ID: 1079112332

View in Genome Browser
Species Human (GRCh38)
Location 11:17611972-17611994
Sequence CGATGCACTTAGTGTGAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079112332_1079112337 2 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112337 11:17611997-17612019 AGGCCCCACATGGCTTGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 168
1079112332_1079112338 3 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112338 11:17611998-17612020 GGCCCCACATGGCTTGTGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 151
1079112332_1079112342 7 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112342 11:17612002-17612024 CCACATGGCTTGTGGTGGGTAGG 0: 1
1: 0
2: 2
3: 25
4: 208
1079112332_1079112334 -8 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112334 11:17611987-17612009 GTGCATCGCCAGGCCCCACATGG 0: 1
1: 0
2: 0
3: 6
4: 137
1079112332_1079112345 10 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112345 11:17612005-17612027 CATGGCTTGTGGTGGGTAGGGGG 0: 1
1: 0
2: 1
3: 33
4: 433
1079112332_1079112347 16 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112347 11:17612011-17612033 TTGTGGTGGGTAGGGGGTGAGGG 0: 1
1: 0
2: 5
3: 94
4: 1014
1079112332_1079112344 9 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112344 11:17612004-17612026 ACATGGCTTGTGGTGGGTAGGGG 0: 1
1: 0
2: 2
3: 15
4: 251
1079112332_1079112335 -1 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112335 11:17611994-17612016 GCCAGGCCCCACATGGCTTGTGG 0: 1
1: 0
2: 2
3: 23
4: 215
1079112332_1079112343 8 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112343 11:17612003-17612025 CACATGGCTTGTGGTGGGTAGGG 0: 1
1: 0
2: 1
3: 16
4: 170
1079112332_1079112346 15 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112346 11:17612010-17612032 CTTGTGGTGGGTAGGGGGTGAGG 0: 1
1: 0
2: 5
3: 121
4: 1090

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079112332 Original CRISPR CGATGCACTTAGTGTGAGCT CGG (reversed) Intronic
908741154 1:67328988-67329010 AGAAGCACATAGTGTGAGGTTGG - Intronic
1065812508 10:29455284-29455306 TGATGCATTTAGTGAGAGCGGGG + Intergenic
1065959130 10:30719942-30719964 TGATGCATTTAGTGAGAGCGGGG - Intergenic
1073920524 10:108452976-108452998 CCATGCACTTAGTGTGGTCCAGG + Intergenic
1074736929 10:116445152-116445174 CTCTGCACTTACTGTGGGCTAGG + Intronic
1076379517 10:130015496-130015518 CCCTGCACTGAGTGTGACCTGGG - Intergenic
1078399959 11:11017518-11017540 GGATGCACGTTGTGTCAGCTAGG + Intergenic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1088382172 11:109205657-109205679 CCATGCACTTACTGTGAACCAGG + Intergenic
1097921308 12:65077503-65077525 TTATGAACTTAGTGTGGGCTGGG + Intronic
1103677762 12:122670030-122670052 TGATGAACTTAGTGTGTGCCAGG - Intergenic
1103857434 12:123982670-123982692 AGATTCATTTAGTGTGAGCCTGG + Intronic
1107380031 13:39847057-39847079 CGATGTACTCATTGTCAGCTTGG - Intergenic
1132604243 16:787089-787111 CGATGCACATGGTGTGGGCCCGG + Exonic
1136108065 16:28045161-28045183 CGTTGCACTTTCTGTGGGCTTGG - Intronic
1136596132 16:31251301-31251323 CCATGCTCTTTGTGTGACCTTGG + Intergenic
