ID: 1079112331

View in Genome Browser
Species Human (GRCh38)
Location 11:17611971-17611993
Sequence GATGCACTTAGTGTGAGCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 91}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079112331_1079112344 10 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112344 11:17612004-17612026 ACATGGCTTGTGGTGGGTAGGGG 0: 1
1: 0
2: 2
3: 15
4: 251
1079112331_1079112347 17 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112347 11:17612011-17612033 TTGTGGTGGGTAGGGGGTGAGGG 0: 1
1: 0
2: 5
3: 94
4: 1014
1079112331_1079112346 16 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112346 11:17612010-17612032 CTTGTGGTGGGTAGGGGGTGAGG 0: 1
1: 0
2: 5
3: 121
4: 1090
1079112331_1079112342 8 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112342 11:17612002-17612024 CCACATGGCTTGTGGTGGGTAGG 0: 1
1: 0
2: 2
3: 25
4: 208
1079112331_1079112337 3 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112337 11:17611997-17612019 AGGCCCCACATGGCTTGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 168
1079112331_1079112345 11 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112345 11:17612005-17612027 CATGGCTTGTGGTGGGTAGGGGG 0: 1
1: 0
2: 1
3: 33
4: 433
1079112331_1079112335 0 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112335 11:17611994-17612016 GCCAGGCCCCACATGGCTTGTGG 0: 1
1: 0
2: 2
3: 23
4: 215
1079112331_1079112338 4 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112338 11:17611998-17612020 GGCCCCACATGGCTTGTGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 151
1079112331_1079112334 -7 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112334 11:17611987-17612009 GTGCATCGCCAGGCCCCACATGG 0: 1
1: 0
2: 0
3: 6
4: 137
1079112331_1079112343 9 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112343 11:17612003-17612025 CACATGGCTTGTGGTGGGTAGGG 0: 1
1: 0
2: 1
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079112331 Original CRISPR GATGCACTTAGTGTGAGCTC GGG (reversed) Intronic
901448222 1:9320861-9320883 GATGGAGTTAGAGTGAGCTCTGG + Intronic
903288372 1:22291322-22291344 GAAGCACTGAGTGAGTGCTCAGG + Intergenic
906679806 1:47718477-47718499 GAGGCACTTACGGTCAGCTCTGG - Intergenic
907320725 1:53600383-53600405 GATGCAGTGAGTGTTGGCTCTGG - Intronic
911149574 1:94584282-94584304 GAAGCCCTTGATGTGAGCTCTGG - Intergenic
915957134 1:160230568-160230590 GGAGCACTTAGTGTGAACTGAGG - Intronic
916444261 1:164857317-164857339 GAGGCACATAGTGGGAGGTCTGG + Intronic
919827846 1:201516517-201516539 TCTGCACTTAGTGGGGGCTCAGG - Intergenic
920755104 1:208721828-208721850 CTTGTACTTAGTGTGAGGTCTGG - Intergenic
1065812509 10:29455285-29455307 GATGCATTTAGTGAGAGCGGGGG + Intergenic
1065959129 10:30719941-30719963 GATGCATTTAGTGAGAGCGGGGG - Intergenic
1068560744 10:58512443-58512465 TATGCGCTTAGTGTGCGTTCAGG + Intergenic
