ID: 1079112335

View in Genome Browser
Species Human (GRCh38)
Location 11:17611994-17612016
Sequence GCCAGGCCCCACATGGCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 215}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079112331_1079112335 0 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112335 11:17611994-17612016 GCCAGGCCCCACATGGCTTGTGG 0: 1
1: 0
2: 2
3: 23
4: 215
1079112328_1079112335 7 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112335 11:17611994-17612016 GCCAGGCCCCACATGGCTTGTGG 0: 1
1: 0
2: 2
3: 23
4: 215
1079112329_1079112335 2 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112335 11:17611994-17612016 GCCAGGCCCCACATGGCTTGTGG 0: 1
1: 0
2: 2
3: 23
4: 215
1079112332_1079112335 -1 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112335 11:17611994-17612016 GCCAGGCCCCACATGGCTTGTGG 0: 1
1: 0
2: 2
3: 23
4: 215
1079112327_1079112335 8 Left 1079112327 11:17611963-17611985 CCCTGACCCCCGAGCTCACACTA 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1079112335 11:17611994-17612016 GCCAGGCCCCACATGGCTTGTGG 0: 1
1: 0
2: 2
3: 23
4: 215
1079112330_1079112335 1 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112335 11:17611994-17612016 GCCAGGCCCCACATGGCTTGTGG 0: 1
1: 0
2: 2
3: 23
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079112335 Original CRISPR GCCAGGCCCCACATGGCTTG TGG Intronic
900098954 1:952835-952857 TGCAGGCCACCCATGGCTTGGGG + Intronic
900247224 1:1642374-1642396 GCCTGGCCTCACCTGGCTTCCGG + Exonic
900258448 1:1709506-1709528 GCCTGGCCTCACCTGGCTTCCGG + Exonic
902372645 1:16015850-16015872 GCCAGACCCCACATGCCGAGGGG + Intronic
903795011 1:25922392-25922414 ACTAGACCCCACATCGCTTGGGG + Intergenic
905244821 1:36605456-36605478 GCCAGGCCCCACACAGCATTAGG - Intergenic
906202179 1:43967309-43967331 GCCTGGCCCCCAATGGCCTGAGG - Exonic
907273303 1:53303301-53303323 GCCAGTCCTCACAGGGCCTGTGG + Intronic
912462995 1:109849498-109849520 GCCAGGGCCCACATGACTTAGGG - Intergenic
916371581 1:164102080-164102102 GCCTGGCCCCCCATGGCCTCAGG - Intergenic
919789362 1:201280590-201280612 GACAGGCCCCACATAGGGTGGGG + Intergenic
919819837 1:201465946-201465968 GCCTGGCCTCATATGGCATGAGG - Exonic
919916615 1:202143515-202143537 GCCAGGCTAGACAGGGCTTGTGG - Intronic
920676372 1:208041218-208041240 TCCAGGCCCCACGTGGGGTGAGG - Intronic
921706113 1:218324048-218324070 GCCAGGCTCCACAGAGCTGGTGG - Intronic
922729589 1:227942712-227942734 GCCAGGCCCCACATGCTTCCTGG + Intronic
924856297 1:247878528-247878550 GCTAGGGCACACATGGCCTGTGG - Intergenic
1064585597 10:16836840-16836862 GACAGGCCCCGGCTGGCTTGGGG - Intronic
