ID: 1079112329

View in Genome Browser
Species Human (GRCh38)
Location 11:17611969-17611991
Sequence TGCACTTAGTGTGAGCTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 63}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079112329_1079112345 13 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112345 11:17612005-17612027 CATGGCTTGTGGTGGGTAGGGGG 0: 1
1: 0
2: 1
3: 33
4: 433
1079112329_1079112334 -5 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112334 11:17611987-17612009 GTGCATCGCCAGGCCCCACATGG 0: 1
1: 0
2: 0
3: 6
4: 137
1079112329_1079112342 10 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112342 11:17612002-17612024 CCACATGGCTTGTGGTGGGTAGG 0: 1
1: 0
2: 2
3: 25
4: 208
1079112329_1079112337 5 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112337 11:17611997-17612019 AGGCCCCACATGGCTTGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 168
1079112329_1079112343 11 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112343 11:17612003-17612025 CACATGGCTTGTGGTGGGTAGGG 0: 1
1: 0
2: 1
3: 16
4: 170
1079112329_1079112347 19 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112347 11:17612011-17612033 TTGTGGTGGGTAGGGGGTGAGGG 0: 1
1: 0
2: 5
3: 94
4: 1014
1079112329_1079112335 2 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112335 11:17611994-17612016 GCCAGGCCCCACATGGCTTGTGG 0: 1
1: 0
2: 2
3: 23
4: 215
1079112329_1079112344 12 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112344 11:17612004-17612026 ACATGGCTTGTGGTGGGTAGGGG 0: 1
1: 0
2: 2
3: 15
4: 251
1079112329_1079112338 6 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112338 11:17611998-17612020 GGCCCCACATGGCTTGTGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 151
1079112329_1079112346 18 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112346 11:17612010-17612032 CTTGTGGTGGGTAGGGGGTGAGG 0: 1
1: 0
2: 5
3: 121
4: 1090

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079112329 Original CRISPR TGCACTTAGTGTGAGCTCGG GGG (reversed) Intronic
904332354 1:29768334-29768356 TGCATTTAGTGTGAAGTTGGAGG - Intergenic
915113204 1:153577897-153577919 AGCACTTGGTGTGTGCTCAGTGG - Intergenic
918221938 1:182443346-182443368 TGCATGTAGTGAGAGCTCAGAGG + Intergenic
1066661277 10:37739966-37739988 AGCACTTACTGTGTGCCCGGTGG + Intergenic
1078205858 11:9228795-9228817 TGCACTCAGCGTGAGCACGAAGG + Intronic
1079112329 11:17611969-17611991 TGCACTTAGTGTGAGCTCGGGGG - Intronic
1079383677 11:19960227-19960249 TTCACTAAGTGTGAGCTCATGGG - Intronic
1080751939 11:35158742-35158764 TGCACATAGTGTCAGCTTGCTGG - Intronic
1081686847 11:45048891-45048913 TGCACTTAGCACGAGCTCAGTGG + Intergenic
1086103091 11:83121941-83121963 TGCTCTTAATTTGGGCTCGGTGG - Intergenic
1091458043 12:622738-622760 TGCATTTAGGGTGAGGTAGGGGG - Intronic
1100009362 12:89935255-89935277 GGCTCTTAGTGGGAGCTCTGGGG + Intergenic
1103857435 12:123982673-123982695 TTCATTTAGTGTGAGCCTGGTGG + Intronic
1110702210 13:78562251-78562273 AGCACTTTGTGAGAGCTCAGGGG + Intergenic
1112484272 13:99805796-99805818 TGAATTTTGTGTGAGCTTGGTGG - Intronic
1115319352 14:32062517-32062539 TTCACTTGGTATGAGCTCGTGGG - Intergenic
1119428956 14:74553252-74553274 TGCATGAAGTGTGAGCTTGGTGG - Intronic
