ID: 1079112330

View in Genome Browser
Species Human (GRCh38)
Location 11:17611970-17611992
Sequence ATGCACTTAGTGTGAGCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 46}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079112330_1079112338 5 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112338 11:17611998-17612020 GGCCCCACATGGCTTGTGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 151
1079112330_1079112343 10 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112343 11:17612003-17612025 CACATGGCTTGTGGTGGGTAGGG 0: 1
1: 0
2: 1
3: 16
4: 170
1079112330_1079112334 -6 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112334 11:17611987-17612009 GTGCATCGCCAGGCCCCACATGG 0: 1
1: 0
2: 0
3: 6
4: 137
1079112330_1079112346 17 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112346 11:17612010-17612032 CTTGTGGTGGGTAGGGGGTGAGG 0: 1
1: 0
2: 5
3: 121
4: 1090
1079112330_1079112335 1 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112335 11:17611994-17612016 GCCAGGCCCCACATGGCTTGTGG 0: 1
1: 0
2: 2
3: 23
4: 215
1079112330_1079112337 4 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112337 11:17611997-17612019 AGGCCCCACATGGCTTGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 168
1079112330_1079112342 9 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112342 11:17612002-17612024 CCACATGGCTTGTGGTGGGTAGG 0: 1
1: 0
2: 2
3: 25
4: 208
1079112330_1079112347 18 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112347 11:17612011-17612033 TTGTGGTGGGTAGGGGGTGAGGG 0: 1
1: 0
2: 5
3: 94
4: 1014
1079112330_1079112345 12 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112345 11:17612005-17612027 CATGGCTTGTGGTGGGTAGGGGG 0: 1
1: 0
2: 1
3: 33
4: 433
1079112330_1079112344 11 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112344 11:17612004-17612026 ACATGGCTTGTGGTGGGTAGGGG 0: 1
1: 0
2: 2
3: 15
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079112330 Original CRISPR ATGCACTTAGTGTGAGCTCG GGG (reversed) Intronic
902681325 1:18045880-18045902 AGGCACTTAGTGAGTGCTCTCGG - Intergenic
920755103 1:208721827-208721849 TTGTACTTAGTGTGAGGTCTGGG - Intergenic
922376525 1:224973318-224973340 ATGCAGCTAGTGAGAGCTAGTGG - Intronic
1072356234 10:94614314-94614336 ATGCACTTATTGAGGGCTGGAGG - Intergenic
1079112330 11:17611970-17611992 ATGCACTTAGTGTGAGCTCGGGG - Intronic
1079383678 11:19960228-19960250 CTTCACTAAGTGTGAGCTCATGG - Intronic
1093159996 12:15735043-15735065 ATGCTGTTAGTGTGAAGTCGTGG - Intronic
1100009361 12:89935254-89935276 AGGCTCTTAGTGGGAGCTCTGGG + Intergenic
1109654342 13:65369616-65369638 ATGAACTTAGGGTGATCTCGAGG + Intergenic
1110236931 13:73226776-73226798 ATACACTAAGTGTGAGCTGTTGG - Intergenic
1114940358 14:27602575-27602597 ATGTACTTATTGAGAGCTTGGGG - Intergenic
1115319353 14:32062518-32062540 TTTCACTTGGTATGAGCTCGTGG - Intergenic
1119533584 14:75381268-75381290 ACCCACTTAGTGTGAGGTCAAGG - Intergenic