1067588945 10:47493696-47493718 GCCAGGCCCACCATGGCCTCTGG + Intergenic
1072922690 10:99589764-99589786 TCCAGGCCACAGATCGCTTGAGG + Intergenic
1073009882 10:100350833-100350855 GTCAGTCACCACTTGGCTTGAGG + Intronic
1073911145 10:108346254-108346276 GCCAGGCTGCAGATGGCCTGTGG - Intergenic
1075411089 10:122228434-122228456 GCAAGACCCCACAGGGCTTGGGG - Intronic
1075978153 10:126714776-126714798 AGCAGGCCTGACATGGCTTGAGG + Intergenic
1076215584 10:128690997-128691019 CACAGGCCACACATGGCTCGTGG + Intergenic
1077504523 11:2923933-2923955 GCCAGGCCCCACCTGGGCTCAGG - Intronic
1079112335 11:17611994-17612016 GCCAGGCCCCACATGGCTTGTGG + Intronic
1081676950 11:44975567-44975589 CCCAGGCCCCTCAAGGCTGGTGG + Intergenic
1081687400 11:45052494-45052516 GCCAGGCCCAACATGGCAAAGGG - Intergenic
1081705568 11:45180646-45180668 GCCAGGCCCGGCATTCCTTGCGG - Intronic
1081907156 11:46677426-46677448 CCCAGGCCCAGCCTGGCTTGCGG + Exonic
1082810842 11:57477938-57477960 GACAGCCCCAACATGGCTTTGGG + Intergenic
1083778654 11:64906863-64906885 GCCAACCCCCAGAGGGCTTGAGG - Intronic
1084327971 11:68412690-68412712 CCCAGGCACCCCTTGGCTTGAGG + Intronic
1084698169 11:70768722-70768744 TCCAGGCTCCCCATGGCCTGAGG - Intronic
1087646005 11:100809033-100809055 GAGAGGGCCCACATTGCTTGTGG + Intronic
1090382171 11:126335143-126335165 GCCAGGCCACACATGGCTGGAGG + Intronic
1095984378 12:47989760-47989782 GCCAGGCCCCGCAGGGCCTCCGG - Exonic
1101127579 12:101653219-101653241 CCCCGGCTCCACATGGCTTTAGG - Exonic
1101736540 12:107467393-107467415 GCCAGGCCACACCAGGCTTGTGG - Intronic
1104479222 12:129092880-129092902 GGCAGGCCCCTCATGGCTATAGG - Intronic
1108152640 13:47552349-47552371 GCCAGGCCCTACATTGCGGGTGG - Intergenic
1111534548 13:89585909-89585931 GCCAGGCATCCCTTGGCTTGTGG - Intergenic
1112945075 13:104918544-104918566 GACAGAGCCCTCATGGCTTGGGG + Intergenic
1113432312 13:110261664-110261686 GCAAATCCCCAGATGGCTTGAGG - Intronic
1113481859 13:110627092-110627114 ACCAGGCCCCACACTGCATGTGG - Intronic
1113509482 13:110841550-110841572 CCCAGGCACCCCTTGGCTTGTGG + Intergenic
1113543801 13:111130993-111131015 GCCAGGCAGCACAGGGCTGGTGG + Intronic
1113970470 13:114185116-114185138 GCCTGGCCACACAAGGGTTGGGG - Intergenic
1118147642 14:63157549-63157571 GCAAGGTCCCACATAGCTGGGGG + Intergenic
1121223018 14:92300486-92300508 GCCAGGCCCTACAGGGCTGTGGG - Intergenic
1121526278 14:94621619-94621641 GCCAGCCCACACCTGGCTTGAGG + Intronic
1121815528 14:96925423-96925445 TCCAGGCCCCACATCCCATGAGG - Intronic
1122317835 14:100836160-100836182 GCCACGGCCCACGTGCCTTGGGG - Intergenic
