ID: 1079112328

View in Genome Browser
Species Human (GRCh38)
Location 11:17611964-17611986
Sequence TTAGTGTGAGCTCGGGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 86}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079112328_1079112343 16 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112343 11:17612003-17612025 CACATGGCTTGTGGTGGGTAGGG 0: 1
1: 0
2: 1
3: 16
4: 170
1079112328_1079112335 7 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112335 11:17611994-17612016 GCCAGGCCCCACATGGCTTGTGG 0: 1
1: 0
2: 2
3: 23
4: 215
1079112328_1079112342 15 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112342 11:17612002-17612024 CCACATGGCTTGTGGTGGGTAGG 0: 1
1: 0
2: 2
3: 25
4: 208
1079112328_1079112333 -10 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112333 11:17611977-17611999 CTCACACTAAGTGCATCGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 45
1079112328_1079112334 0 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112334 11:17611987-17612009 GTGCATCGCCAGGCCCCACATGG 0: 1
1: 0
2: 0
3: 6
4: 137
1079112328_1079112347 24 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112347 11:17612011-17612033 TTGTGGTGGGTAGGGGGTGAGGG 0: 1
1: 0
2: 5
3: 94
4: 1014
1079112328_1079112344 17 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112344 11:17612004-17612026 ACATGGCTTGTGGTGGGTAGGGG 0: 1
1: 0
2: 2
3: 15
4: 251
1079112328_1079112345 18 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112345 11:17612005-17612027 CATGGCTTGTGGTGGGTAGGGGG 0: 1
1: 0
2: 1
3: 33
4: 433
1079112328_1079112338 11 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112338 11:17611998-17612020 GGCCCCACATGGCTTGTGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 151
1079112328_1079112337 10 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112337 11:17611997-17612019 AGGCCCCACATGGCTTGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 168
1079112328_1079112346 23 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112346 11:17612010-17612032 CTTGTGGTGGGTAGGGGGTGAGG 0: 1
1: 0
2: 5
3: 121
4: 1090

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079112328 Original CRISPR TTAGTGTGAGCTCGGGGGTC AGG (reversed) Intronic
900509946 1:3054062-3054084 TTCTTGGGAGCTCTGGGGTCCGG + Intergenic
904035751 1:27557603-27557625 TAAGTGTGTGCTCAGGGTTCTGG - Intronic
910077706 1:83299621-83299643 TTAGTGTGATTTTGGGGGTGGGG - Intergenic
915636449 1:157190212-157190234 TGAGTGTGGGCTCGGGGGGAAGG + Intergenic
915979428 1:160410799-160410821 TTTGTCTGAGCTCTGGGATCAGG - Intronic
918084842 1:181236843-181236865 ATAGTGGGCGCTCCGGGGTCAGG + Intergenic
919348122 1:196412635-196412657 TTTGTGTGTGCTGGGGGGTAGGG - Intronic
923332647 1:232939833-232939855 TTGGTGTGTTCTAGGGGGTCAGG + Intergenic
923750957 1:236745639-236745661 GTAGTGTGAGCCCTGGGGTGCGG + Intronic
1066233678 10:33464522-33464544 TTAGTGTGAGAAAGGGAGTCTGG - Intergenic
1067233174 10:44426030-44426052 TCAGTGTCAGCTCTGGGGTTGGG + Intergenic