1120060360 14:79975539-79975561 TGCTCAGAGTGGGAGCTCGGGGG + Intergenic
1123399515 15:19970461-19970483 TGCACTTAGTGTTTGCTTTGGGG + Intergenic
1126763089 15:51987523-51987545 TGAACCTAGTGTGGGGTCGGTGG + Intronic
1133732473 16:8589365-8589387 GGCACTTAGGGTGAGCATGGGGG - Intronic
1140890802 16:79283314-79283336 TGTACTTATTGTGAACTGGGAGG - Intergenic
1141880181 16:86852980-86853002 TGCAAATATTGTGAGCTCTGGGG - Intergenic
1143557036 17:7668304-7668326 TGCAATGAGTGTGGGCTGGGGGG - Intronic
1150588578 17:66540590-66540612 TGCACTTTGTGAGTGCTCTGTGG + Intronic
1157590431 18:48833397-48833419 TACAGATAGTGTGGGCTCGGAGG + Intronic
1164404559 19:27932529-27932551 TACACTTTGTGTGAGCGCTGGGG - Intergenic
928567585 2:32568870-32568892 TGCACATAGTGTGAAGTCTGGGG + Intronic
931641914 2:64388533-64388555 CTCACTTAGTGTGAGCTTTGAGG + Intergenic
939696742 2:145335151-145335173 TACACCTAGTTTAAGCTCGGTGG - Intergenic
1171199806 20:23231864-23231886 TGGCCTTAGTGTGGGCTCCGGGG - Intergenic
1174228305 20:49022970-49022992 TGCACATAGTAGGAGCTCAGTGG + Intronic
1175199448 20:57267447-57267469 TGAACTGCGTGTGAGCTGGGGGG + Intergenic
1179639262 21:42736515-42736537 TGCAGTGAGCCTGAGCTCGGTGG - Intronic
1181329832 22:22081290-22081312 TGCACATAGTAGGAGCTCAGAGG - Intergenic
1184551087 22:45204455-45204477 TGCACAGACTGTGAGCTCCGAGG + Intronic
949379785 3:3431711-3431733 TGAACTTGGTGTGAACTTGGGGG + Intergenic
950262577 3:11553567-11553589 CGCACTGAGGATGAGCTCGGTGG + Intronic
950341266 3:12246939-12246961 TGCACTTAGTGTGAAAGCGTTGG + Intergenic
961301646 3:125925686-125925708 TGCAGTCTGTGGGAGCTCGGGGG - Intergenic
961552504 3:127677273-127677295 CGCACTTACTCGGAGCTCGGGGG - Exonic
963711375 3:148751359-148751381 TGCACTTAGTGTCTTCTCTGAGG - Intergenic
970550943 4:17180542-17180564 AGCACTTGGTGTAAGCTCTGAGG + Intergenic
978768833 4:112432568-112432590 TGTACTTACTATGTGCTCGGTGG - Exonic
985546613 5:513118-513140 TGCACCTACTGTGAGCTGCGTGG + Intronic
985645039 5:1080773-1080795 TGGCCTCAGTGTGAGCTCAGAGG - Intronic
985958918 5:3284764-3284786 GGCAGGCAGTGTGAGCTCGGTGG - Intergenic
986287916 5:6373652-6373674 GGCACCTATTGTGAGCTGGGAGG + Intronic
986490934 5:8289377-8289399 TGGCCTCAGTGTGAGCTCAGTGG + Intergenic
1001144992 5:169176094-169176116 TGCACTCACTGTGGGCTTGGTGG - Intronic
1008646579 6:53520542-53520564 TGCACTCAGTGGGGGCTCAGTGG - Intronic
1014003634 6:116392502-116392524 TGCTCTTAGGCTGAGCTTGGCGG + Intronic
1019737771 7:2659103-2659125 TGCAGCCAGTGTGAGCTCTGGGG + Intronic
1033266107 7:139888603-139888625 TGCACTGAGTGTGTGCTCATTGG + Intronic
1034823041 7:154234775-154234797 TGCACTCAGTATGGGCTGGGTGG + Intronic
1037947307 8:22997431-22997453 TTCACTGAGTGTGAGCGGGGCGG + Intronic
1040423584 8:47262174-47262196 TGCACTAAGTTTGAGCTCTAGGG - Intronic
1041317177 8:56575925-56575947 AGAACTTAGTGTAAGCTAGGTGG - Intergenic
1041455736 8:58057263-58057285 TGCCCATAGTGTGTGCTCGAGGG - Intronic
1042229564 8:66542332-66542354 TTGACTTTGTGTGTGCTCGGGGG - Intergenic
1048697689 8:137046950-137046972 TGCATTTAGTCTGAGCATGGTGG + Intergenic
1062447395 9:136600884-136600906 TGCACTGAGTGTGTGCACTGGGG + Intergenic
1185616050 X:1422724-1422746 TACACTCAGGGTCAGCTCGGTGG - Intronic
1192541146 X:71974065-71974087 TCCACTTACTGTGTGCTCTGAGG + Intergenic