1122988697 14:105226086-105226108 GCCAGGCCCCCCTTGGCCTTTGG + Exonic
1123479274 15:20616083-20616105 GCCAGGCACCGGACGGCTTGGGG - Intergenic
1123638739 15:22384302-22384324 GCCAGGCACCGGACGGCTTGGGG + Intergenic
1124888786 15:33712208-33712230 GACAGATCCCTCATGGCTTGAGG - Intronic
1125279855 15:38031890-38031912 GCCAGGCCCCCTCTGGCCTGGGG + Intergenic
1127413382 15:58731820-58731842 ACCAGGCCGCACATGTCATGGGG - Intronic
1128275325 15:66348710-66348732 GCCAGGCACAGTATGGCTTGAGG + Intronic
1128543264 15:68551356-68551378 CCCAGGCCCAACCTGGCATGAGG + Intergenic
1128983539 15:72202928-72202950 GCCAGGCCCAACCTGGCATCTGG - Intronic
1129325850 15:74799980-74800002 GCCAGGCCACACCTGGCATCCGG + Intronic
1130053384 15:80502618-80502640 CCCATGTCCCACATGGCATGGGG - Intronic
1130919091 15:88329095-88329117 GCCAGGCCCTGCAGTGCTTGAGG + Intergenic
1130933500 15:88449466-88449488 GGCAAACCCCACATGGCATGTGG + Intergenic
1131228768 15:90645860-90645882 GCCCGGGCCCACCTGGCTCGTGG + Intergenic
1131312949 15:91307194-91307216 GTCAGGCCACACCTGGCTTGGGG - Intergenic
1132573267 16:653280-653302 GCCAGGCCCCTCCTGGCTGCCGG - Intronic
1133705042 16:8346469-8346491 CCCATGCACCCCATGGCTTGTGG - Intergenic
1133976350 16:10602087-10602109 GCCAGCCCCCAGAAGGCCTGTGG - Intergenic
1134249121 16:12562014-12562036 GCCTGGCCCCTCATGGATTTAGG + Intronic
1134837610 16:17375344-17375366 GCCAGGTCCCTCTTGGCTGGGGG - Intronic
1135039764 16:19109193-19109215 TCCAGGCGCCCCTTGGCTTGTGG - Intergenic
1135393591 16:22114328-22114350 GCTATGTCCCACATGGGTTGGGG - Intronic
1136175092 16:28511221-28511243 GCCAAAACCCACCTGGCTTGTGG - Intronic
1136183272 16:28569777-28569799 GACAGCCCCCACATGCCTTCGGG - Intronic
1138203072 16:55104516-55104538 ACAAGGCCCCAAAGGGCTTGTGG + Intergenic
1139195821 16:64917604-64917626 GCCAGGTCTCACATGGCGGGAGG + Intergenic
1139661580 16:68424462-68424484 GTCAGGCCCAACATGACTTGAGG - Intronic
1141309584 16:82900395-82900417 ACCAGGCCACACTTGGCTTGTGG - Intronic
1141900544 16:86987779-86987801 TCCAGGCACCCCTTGGCTTGTGG - Intergenic
1142033581 16:87850443-87850465 GCCTGGTCCCACATGGCTGTAGG - Intronic
1148064329 17:44857724-44857746 GCCAAGCAACACATGGTTTGAGG + Intronic
1149169619 17:53793189-53793211 GCCACTCCCCACCTGGCTCGTGG + Intergenic
1149977406 17:61279804-61279826 GCCAAGCCCAACTTGGCTTGTGG - Intronic
1151091538 17:71445583-71445605 GCCAGGCTTTACATGGTTTGGGG + Intergenic
1151187662 17:72375605-72375627 GACAGGGCCCACATGGCCTGGGG + Intergenic
1152200267 17:78941447-78941469 GCCAGGCTCCAAATTGCTTATGG - Intergenic
1152582275 17:81171360-81171382 GCCAGGCTCCCCAGGCCTTGTGG + Intergenic
