ID: 1079112334

View in Genome Browser
Species Human (GRCh38)
Location 11:17611987-17612009
Sequence GTGCATCGCCAGGCCCCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079112327_1079112334 1 Left 1079112327 11:17611963-17611985 CCCTGACCCCCGAGCTCACACTA 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1079112334 11:17611987-17612009 GTGCATCGCCAGGCCCCACATGG 0: 1
1: 0
2: 0
3: 6
4: 137
1079112331_1079112334 -7 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112334 11:17611987-17612009 GTGCATCGCCAGGCCCCACATGG 0: 1
1: 0
2: 0
3: 6
4: 137
1079112329_1079112334 -5 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112334 11:17611987-17612009 GTGCATCGCCAGGCCCCACATGG 0: 1
1: 0
2: 0
3: 6
4: 137
1079112332_1079112334 -8 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112334 11:17611987-17612009 GTGCATCGCCAGGCCCCACATGG 0: 1
1: 0
2: 0
3: 6
4: 137
1079112330_1079112334 -6 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112334 11:17611987-17612009 GTGCATCGCCAGGCCCCACATGG 0: 1
1: 0
2: 0
3: 6
4: 137
1079112328_1079112334 0 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112334 11:17611987-17612009 GTGCATCGCCAGGCCCCACATGG 0: 1
1: 0
2: 0
3: 6
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079112334 Original CRISPR GTGCATCGCCAGGCCCCACA TGG Intronic
900014258 1:137708-137730 TGGCATCTCCAGGCCCCAAATGG - Intergenic
900044121 1:492910-492932 TGGCATCTCCAGGCCCCAAATGG - Intergenic
900065530 1:727816-727838 TGGCATCTCCAGGCCCCAAATGG - Intergenic
900156826 1:1206515-1206537 CAGCAGCGCCAGGCCGCACAGGG + Exonic
900457614 1:2785165-2785187 GTGCATGGCCAGGTTCCACGTGG + Intronic
900643134 1:3696784-3696806 GTCCCTCCCCTGGCCCCACATGG - Intronic
902149801 1:14434139-14434161 TTGCATTGCCAGACCCCACTAGG + Intergenic
902331718 1:15734180-15734202 GTGCATCCGCAGAGCCCACAGGG - Exonic
903370479 1:22831996-22832018 GGGCTTCCCCAGGCCCCAAATGG + Intronic
903404273 1:23083311-23083333 CTGCCTCGCCAGGCCACACCAGG + Exonic
904075820 1:27841426-27841448 GTGTATCACCAGGCCTAACAAGG + Intronic
906541017 1:46586090-46586112 GTGTGTGGCCAGGCTCCACATGG - Intronic
909931551 1:81504097-81504119 GTTCAGGGCCAGGGCCCACAGGG + Intronic
913094310 1:115502127-115502149 AAGCATCGCCAGTCTCCACAAGG + Intergenic
922170013 1:223146164-223146186 GTGGATCCCCAAGCCCTACAGGG - Intergenic
924343582 1:243055298-243055320 TGGCATCTCCAGGCCCCAAATGG - Intergenic
1064832073 10:19480119-19480141 GTGCATCTCCGGACCACACATGG + Intronic
1071807406 10:89139103-89139125 GTGCATCCCCAGGGCCCTGAGGG - Intergenic
1074535791 10:114328004-114328026 GCGCATGGCCAGGCCTCAGAGGG + Intronic
1076970455 11:129385-129407 TGGCATCTCCAGGCCCCAAATGG - Intergenic
1077043415 11:534409-534431 GCCCAGCCCCAGGCCCCACAGGG + Intronic
1077223522 11:1427621-1427643 GTGCACCGCCTGCCCCCTCAGGG + Intronic