1072419176 10:95275026-95275048 GTTGCAAATATTGTGAGCTCTGG - Intronic
1073733917 10:106324073-106324095 GATGAATTTAGTGTGATCTTAGG - Intergenic
1074976061 10:118582676-118582698 GATGCACACAGTGGGTGCTCAGG - Intergenic
1076550333 10:131273728-131273750 GAAGCACTCAGAGTGACCTCTGG - Intronic
1078399960 11:11017519-11017541 GATGCACGTTGTGTCAGCTAGGG + Intergenic
1079112331 11:17611971-17611993 GATGCACTTAGTGTGAGCTCGGG - Intronic
1084421095 11:69060983-69061005 GATTCACTTGGAGTGAGCGCTGG + Intronic
1087381995 11:97417094-97417116 GATACACAAACTGTGAGCTCAGG + Intergenic
1095124282 12:38457852-38457874 CATGCAATTTTTGTGAGCTCTGG - Intergenic
1095523053 12:43091236-43091258 GAGGCACATAGCTTGAGCTCAGG - Intergenic
1097972084 12:65644238-65644260 GATCCAATCAGTTTGAGCTCTGG - Intergenic
1098076799 12:66740068-66740090 GATGCCCTTAATGTGAACTAAGG + Intronic
1100009360 12:89935253-89935275 AAGGCTCTTAGTGGGAGCTCTGG + Intergenic
1104002739 12:124870553-124870575 CAGGCACTTTGTTTGAGCTCAGG + Intronic
1110702208 13:78562249-78562271 GCAGCACTTTGTGAGAGCTCAGG + Intergenic
1112433728 13:99375491-99375513 CCTGCACCCAGTGTGAGCTCAGG + Intronic
1113565393 13:111316694-111316716 GATGCACATTGTCTGGGCTCTGG + Intronic
1114883400 14:26815099-26815121 GATGTAGCTATTGTGAGCTCTGG + Intergenic
1115722274 14:36176209-36176231 GATGCAATGAGTGAGAGCTAAGG + Intergenic
1116037162 14:39640767-39640789 GAGGCACTAAGTCTGGGCTCAGG - Intergenic
1118130693 14:62959830-62959852 GATGCTGTTAGTGTGATCTAAGG - Intronic
1121880975 14:97500014-97500036 GATGGGCTCAGTGTTAGCTCTGG - Intergenic
1122745474 14:103894855-103894877 GAGGCACTCAGGGTGAGCTGAGG + Intergenic
1123399513 15:19970459-19970481 CATGCACTTAGTGTTTGCTTTGG + Intergenic
1137292073 16:47058627-47058649 GAGGCACATAGGGTGAGGTCTGG + Intergenic
1142819479 17:2454075-2454097 GAAGAACCTAGAGTGAGCTCAGG - Intronic
1143868868 17:9943615-9943637 GCTGGACTATGTGTGAGCTCAGG + Intronic
1156133367 18:34005693-34005715 GATGCAATGAGTGTGAGCCTTGG - Intronic
1164404561 19:27932531-27932553 CATACACTTTGTGTGAGCGCTGG - Intergenic
925235705 2:2275552-2275574 ATCGCACCTAGTGTGAGCTCAGG + Intronic
929909231 2:46074929-46074951 AATGCTCTTCTTGTGAGCTCAGG - Intronic
931718593 2:65049460-65049482 GATGCAATCAGATTGAGCTCTGG - Intergenic
935594699 2:104869570-104869592 CATGCACTTTGGGAGAGCTCTGG + Intergenic
937626153 2:124046159-124046181 GACGGAGTGAGTGTGAGCTCTGG + Intronic
938104849 2:128522941-128522963 GGTGTACGTAGTGTGAGCCCAGG + Intergenic
1171383532 20:24751745-24751767 GATGCAGTAGGTGTGAGCTGGGG + Intergenic
1173420406 20:42896178-42896200 GATGCACTCAGCGTCAGATCAGG + Intronic
1173967251 20:47121937-47121959 GATGCCCTCAGTGTGATGTCTGG - Intronic
1174422095 20:50405771-50405793 GATGCAATTAGGGTGAGAACAGG - Intergenic
1176213096 20:63934947-63934969 GATGCACTGAGTCAGAGCTAAGG - Exonic
1180192382 21:46172123-46172145 GATGCACAGAGTGTGAGGTGGGG + Intronic