1156154839 18:34289107-34289129 GGCAGATCCCTCATGGCTTGGGG - Intergenic
1156786770 18:40924453-40924475 GCCAGACCCACCAGGGCTTGAGG - Intergenic
1157177659 18:45466032-45466054 GCCATGCCCCACAAGGTCTGTGG + Intronic
1160719997 19:592864-592886 GCCTGGCCCCAACTGGCTTCGGG + Intronic
1161513069 19:4682564-4682586 GGGAGGCTCCACATGGCCTGAGG + Intronic
1165070275 19:33251502-33251524 GCCAGGCCCCACACGGTGTGGGG - Intergenic
1165120792 19:33557135-33557157 GCTAGGTCCCACATGGCCTTTGG + Intergenic
1166360530 19:42251248-42251270 TCCAGGCCCCACCTGGCTGGAGG + Intronic
1167703486 19:51065054-51065076 GCCAGGGGCCACATGGCTCCGGG + Exonic
925461571 2:4067651-4067673 GCCAGCACCCACATGGCCTGTGG - Intergenic
926424067 2:12725474-12725496 GCCAGGCCTCACCTGGGCTGTGG + Intronic
928231692 2:29504293-29504315 GCCAGGTCACACAGGGCTTTAGG + Intronic
929001363 2:37350194-37350216 GCCAGGCCCCAAATGCTCTGAGG - Intronic
929420037 2:41781195-41781217 GCCAGGAACCACATGCCTTCTGG + Intergenic
929947286 2:46380869-46380891 ACTAGGCCTCACATGGCTTGAGG - Intronic
931665396 2:64606697-64606719 GCCACTCTCCACATGGCCTGAGG - Intergenic
933797336 2:85930188-85930210 GCCAGGGCCCACAGGACCTGGGG + Intergenic
933886023 2:86720086-86720108 GCGAGGCCCCAATTGGCCTGAGG - Intronic
933924157 2:87076620-87076642 GCGAGGCCCCAATTGGCCTGAGG + Intergenic
934751744 2:96798279-96798301 GCCAGGCCCATCAGGGCTTGTGG + Intronic
936660643 2:114539435-114539457 GCCAGGCCACACAGGCCTAGAGG - Intronic
937914175 2:127090747-127090769 GCCAGCACCCACCTGCCTTGGGG + Intronic
938124572 2:128662682-128662704 GCCAGGCCACGCAAGCCTTGGGG - Intergenic
945338435 2:208620100-208620122 GCAGGCCCCCACATGGCTTTAGG + Intronic
946332385 2:219017784-219017806 GCCAGGCCCTACAGGGCTCCAGG - Intronic
946339016 2:219056706-219056728 GCCAAGCCCCACCTGGCTGCCGG - Intronic
947597057 2:231419562-231419584 GCCTGACCCCACAGGTCTTGGGG - Intergenic
948572069 2:238923941-238923963 TCCAGGCCCAACATGTCTTCAGG + Intergenic
948627816 2:239279892-239279914 GACAGGCCACTCATGGTTTGTGG - Intronic
1171421531 20:25020965-25020987 GCCATGCCTAACATGGTTTGAGG + Intronic
1172147211 20:32764897-32764919 CACAGGCCCCACGTGGCTGGAGG - Intronic
1172413012 20:34740565-34740587 GCCCGGGCCCACAGGGCTAGAGG + Exonic
1174231021 20:49045807-49045829 GCCAGATCCCATATGGTTTGTGG + Intergenic
1174402020 20:50281049-50281071 TCCAGGCCACACAGGGCTTCAGG - Intergenic
1174444907 20:50584046-50584068 ATCAGGCCCCACAGGGTTTGAGG - Exonic
1175793087 20:61754493-61754515 TGCAGGCTCCACAGGGCTTGGGG + Intronic
1175860836 20:62149227-62149249 CCCAGGCCCCACAGGCCTTACGG - Intronic
1179571137 21:42279541-42279563 GCCAGGCCCCACCTGCCTTTTGG + Intronic
