACCAGGG + Intergenic
1172505920 20:35462528-35462550 GGCCTGCAGCTTCCTCACAAGGG - Exonic
1172658531 20:36550853-36550875 GGCCTGCAGCCTGCTGCCGGGGG - Exonic
1173482884 20:43416890-43416912 GGCCTGGAGGGTGCCCACCGGGG - Intergenic
1173638682 20:44583531-44583553 GGCTTGCAGTGTGCTAACAGGGG + Intronic
1174869219 20:54167989-54168011 GGCCAGCAGCCAGCTCATGGAGG - Intronic
1176108182 20:63399251-63399273 GGCCTGCAGGGGTCTCACTGGGG - Intergenic
1176111895 20:63414689-63414711 GGCATGTAGCACGCTCACGGTGG - Intronic
1179480946 21:41678300-41678322 GGCCCCCAGCATGCTCAGGGTGG - Intergenic
1179520636 21:41942158-41942180 GGTCTCCAGCGTGCTCAGGTCGG - Exonic
1179947219 21:44686517-44686539 GGCCTGCCGCATGCTCAGGTCGG + Intronic
1180985203 22:19900092-19900114 GGCATGCAGCTTCCTCACTGTGG + Intronic
1181464620 22:23104189-23104211 GCCCTGCAGCGGGATGACGGAGG + Intronic
953999122 3:47542359-47542381 GGCCTGCAGTGTGCTCCTGCTGG + Intergenic
954744866 3:52781959-52781981 GGACTGCTGCTGGCTCACGGTGG - Exonic
960080151 3:113532857-113532879 GGCTGGCAGCGTGCTGACGAAGG - Exonic
968428173 4:536639-536661 GGCCAGCCGCGTGCTCACACTGG + Intronic
968509466 4:989043-989065 GTCCTGCAGCGTGCTCACACCGG + Exonic
968702927 4:2065263-2065285 GGCCTGCAGTGTGGGCAGGGTGG + Exonic
968866889 4:3218801-3218823 GGCCTGCAGCATCCTCAGGCAGG + Intronic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
972567958 4:40285813-40285835 GCCCTTCAGGGTGCTGACGGAGG + Intergenic
972864924 4:43220178-43220200 GGCCTGCTGAATGCTCACGTAGG - Intergenic
981088275 4:140706117-140706139 GGCCTGCAGAGGGCTGACGGGGG - Intronic
982396085 4:154917432-154917454 CACCTGCAGCTTGCTCACTGGGG + Intergenic
985656912 5:1137128-1137150 GGACTGCAGCGGCCTCACTGTGG - Intergenic
986267461 5:6202675-6202697 GAGCTGCAGTGTGCTCAGGGGGG - Intergenic
986713223 5:10502790-10502812 GGCCTTCTGGGTGCACACGGAGG - Intergenic
987221323 5:15793030-15793052 GGCATGCAGCTTGCACACGCAGG - Intronic
989606451 5:43248682-43248704 GGCCTCCAGCTTGCTGACTGTGG - Intronic
998339583 5:141405069-141405091 GGCCAGCAGCGTGATAACGAAGG - Exonic
998340098 5:141409782-141409804 GGCCTGCAGCGTGAGCGCGAAGG - Exonic
998341187 5:141419439-141419461 GGCCTGCAGCGTGAGCTCGAAGG - Exonic
1001485835 5:172119096-172119118 GATCTGCAGCGTGCGCACGTGGG - Intronic
1002309163 5:178304159-178304181 GGCCTGCAGCGGCCTCAGGGAGG + Intronic
1002771216 6:292228-292250 GGCCTGCCCGGTGCGCACGGGGG + Intronic
1005946862 6:30601951-30601973 GGCCTCCATCGTGCCCTCGGTGG + Exonic
1007235856 6:40391140-40391162 GGCCTGCCACATGCTCAAGGGGG + Intergenic
1026768113 7:73173152-73173174 GGCCTGCAGCTTGTTCTCTGAGG - Intergenic
1027044578 7:74982862-74982884 GGCCTGCAGCTTGTTCTCTGAGG - Intronic
1027079060 7:75219498-75219520 GGCCTGCAGCTTGTTCTCTGAGG + Intergenic
1029372242 7:100157443-100157465 AGTCAGCAGCGTGCTCACTGCGG + Exonic
1032080051 7:128854234-128854256 GGCCGGCCGGGTCCTCACGGCGG + Intronic
1035018004 7:155783042-155783064 GGCCTGCAGTGGGCAGACGGTGG + Intergenic
1035047840 7:155980939-155980961 GGGCTGCAGCGTGGGCACTGTGG + Intergenic
1037675926 8:21050707-21050729 AGCCGGCAGCGTGCTCCCTGAGG + Intergenic
1039474154 8:37830583-37830605 GGCCTGCAGCCTGCTCCAGCTGG - Intronic
1039547605 8:38421138-38421160 AGCCTGCAGCCTGCTCAGGGTGG - Intronic
1039630559 8:39107586-39107608 GGCCCGCAGCGTGCGCCCCGAGG - Intronic
1047381790 8:124371771-124371793 GGGCCGCAGCGGGCTCCCGGTGG + Intronic
1049488216 8:142877313-142877335 GGCCTGCAGGGAGCTGACTGGGG + Intronic
1049493105 8:142915336-142915358 GGCCTGCAGGGAGCTGACTGGGG + Intronic
1057274441 9:93668832-93668854 TGCCTGCAGCGGGCTGAGGGGGG - Intronic
1057908925 9:99003515-99003537 GGCCAGCAGTGTGCCCACCGGGG + Exonic
1060105287 9:120869283-120869305 GGCCTGCAGCGTCCTGGCGATGG + Exonic
1060660072 9:125400037-125400059 AGCCTCCAGCGTGCTCCAGGTGG + Intergenic
1061828079 9:133274400-133274422 GGCCTGCAGCCTGCACCCCGTGG + Intronic
1186457671 X:9722785-9722807 GTCCTGCAGCCTGCTCTTGGCGG - Intergenic
1200053114 X:153445122-153445144 GGCCTGCAGCGTCCGCACCACGG + Exonic