1180392602 22:12298288-12298310 GATGTGCTTGGTGTGAGCTGGGG + Intergenic
1180407146 22:12566480-12566502 GATGTGCTTGGTGTGAGCTGGGG - Intergenic
1181097898 22:20518539-20518561 GATGCACTCAATGAGGGCTCTGG - Intronic
1181422395 22:22810909-22810931 TTTGCACAGAGTGTGAGCTCTGG - Intronic
1183828042 22:40403908-40403930 GATGGACTGAGTGTGGGGTCTGG + Intronic
1184650078 22:45915643-45915665 GATGGAGTTAGTGGGAGCTGGGG - Intergenic
1184957709 22:47902851-47902873 TGTGCACTTAGAGTGAGGTCAGG - Intergenic
949864840 3:8538897-8538919 GATGCTCTAAGTGTGGGCTGTGG + Intronic
951524871 3:23644133-23644155 GATGCTGTTAGTGTGGGCCCTGG + Intergenic
958205604 3:90387382-90387404 GATCAAATTAGTCTGAGCTCTGG - Intergenic
961871342 3:129990521-129990543 GATGTGCTTAGTGTGGGCACAGG - Intergenic
967665872 3:192171438-192171460 GAAGCAATGAATGTGAGCTCTGG - Intronic
991088672 5:62672334-62672356 GATGGGCTTAGAGTGAGGTCAGG + Intergenic
992897205 5:81255336-81255358 GATGCTCTTGGGCTGAGCTCAGG - Intronic
994781108 5:104091219-104091241 GATGTAATTAGTGTGAGGTCCGG + Intergenic
1002306780 5:178288171-178288193 GAGGCGATTAGCGTGAGCTCTGG - Intronic
1002755807 6:158498-158520 GACCCACTCAGTGAGAGCTCTGG - Intergenic
1003092968 6:3119230-3119252 TATGCCCTTAGTGTGGACTCTGG - Intronic
1004476809 6:15980940-15980962 GATGCACGTAGTGAGAGACCAGG - Intergenic
1009835382 6:68994079-68994101 GTTATGCTTAGTGTGAGCTCTGG + Intronic
1012412505 6:98975130-98975152 CATGCACATAGTGTGATTTCAGG + Intergenic
1014633434 6:123815710-123815732 GATTCAGTTATTTTGAGCTCAGG + Intronic
1017090078 6:150751594-150751616 TAGGCTCTTAGTGAGAGCTCGGG - Intronic
1019156795 6:170044708-170044730 GATGCAGGTACTGTGAGCACAGG - Intergenic
1020678103 7:11203884-11203906 CATGCAATTAGGGTGAGCTGGGG - Intergenic
1025160520 7:56655283-56655305 GAAGTACTTACTGTGGGCTCTGG + Intergenic
1025726210 7:64063911-64063933 GAAGTACTTACTGTGGGCTCTGG - Intronic
1028881613 7:95886538-95886560 GAAGCACTGAGTGTGAATTCTGG - Intronic
1031353914 7:120767082-120767104 GATCCATTTAGTGTGGGCCCAGG - Intergenic
1035949086 8:3999309-3999331 TATGCACTTTGTAAGAGCTCAGG - Intronic
1039831709 8:41220740-41220762 GACACATTTAGTGTGAGATCTGG + Intergenic
1043558518 8:81462809-81462831 GAGGCACTTATTTTGAGCTTGGG - Intergenic
1045813383 8:106251110-106251132 GATACACTTTATCTGAGCTCAGG + Intergenic
1051184068 9:14440147-14440169 GAGGCACCTGGTGTGAGCTGGGG + Intergenic
1052223386 9:26054724-26054746 GATGCACACAGATTGAGCTCAGG - Intergenic
1052371137 9:27665640-27665662 GATGCAGGTAGTTTGGGCTCTGG + Intergenic
1055949830 9:81720240-81720262 GAGTCAGTGAGTGTGAGCTCAGG - Intergenic
1062339374 9:136087224-136087246 GATGCACAGAGTGTCAACTCCGG + Intronic
1189360609 X:40347905-40347927 GAAGCCCTAAGTGTGAGCTGGGG + Intergenic
1190087699 X:47410037-47410059 GAGGCACATAGTGTTAACTCAGG + Intronic
1201267879 Y:12226351-12226373 CATGCATTTAATGTGAGCTTAGG - Intergenic