1180798161 22:18617835-18617857 GGCAGGCTCCACAAAGCTTGGGG - Intergenic
1180994861 22:19960523-19960545 GCCATGACCCACAGGGCTCGTGG - Intronic
1181255185 22:21558191-21558213 GGCAGGCTCCACAAAGCTTGGGG - Intronic
1181533647 22:23530963-23530985 GCCTGGGCCCACATGGGGTGAGG + Intergenic
1181643873 22:24219898-24219920 TCCAGGCCGGACATGGCTGGGGG - Exonic
1181773528 22:25143722-25143744 TCCAGGGCCCTCAGGGCTTGTGG - Intronic
1181896115 22:26109263-26109285 TCCAGGCCCCACTTAGCTTCTGG + Intergenic
1183683546 22:39349359-39349381 GCCAGGCCCCTCCAGGCTGGGGG + Intergenic
1184333626 22:43840853-43840875 GCCAGGCCCCTCGTGCCGTGGGG + Intronic
1184580481 22:45413386-45413408 TCCAGGCCACACGTGGCCTGTGG - Intronic
1184649115 22:45911607-45911629 GCCGGCCCCCACATGGCTCACGG + Intergenic
949850168 3:8412839-8412861 ACCAGGCCACACTTGCCTTGAGG + Intergenic
950139320 3:10604312-10604334 GCCAGCCTCCACATGGCAGGTGG + Intronic
953720605 3:45351539-45351561 CCCACTCCCCACATGGGTTGAGG - Intergenic
953925836 3:46982041-46982063 GCCTGGCCCCGCCTGGCTTGGGG - Intronic
954446349 3:50548954-50548976 GACTGGCCCCACATGTCTTTGGG - Intergenic
956174986 3:66464542-66464564 TGCAGGCCCCATTTGGCTTGAGG + Intronic
962348731 3:134641482-134641504 TGCAGGCCCACCATGGCTTGTGG - Intronic
967634131 3:191780708-191780730 GTAAGGCCCTACACGGCTTGAGG + Intergenic
967698813 3:192567662-192567684 GCCAGGCCTTCCTTGGCTTGTGG + Intronic
968131783 3:196196502-196196524 CCCAGGCCCCACAAGTCTTCAGG - Intergenic
970242547 4:14024599-14024621 GCCTGGCCACACATGGCATGAGG - Intergenic
971252319 4:24983736-24983758 GCCAAGTCCCTCATGGCATGAGG + Intergenic
972420124 4:38879127-38879149 GCCCGGCCCCACATGGCTGGAGG - Intronic
977940648 4:102854880-102854902 GCCATGCCCCACTTTGCTTTGGG + Intronic
980950135 4:139367225-139367247 GCCATGCCCCACTGGACTTGAGG - Intronic
984870302 4:184319132-184319154 TCCCGGCCCCACATGGATTGAGG - Intergenic
988520496 5:31941027-31941049 GCCACTCACCTCATGGCTTGTGG - Intronic
989310310 5:40009038-40009060 GCAATGTCCCACATGGCTAGGGG + Intergenic
993902557 5:93594799-93594821 GCCAGGCTCTACATGGGCTGGGG + Intergenic
995926016 5:117375507-117375529 TCCAGGCCCCACCTGACATGTGG - Intergenic
996663042 5:126026953-126026975 TCCAGGCCCCAGATGGCTCCAGG + Intergenic
997262647 5:132476434-132476456 GCCAGTCCCCACAGGGTCTGCGG - Intergenic
997283767 5:132664268-132664290 GGCAGGCAGCACATGGCTGGGGG - Intergenic
997527275 5:134561510-134561532 GCCAGGCTCCCCTTGGTTTGGGG + Intronic
998404358 5:141865562-141865584 GGCAGGACACACATGGCTTCTGG - Intronic
999241844 5:150132428-150132450 GGCAGGCCACTCATGGCCTGTGG - Intronic
1000269464 5:159669917-159669939 GCCAGGTCCAACATGGATTATGG - Intergenic