1077545309 11:3166624-3166646 CTGCATCCCAAGGCCTCACAAGG - Intronic
1079112334 11:17611987-17612009 GTGCATCGCCAGGCCCCACATGG + Intronic
1082767797 11:57182479-57182501 GTGCATCCCCAGGCCTTTCAGGG + Exonic
1084311501 11:68318849-68318871 GTGCCTCTCAATGCCCCACAGGG - Intronic
1084313650 11:68331379-68331401 GGGCAGGGCCTGGCCCCACAAGG - Intronic
1084489936 11:69472765-69472787 GTCCATCTCCAGCCCCCACGTGG + Intergenic
1085284255 11:75349885-75349907 GGGCACTGCCAGGCCCCTCATGG - Intronic
1086243021 11:84719548-84719570 GTGCGTCGTCAGGTCCAACAAGG + Intronic
1089519258 11:119052796-119052818 CTCCATCTCCAGGCCCCCCAGGG + Exonic
1091275444 11:134346436-134346458 ATGCATGGCCAGGTGCCACATGG - Intronic
1092288933 12:7147196-7147218 GTGCAAACCCAGGCCCCAAATGG + Intronic
1097186211 12:57197900-57197922 GTGCTTGGCCAGACCTCACAGGG - Intronic
1099021216 12:77407086-77407108 GTGAATAGCCTGGCCCCACCTGG + Intergenic
1103581529 12:121918802-121918824 GGGCCGCCCCAGGCCCCACAAGG - Intronic
1106479095 13:30123623-30123645 GTCCATCGCCAGGCTCCTCATGG + Intergenic
1113481657 13:110626079-110626101 GTGCAGGGCTGGGCCCCACAGGG + Intronic
1113895095 13:113759253-113759275 CTGCATCCCGAGGCCCCACCCGG - Exonic
1114144440 14:19957272-19957294 GTGCATCGCCAAGCCTCTGATGG + Intergenic
1121946052 14:98123069-98123091 GTTCCCCGCCATGCCCCACATGG - Intergenic
1122119551 14:99544813-99544835 GAGCCTCGCCAGGTCACACATGG + Intronic
1122629337 14:103100130-103100152 GGGTGTGGCCAGGCCCCACAGGG + Exonic
1122724897 14:103743990-103744012 ATGCCTCGCCAGGACCCACGGGG - Intronic
1122892603 14:104739788-104739810 GTGCAGCGCCAGGCACAAGAGGG + Exonic
1124625662 15:31306290-31306312 GTGCATCCCAAGGCCCCAATGGG - Intergenic
1128496213 15:68200078-68200100 GTGCCCCTCCAGGGCCCACAGGG + Intronic
1129295214 15:74596403-74596425 GTTCAGGGCCAGGGCCCACAGGG + Exonic
1132573268 16:653287-653309 GTGCTACGCCAGGCCCCTCCTGG - Intronic
1132658279 16:1050288-1050310 GTGCATTCCCAGGCCCCAGACGG - Intergenic
1132744898 16:1432497-1432519 GGGCATGGCCAGGCCTGACAGGG + Intergenic
1132785070 16:1652386-1652408 ATGCTTGGCCAGGCCCCACCTGG + Intronic
1139544987 16:67645861-67645883 GTGCAAAGTCAGGGCCCACAAGG - Intronic
1142134692 16:88446272-88446294 GTGCAGAGCCAGGCCCCAGGTGG - Intergenic
1142449794 16:90168097-90168119 TGGCATCTCCAGGCCCCAAATGG + Intergenic
1142457292 17:63749-63771 TGGCATCTCCAGGCCCCAAATGG - Intergenic
1146193304 17:30789195-30789217 ATGCATCACCAGGCCCCACTTGG - Intronic
1146821456 17:35986202-35986224 CTGAATCTCCAGGCCTCACATGG - Intronic
1147422200 17:40327428-40327450 GTGCATGGGCTGGGCCCACAGGG + Intronic
1152538671 17:80964049-80964071 GGGCAGCGCCACGCCCCTCACGG + Intronic
1153540690 18:6150993-6151015 CAGCAGCGCCAGGCTCCACAAGG + Intronic
1158561606 18:58518689-58518711 GTCCATCTCCAGGCCCATCAGGG - Intronic