1077230396 11:1455971-1455993 TGAGTGGGAGGTGGGGGGTCTGG - Intronic
1077832134 11:5884829-5884851 ATACTGTGAGCACAGGGGTCTGG + Exonic
1078011189 11:7574381-7574403 TTATTGGGAGCTCGGGGGCCTGG - Intronic
1079112328 11:17611964-17611986 TTAGTGTGAGCTCGGGGGTCAGG - Intronic
1080474304 11:32575342-32575364 TTAGTGTGAGTTTAGGGGCCTGG + Intergenic
1083900580 11:65641416-65641438 TGTGTGTGAGCTCGGGGGTGAGG + Exonic
1084370764 11:68741236-68741258 ATAGTGTGAGCTAGGGGAGCAGG - Intronic
1089732461 11:120527654-120527676 TTAGTGTGAGCGAGGCTGTCTGG - Intronic
1089738222 11:120564333-120564355 TTAGTGTGCGCTCGCGGGGAGGG + Intronic
1097033281 12:56104827-56104849 TGAGTGCGGCCTCGGGGGTCGGG + Intronic
1102469678 12:113152739-113152761 TCTGTGTGGGTTCGGGGGTCCGG - Intronic
1103857436 12:123982678-123982700 TTAGTGTGAGCCTGGTGGACTGG + Intronic
1106573970 13:30957239-30957261 TTAGTGTGGGATAGGGGGTCAGG + Intronic
1112217787 13:97452296-97452318 GTGGTGTGAGATAGGGGGTCAGG + Intronic
1119437895 14:74610167-74610189 TTAGTGTGGGCTGGGAGGCCAGG + Intronic
1121246366 14:92463815-92463837 TTAGTGGTTGCTAGGGGGTCGGG - Intronic
1122115949 14:99527367-99527389 TTAGTGTCAGCTCGGGCATGGGG + Intronic
1128002923 15:64210764-64210786 TTTGTGTGTGTTGGGGGGTCCGG - Intronic
1131456029 15:92583424-92583446 TTAGGGAAAGCACGGGGGTCTGG - Intergenic
1136556449 16:31010349-31010371 GGAGTGTGAGCTTGGGGGTGGGG - Exonic
1140253136 16:73312315-73312337 TTAGTGCCAGCTCTGTGGTCTGG - Intergenic
1148693152 17:49544611-49544633 AGAGTTTGAGCTCTGGGGTCAGG - Intergenic
1149866907 17:60156269-60156291 TGACTGTGAGCTCCGGGGTAGGG - Intronic
1150568785 17:66367350-66367372 TTAGTGAGAGCTGGGAGGACAGG + Intronic
1152638492 17:81439837-81439859 TGAGTGTGAGCTGTGGGGTAGGG + Intronic
1157817083 18:50737243-50737265 TCAGTGTGACCTCTGGGGGCTGG - Intergenic
1163315113 19:16536125-16536147 GCAGTGTGCGCTCGGGGGTGCGG - Intronic
1166198466 19:41221242-41221264 GGAGGGTGAGCTCTGGGGTCAGG + Exonic
925358317 2:3259070-3259092 TTAGTGTGTGCTAGTGGGTTAGG - Intronic
929150814 2:38747151-38747173 TTAGTCTCAGTTCAGGGGTCTGG - Intronic
929558645 2:42941843-42941865 TCAGTGTGGACTAGGGGGTCAGG - Intergenic
929562084 2:42962282-42962304 GGAGGGTGAGCTCTGGGGTCAGG + Intergenic
929929136 2:46238607-46238629 TGATTGTGAGCCCTGGGGTCAGG - Intergenic
932274347 2:70440846-70440868 CTAGTCTGAGCTCAGGGCTCAGG + Intergenic
933817598 2:86080669-86080691 TTAGTGTGAGCTCTGGGCTTAGG - Intronic
935272970 2:101451002-101451024 TTAATGGGTGCTGGGGGGTCGGG - Intronic
942060886 2:172227825-172227847 TTAGTTTGAGCTCCAGGGTTGGG - Intergenic
942541605 2:177020937-177020959 TCAGTGTGAGCATGGGGGTGAGG - Intergenic
942958023 2:181797182-181797204 TTAGTGTGTGCTCAGTGGTCTGG - Intergenic
944989997 2:205224552-205224574 CTAGTGTGTGCTGGGGGGTTGGG - Intronic
945888470 2:215402316-215402338 TAAGTGTGAGCTATGGGTTCTGG + Intronic
1169664617 20:8019881-8019903 TTATTGTCAGCTTGGCGGTCAGG - Intergenic