1000379107 5:160612986-160613008 GCCTGGCTTCACATGGCTTTGGG - Intronic
1001348939 5:170937221-170937243 GTCAGACCTCACATGGTTTGTGG - Intronic
1002467842 5:179416634-179416656 GCCAGGCCCCTTGTGGCGTGTGG - Intergenic
1002528993 5:179832588-179832610 GCCTGGCCCCACCTGCCGTGTGG + Intronic
1002863645 6:1102072-1102094 ACCAGGAGACACATGGCTTGGGG - Intergenic
1003744672 6:8987258-8987280 TTCAGCCCCCACATGGCGTGTGG + Intergenic
1004750214 6:18554798-18554820 CCCAGGCCACACATGGCAAGAGG - Intergenic
1004843199 6:19610806-19610828 GCCAGGCACAACATGTCCTGTGG - Intergenic
1006393111 6:33770536-33770558 GCCATGCCCCATGGGGCTTGTGG - Intergenic
1007733560 6:43966315-43966337 GCCAGAGCCTACATGGCCTGGGG - Intergenic
1013184509 6:107746194-107746216 GCCAGGTCACACAGGGCCTGTGG + Intronic
1014941848 6:127450046-127450068 GCCAGGCCTCACATTCCTTTTGG + Exonic
1015189539 6:130457788-130457810 GCCTGGCACCACAGGGATTGGGG - Intergenic
1016950707 6:149577058-149577080 GGCAGATCCCTCATGGCTTGGGG - Intronic
1017747855 6:157462776-157462798 GCCAGGCCCTCCAGGGCTGGGGG - Intronic
1018959095 6:168434036-168434058 GCCAGGCCCTGCATGGCTGGAGG - Intergenic
1019308520 7:347711-347733 GGGAGGCCCCTCAGGGCTTGTGG - Intergenic
1019565991 7:1679371-1679393 GCCAGGCACCCCCAGGCTTGGGG - Intergenic
1019710604 7:2516620-2516642 GCCAGGACCCACATGACCAGGGG - Intronic
1019780490 7:2936987-2937009 ACCAGGGCCCACCTGGCTTCAGG + Intronic
1020025680 7:4898259-4898281 ACCTGTCCCCACATGGCCTGGGG + Intergenic
1020117012 7:5481642-5481664 GCCACGCCCCACCTGGCTCCTGG - Exonic
1022330675 7:29375856-29375878 GTCAGGCCCCACAAGTTTTGGGG + Intronic
1022975347 7:35550974-35550996 GCCAGGCTACAGATGGCTTGGGG + Intergenic
1023377483 7:39572613-39572635 CCCAAGCCCCACATGGATTTTGG + Exonic
1023453476 7:40313036-40313058 GCAAAGCCCCAAAAGGCTTGAGG - Intronic
1024042736 7:45567785-45567807 CTCAGGCCCCATATGGCATGAGG - Intergenic
1025176285 7:56804047-56804069 TCCAGGCCCCAAATGGCCTCCGG + Intergenic
1025178206 7:56812436-56812458 TCCAGGCCCCAAATGGCCTCGGG - Intergenic
1025179076 7:56815968-56815990 TCCAGGCCCCAAATGGCCTCGGG - Intergenic
1025179531 7:56817854-56817876 TCCAGGCCCCAAATGGCCTCGGG - Intergenic
1025179981 7:56819692-56819714 TCCAGGCCCCAAATGGCCTCGGG - Intergenic
1025180455 7:56821674-56821696 TCCAGGCCCCAAATGGCCTCGGG - Intergenic
1025180900 7:56823523-56823545 TCCAGGCCCCAAATGGCCTCGGG - Exonic
1025181772 7:56827101-56827123 TCCAGGCCCCAAATGGCCTCGGG - Intronic
1025638205 7:63343088-63343110 AGCAGGCACCACATGGCTTCGGG - Intergenic
1025644491 7:63405001-63405023 AGCAGGCACCACATGGCTTCGGG + Intergenic