1121711580 14:96042739-96042761 AGGCACTGAGAGTGTGCTCGTGG + Intronic
1123399514 15:19970460-19970482 ATGCACTTAGTGTTTGCTTTGGG + Intergenic
1125589831 15:40847180-40847202 TTGGACTTAGTATGAGCTCCAGG + Intronic
1127501036 15:59554348-59554370 ATGCATTTATTGTGAGCACAAGG + Intergenic
1128716614 15:69913395-69913417 ATGCAGTTACTGGGAGCTGGTGG - Intergenic
1136182325 16:28562205-28562227 ATGCACTTAGTGAACGCTAGTGG - Intronic
1141355855 16:83346153-83346175 ATGCACTGCGTGTGTGCTGGAGG + Intronic
1143421454 17:6796299-6796321 ATGGACTTAAAGTGAGATCGTGG + Intronic
1144051128 17:11497983-11498005 AAGCACTTACTGGGAGCTGGGGG - Intronic
1144933287 17:18877456-18877478 ATGCACATAGTGGGAGCTTGTGG + Intronic
1147992209 17:44341414-44341436 AAGCCTTTAGTGTGAGCTGGTGG - Intergenic
1148724396 17:49778006-49778028 ATGCACTTTGTGGGAGCACATGG + Intronic
1154156651 18:11948983-11949005 ATGCACTGAGTTTGTGCTCCTGG - Intergenic
1157210253 18:45735981-45736003 ATGCAGGTAGTGTGAGCTGGAGG - Intronic
1164404560 19:27932530-27932552 ATACACTTTGTGTGAGCGCTGGG - Intergenic
932114848 2:69036998-69037020 ATGCAGTTCTGGTGAGCTCGTGG + Intronic
1173639645 20:44591857-44591879 ATGCACTTAATGTGCGCTTGAGG - Intronic
1180192383 21:46172124-46172146 ATGCACAGAGTGTGAGGTGGGGG + Intronic
1181053716 22:20249531-20249553 ATGCACTGAGTCTGTGCTCCTGG - Intronic
1181922946 22:26334743-26334765 AGGCACAAAGTGTGAGCTCCTGG - Intronic
1185299898 22:50074126-50074148 ATGCACCAAGACTGAGCTCGGGG + Intronic
949379784 3:3431710-3431732 ATGAACTTGGTGTGAACTTGGGG + Intergenic
957056236 3:75444924-75444946 AGGCACCGAGAGTGAGCTCGAGG + Intergenic
980737808 4:136913703-136913725 AAGCAATTAGTGTGAGCTTGAGG + Intergenic
997480235 5:134179108-134179130 ATGCACTTACTCTGGGCTTGAGG - Intronic
998472365 5:142393018-142393040 ATACATTTAGTGGGAGCTCTAGG + Intergenic
1003676413 6:8208806-8208828 AACCACTTAGGGTCAGCTCGGGG + Intergenic
1017031434 6:150226554-150226576 ATGCATTTAATGTGGGCTTGAGG + Intronic
1017090077 6:150751593-150751615 AGGCTCTTAGTGAGAGCTCGGGG - Intronic
1020590904 7:10135864-10135886 ATACACTTAGTTTGAACTTGTGG - Intergenic
1020678102 7:11203883-11203905 ATGCAATTAGGGTGAGCTGGGGG - Intergenic
1028740142 7:94265139-94265161 ATGCAGTTAATGTGAGGTCATGG + Intergenic
1033936624 7:146593354-146593376 ATCCCCTTAGTGGGAGCTCCAGG - Intronic
1035738328 8:1905704-1905726 ATGCACTTACCGTGAGCTGACGG - Exonic
1040423585 8:47262175-47262197 ATGCACTAAGTTTGAGCTCTAGG - Intronic
1041455737 8:58057264-58057286 GTGCCCATAGTGTGTGCTCGAGG - Intronic
1057452038 9:95173200-95173222 ATGTACTCTGTGTGAGCTCCTGG + Intronic
1058933393 9:109744941-109744963 ATGGACTTAGAGGGAGCTCATGG - Intronic
1061045239 9:128161392-128161414 ATCCACTTAATGTGACCTCCTGG - Intronic
1185921943 X:4103156-4103178 ATGCACTCAGTGTGAGAAGGTGG - Intergenic
1189025172 X:37387259-37387281 ATACACTTAGTATGTGCTCAAGG - Intronic
1201267878 Y:12226350-12226372 ATGCATTTAATGTGAGCTTAGGG - Intergenic