1143872655 17:9968427-9968449 TGATGGACTTAGAGTGAGCTGGG - Intronic
1151460586 17:74252004-74252026 CTGAGCACTTACTGTGAGCTGGG - Intronic
1153878008 18:9393399-9393421 TGATCCACTTGGTGTCAGCTGGG + Intronic
1157084886 18:44569753-44569775 CAAAGCACTCAGTGTGGGCTTGG - Intergenic
1157623741 18:49031468-49031490 CCATCCACATAGTGGGAGCTGGG + Intergenic
935466705 2:103406621-103406643 CCATTCACTCAGTGTGACCTTGG + Intergenic
936095377 2:109527192-109527214 GGATGCACTTTGGCTGAGCTGGG - Intergenic
945977237 2:216280428-216280450 CTACGCACTGAGTGTGACCTAGG + Intronic
1171383531 20:24751744-24751766 TGATGCAGTAGGTGTGAGCTGGG + Intergenic
1172595433 20:36148130-36148152 CTATGCACATATTGTGAACTGGG + Intronic
1180192381 21:46172122-46172144 GGATGCACAGAGTGTGAGGTGGG + Intronic
1180392601 22:12298287-12298309 TGATGTGCTTGGTGTGAGCTGGG + Intergenic
1180407147 22:12566481-12566503 TGATGTGCTTGGTGTGAGCTGGG - Intergenic
1183283139 22:36943717-36943739 AGATGCACTGCGTCTGAGCTGGG - Intergenic
1184235013 22:43178675-43178697 CGAGGCACTTAGTGAGCGCCTGG + Intronic
1184650079 22:45915644-45915666 AGATGGAGTTAGTGGGAGCTGGG - Intergenic
961535650 3:127568970-127568992 CCATGTACTAAGTGTGTGCTGGG - Intergenic
961833612 3:129638736-129638758 CCTTTCACTTACTGTGAGCTGGG - Intergenic
962265872 3:133943936-133943958 CTGTGCAGTTAGTGTAAGCTAGG - Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
977660939 4:99585193-99585215 CTAAGCACTTACTGTGTGCTAGG + Intronic
985802540 5:2014288-2014310 CCATGCACTTAAGGTCAGCTGGG - Intergenic
986287915 5:6373649-6373671 AGAGGCACCTATTGTGAGCTGGG + Intronic
988166035 5:27590688-27590710 CAATGCACTCAGGCTGAGCTGGG + Intergenic
998887147 5:146706377-146706399 CTATGCAGGTGGTGTGAGCTTGG - Intronic
1002049333 5:176561131-176561153 TTATGTACTTACTGTGAGCTAGG + Intronic
1002596570 5:180327634-180327656 CTGTGCACTTACTGTGTGCTGGG - Intronic
1004324095 6:14658125-14658147 AGATGCAGTGAGTGAGAGCTGGG - Intergenic
1007291732 6:40792524-40792546 CTATGCACTCAATGTGATCTTGG + Intergenic
1016109766 6:140208113-140208135 AGAAGAACTTAGTGTGTGCTAGG + Intergenic
1019979132 7:4608096-4608118 CTCTGCAATTAGTGTGATCTTGG + Intergenic
1020678104 7:11203885-11203907 TCATGCAATTAGGGTGAGCTGGG - Intergenic
1022753305 7:33255578-33255600 TGATGCCCTTAGTGGGACCTGGG + Intronic
1026054145 7:66970329-66970351 GGATGGACTGAGTGTGAGGTAGG - Intergenic
1036953904 8:13166783-13166805 AGCTGCACTTAGTATGAACTGGG - Intronic
1043558519 8:81462810-81462832 TGAGGCACTTATTTTGAGCTTGG - Intergenic
1046754544 8:117959673-117959695 CAATGCATTTAATATGAGCTTGG - Intronic
1051184067 9:14440146-14440168 TGAGGCACCTGGTGTGAGCTGGG + Intergenic
1057523564 9:95780036-95780058 AGATGCACTTAGTGTGAATCAGG + Intergenic
1186300045 X:8190665-8190687 CTATGAACTCAGTGTGACCTTGG + Intergenic
1189360608 X:40347904-40347926 TGAAGCCCTAAGTGTGAGCTGGG + Intergenic
1191220798 X:57985935-57985957 CTATGCAGGTAGTCTGAGCTCGG + Intergenic
1194683053 X:96877632-96877654 AGATGGACTTAGTCTGAGCATGG - Intronic
1195850388 X:109276261-109276283 AGATGCACTGAGTGTGAGTGGGG - Intergenic
1198556670 X:137800782-137800804 TGATGCAGTTAGGGTTAGCTTGG - Intergenic