1159036246 18:63279987-63280009 GGGCATTGCCAGCCCCCATAAGG - Intronic
1159518660 18:69490218-69490240 GTGAAACGCCAGACCTCACAAGG + Intronic
1160029835 18:75249276-75249298 GTGCCTCGCCTGCCCCCACGGGG + Intronic
1160647651 19:200854-200876 TGGCATCTCCAGGCCCCAAATGG - Intergenic
1161376312 19:3940882-3940904 GGGCATCTCCCGGACCCACAGGG + Intronic
1161473753 19:4473547-4473569 GGGCTTCTCCAGGACCCACAAGG - Intronic
1162070024 19:8147776-8147798 CTGCAACGCCTGGCCCCACCTGG - Intronic
1162964562 19:14149782-14149804 GTGCATCCCCAGTCCCCGCCGGG - Exonic
1163661940 19:18583461-18583483 GTCCATTGCCAAGCCCCTCATGG + Intronic
1164448278 19:28336417-28336439 GTGCAAAGGAAGGCCCCACAGGG - Intergenic
1165028577 19:32980799-32980821 GTGCACCACCAGGTCCAACAAGG + Intronic
1165404462 19:35621261-35621283 GAGCAGCCCCAGACCCCACACGG + Intronic
1166617179 19:44260586-44260608 GGACATCCCCAGGCACCACATGG - Intronic
1167213234 19:48146888-48146910 GGGCCTCGCCAGGTCACACAGGG - Intronic
1168406647 19:56114126-56114148 GTTCCTCCCCAGGCACCACAGGG + Intronic
1168469220 19:56627440-56627462 GGGCAGTGCCAGGCCACACAGGG + Intergenic
925062437 2:903629-903651 ATGCATCTCCAGGACCCACGTGG - Intergenic
926107205 2:10159964-10159986 GTGCATCCCCAGGGCCCTCGGGG + Intronic
933738855 2:85517215-85517237 CTGGATTGCCAGGCCCCAGAGGG - Intergenic
934553734 2:95276883-95276905 CTGCCTCCCCAGGCCCCACCGGG - Intronic
939962774 2:148580295-148580317 GTGCCTCGTCAGGGCACACAAGG + Intergenic
948740222 2:240041630-240041652 GTGCATCCTCAGGCTGCACAGGG - Intergenic
1172978313 20:38922602-38922624 GTGCAGAGCCAGGCCCCGCACGG - Exonic
1174444909 20:50584053-50584075 GAGCACCATCAGGCCCCACAGGG - Exonic
1176135992 20:63522248-63522270 GAGCAGGGCCAGCCCCCACAAGG - Intergenic
1181751873 22:24994569-24994591 GTGCCACCCCAGGCACCACAGGG - Intronic
1183735195 22:39641110-39641132 GGGCAGCGCCAACCCCCACAAGG + Exonic
1184320481 22:43738929-43738951 GTGCATCACGTGGCCCCACCTGG - Intronic
1184734854 22:46391985-46392007 CTGCCTCCCAAGGCCCCACAAGG + Intronic
1185179323 22:49350119-49350141 GTGCCACGCCAGGCCACGCAGGG + Intergenic
949599622 3:5583937-5583959 ATGCATTTCCAGGCCCTACATGG - Intergenic
952338086 3:32422103-32422125 TTCCTTCCCCAGGCCCCACAGGG + Intronic
954397914 3:50302816-50302838 GTGCCTCTCCAGGCACCACTGGG + Exonic
961640546 3:128362098-128362120 GTGCTTCTCCAAGCACCACATGG - Intronic
968370196 3:198219261-198219283 TGGCATCTCCAGGCCCCAAATGG + Intergenic
968608118 4:1545244-1545266 GTTAATCGCCACTCCCCACACGG - Intergenic
968668646 4:1835634-1835656 GGGCATCGCAGGTCCCCACAGGG + Intronic
968801482 4:2745997-2746019 GTGCATGGCCAGGCCCACCCTGG - Intronic
969573323 4:8022745-8022767 ATGCATCGCCAGCTCCCACCTGG + Intronic
976342680 4:83962987-83963009 GCACATGGCCTGGCCCCACATGG + Intergenic
980053910 4:128061935-128061957 GTGCAGCGCCAGGGGCCTCACGG - Intronic
984288443 4:177763029-177763051 GTGCTTTGACAGGCCCCTCAAGG - Intronic