1025695507 7:63772375-63772397 TCCAGGCCCCAAATGGCCTCTGG - Intergenic
1030114097 7:106050169-106050191 GCCAGGCCCCAGCTGGCTCATGG - Intergenic
1030708940 7:112726361-112726383 GAGTGGCCCCACATGGCATGTGG + Intergenic
1031974453 7:128084996-128085018 GCAAGGCCCCAGATGGGCTGTGG - Intronic
1032053131 7:128662303-128662325 CCCAGGCTGCACATAGCTTGGGG - Intergenic
1032071619 7:128811291-128811313 GCCAGGCCCAACATGCCCAGAGG + Intronic
1032163347 7:129527091-129527113 GCCAGGCCACTCAGGACTTGTGG - Intergenic
1035476605 7:159148641-159148663 GCCAGGCCCAGCATGGCAGGTGG - Intergenic
1035528413 8:332788-332810 TCCAGGCCTCCCCTGGCTTGTGG - Intergenic
1035579396 8:730888-730910 GCCAGGCCCCACCTGGTGTCTGG - Intronic
1036202381 8:6780237-6780259 GCCAGGCCCCATCAGGCTGGAGG + Intergenic
1042028026 8:64444530-64444552 TCCAGGCATCACTTGGCTTGTGG + Intergenic
1042778895 8:72468090-72468112 GTCAGGCCCCATAGGTCTTGTGG + Intergenic
1044179800 8:89177624-89177646 CCCAGGCCTCACATTGCTTTTGG - Intergenic
1048744470 8:137599002-137599024 GCCAGTCCCCTCCTGGCCTGTGG + Intergenic
1049469587 8:142769387-142769409 GCCAGGCCCAAGAGGGCTGGAGG + Intronic
1049610345 8:143552369-143552391 GGCATGCCCCACCTGGCTTCTGG - Intergenic
1049751852 8:144288682-144288704 GCCTGACCCCACAGGGCTTCAGG - Intronic
1052903937 9:33817595-33817617 ACCAGGCCCCACACGGCCCGTGG - Exonic
1053169384 9:35867977-35867999 TCCAGGCCTCACCTGGCTTGAGG - Intergenic
1061338813 9:129962213-129962235 CCCAGGCCTCACAGGGCTGGAGG - Intronic
1062174508 9:135153493-135153515 GCCGGGCCCCACCTTGCTCGAGG - Intergenic
1062342381 9:136099548-136099570 GCCTGGCCTCAGAGGGCTTGTGG + Intergenic
1186744165 X:12548802-12548824 GTCAGGCCACACATGGGTTGGGG + Intronic
1186978122 X:14930191-14930213 GCCAACCCACACATAGCTTGGGG + Intergenic
1189239840 X:39516648-39516670 GCCAAGCCCCACATGGCAGCTGG + Intergenic
1189286874 X:39858001-39858023 GCCTGGCCCCAGAGGGGTTGTGG - Intergenic
1190463193 X:50699262-50699284 TCCAGGCACCACCTGGCTTTTGG - Intronic
1194100264 X:89694477-89694499 TCCTGGCCCCAAATGGCTTCTGG - Intergenic
1196866607 X:120076764-120076786 ACCAGGCCCCAGATGGGTTTTGG + Intronic
1196876492 X:120159517-120159539 ACCAGGCCCCAGATGGGTTTTGG - Intronic
1197068640 X:122266660-122266682 GCCAGACACCTCATGGCTTGGGG - Intergenic
1197709282 X:129654387-129654409 GCCAGCCGCCCCATGGCTCGGGG + Intronic
1197722620 X:129755490-129755512 CCCAGCCCCCACAGGGCTAGGGG - Intronic
1199093326 X:143715104-143715126 TCCAGGCCCCACCTGTCTTCAGG - Intronic
1199672577 X:150159410-150159432 ATCAGACCCCTCATGGCTTGAGG + Intergenic
1200453264 Y:3355836-3355858 TCCTGGCCCCAAATGGCTTCTGG - Intergenic