1170226436 20:13995851-13995873 TTAGGGTGGGGGCGGGGGTCAGG + Intronic
1172129442 20:32645908-32645930 TTAGTGTGAGATCTGGAGCCTGG + Intergenic
1173728547 20:45313267-45313289 TTAGGGTGAGGGAGGGGGTCAGG - Intronic
1173873713 20:46357093-46357115 TTAGTGCCAGCTGTGGGGTCTGG - Intronic
1175713874 20:61242565-61242587 TGACTGTGAGCTTGGGGGTCGGG - Intergenic
1179948305 21:44695368-44695390 CTACTGAGAGGTCGGGGGTCGGG + Intronic
1180791736 22:18578466-18578488 TGACTGCAAGCTCGGGGGTCTGG + Intergenic
1181230000 22:21416843-21416865 TGACTGCAAGCTCGGGGGTCTGG - Intergenic
1181248649 22:21518023-21518045 TGACTGCAAGCTCGGGGGTCTGG + Intergenic
1182899394 22:33885413-33885435 TTGGTGTGAACTTGGGGCTCGGG - Intronic
1183197944 22:36366375-36366397 TCAGTGAGAGGTGGGGGGTCGGG + Intronic
1184086485 22:42269341-42269363 TTAGTTTGACCTTAGGGGTCAGG - Intronic
1184678394 22:46055629-46055651 TTTGTGTGAGCTCGTGGGTTTGG - Intronic
949695384 3:6688563-6688585 TTATTGTTAGGTCGGTGGTCAGG - Intergenic
951112527 3:18821560-18821582 TTGGTGTGAGATAGGGGTTCGGG - Intergenic
954912534 3:54121897-54121919 TGGGTGGGAGCTCGGGGCTCTGG - Intergenic
955149611 3:56354037-56354059 TGAGTGTGGGCTCTGGAGTCAGG - Intronic
955551585 3:60090849-60090871 GTTGTCTGAGCTCTGGGGTCGGG + Intronic
961552502 3:127677268-127677290 TTACTCGGAGCTCGGGGGGCAGG - Exonic
968576254 4:1367608-1367630 TCAGTGTGAGCTTGAGGGTCTGG + Intronic
970193461 4:13535452-13535474 TTTGTTTGCGCGCGGGGGTCGGG - Intergenic
978754245 4:112285763-112285785 TAAGTGTGAGCCCCGGGGTGCGG + Exonic
985645036 5:1080768-1080790 TCAGTGTGAGCTCAGAGGCCGGG - Intronic
986490936 5:8289382-8289404 TCAGTGTGAGCTCAGTGGTGAGG + Intergenic
987369639 5:17181362-17181384 TTGCTGTGAGCTCTGGGGTGGGG - Intronic
991587520 5:68215668-68215690 TTGGTGTGGGCTCGGGGGCGGGG + Intergenic
992070407 5:73143660-73143682 TTAGAGTGAGTTTGGGGGTGAGG - Intergenic
996042702 5:118833682-118833704 ATAGTGTGAGGTCTGGGGCCAGG + Intergenic
997310786 5:132879789-132879811 TCAGTGTGAGCTCTTGGGACAGG - Exonic
997429584 5:133828178-133828200 TTCGTGTGAGCTGGTGGGTCTGG + Intergenic
1000107010 5:158069343-158069365 TTAGTTGGAGTGCGGGGGTCGGG + Intergenic
1007338338 6:41171524-41171546 TTAGTGTGAGCTGAGAAGTCAGG + Intergenic
1011744981 6:90400525-90400547 TTAGTGTGAGTGCAGAGGTCTGG + Intergenic
1020705806 7:11542689-11542711 TTAGGATGAGCTGTGGGGTCAGG - Intronic
1027295476 7:76764817-76764839 TTAGTGTGATTTTGGGGGTGGGG - Intergenic
1031074422 7:117199182-117199204 TTTGTGTGAGCTGTGTGGTCAGG + Intronic
1031141488 7:117948046-117948068 TGAGAGTGAACTCGGGGGCCGGG - Intergenic
1035068308 7:156123527-156123549 TGCGTGTGAGCTCGGCGGACAGG - Intergenic
1037967640 8:23146412-23146434 TTAGTGAGAAATCGGGGGCCAGG + Intronic
1042229561 8:66542327-66542349 TTTGTGTGTGCTCGGGGGCGGGG - Intergenic
1042480950 8:69301803-69301825 TTAGTGTGAGTTCTTGGGTGAGG + Intergenic
1061481703 9:130900684-130900706 TTTGTGTGAGATGGGGGGACGGG - Intergenic
1062067809 9:134538139-134538161 TTAGTGTGAGGCCCGGGGTGTGG - Intergenic