985592684 5:773723-773745 GTTCCTGGCCAGGCCCCACTTGG - Intergenic
985795990 5:1962498-1962520 GTGCAACGGCGGCCCCCACACGG + Intergenic
987052760 5:14161814-14161836 GTGGATCGCCTGAGCCCACAAGG - Intronic
991591639 5:68257457-68257479 GTGCAAAGGCAGGCCCCACAGGG + Intronic
1001696425 5:173673676-173673698 GTGCTTCGCCAGGGTCCCCAGGG - Intergenic
1002729722 5:181326019-181326041 TGGCATCTCCAGGCCCCAAATGG + Intergenic
1003130911 6:3394685-3394707 GTGGCTCTCCAGGGCCCACAGGG + Intronic
1006718054 6:36132543-36132565 GTGCATGGCCAGGGCCCAGGAGG + Intronic
1007496652 6:42264595-42264617 GTGCCTCGCCAGGTCCCGCATGG + Intronic
1019410427 7:904343-904365 GTGCGCCGCCAGCACCCACAGGG - Intronic
1019410464 7:904529-904551 GGGCAGCCCCGGGCCCCACACGG + Intronic
1024648382 7:51386782-51386804 CGGCATCTCCAGGCCCCAAACGG - Intergenic
1025052231 7:55741251-55741273 CGGCATCTCCAGGCCCCAAACGG - Intergenic
1025176284 7:56804040-56804062 TGGCATCTCCAGGCCCCAAATGG + Intergenic
1025695508 7:63772382-63772404 TGGCATCTCCAGGCCCCAAATGG - Intergenic
1027342632 7:77225403-77225425 GTGCATCACCATGCCCCGCTAGG - Intronic
1032051441 7:128653140-128653162 TGGCATCTCCAGGCCCCAAATGG + Intergenic
1036711720 8:11083581-11083603 AAGCATCCCCAGGCCCCCCAAGG - Intronic
1040042798 8:42933422-42933444 GTGTAACCCCAGGCCCCACTGGG - Intronic
1040918397 8:52587522-52587544 GTGCTTCCACAAGCCCCACAGGG + Intergenic
1041943356 8:63413153-63413175 ATGCATCGCCAGGACCCTGAAGG - Intergenic
1043465861 8:80506697-80506719 GTGCTACTCCAGACCCCACATGG + Intronic
1045124968 8:99079156-99079178 GTTGATCCCCAGGCCCCAGATGG + Intronic
1049381071 8:142316061-142316083 GTGCTGAGCAAGGCCCCACATGG - Intronic
1050026066 9:1335493-1335515 GTGCATCCCCAGGGACTACAGGG - Intergenic
1052792593 9:32889754-32889776 CTGCATTACCAGGCCCCAAAGGG - Intergenic
1053224957 9:36346825-36346847 GTAAATTGCCAGGCCACACATGG + Intronic
1056721987 9:89080504-89080526 GCCCATCCCAAGGCCCCACAAGG + Intronic
1057836770 9:98451640-98451662 GCACATTCCCAGGCCCCACATGG - Intronic
1058165284 9:101612001-101612023 GGGCAGGGCCAGGTCCCACAGGG + Intronic
1062164202 9:135098518-135098540 GTGCAGCGCCACGTCCCGCAGGG - Intronic
1062446467 9:136597404-136597426 GTGCCTGGCCGGGCCCCACTGGG + Intergenic
1062723586 9:138058474-138058496 CTGTCTCGCCAGGCCTCACAGGG - Intronic
1062754136 9:138278531-138278553 TGGCATCTCCAGGCCCCAAATGG + Intergenic
1202792286 9_KI270719v1_random:95800-95822 GTGGATACCCAGGCCCCACGTGG - Intergenic
1203577694 Un_KI270745v1:21288-21310 TGGCATCTCCAGGCCCCAAATGG + Intergenic
1185465981 X:354351-354373 GTGCATTGCCCGGCCACGCAGGG - Intronic
1187400374 X:18954311-18954333 GGCCATGCCCAGGCCCCACACGG + Exonic
1190928756 X:54931045-54931067 TTCCATAGCCAGGACCCACAGGG + Intronic
1194128607 X:90051143-90051165 GTGCAGAGCCAAGCCCCAAAAGG + Intergenic