ID: 1079112337

View in Genome Browser
Species Human (GRCh38)
Location 11:17611997-17612019
Sequence AGGCCCCACATGGCTTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 168}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079112329_1079112337 5 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112337 11:17611997-17612019 AGGCCCCACATGGCTTGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 168
1079112331_1079112337 3 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112337 11:17611997-17612019 AGGCCCCACATGGCTTGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 168
1079112330_1079112337 4 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112337 11:17611997-17612019 AGGCCCCACATGGCTTGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 168
1079112332_1079112337 2 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112337 11:17611997-17612019 AGGCCCCACATGGCTTGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 168
1079112328_1079112337 10 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112337 11:17611997-17612019 AGGCCCCACATGGCTTGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 168
1079112327_1079112337 11 Left 1079112327 11:17611963-17611985 CCCTGACCCCCGAGCTCACACTA 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1079112337 11:17611997-17612019 AGGCCCCACATGGCTTGTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079112337 Original CRISPR AGGCCCCACATGGCTTGTGG TGG Intronic
900346808 1:2214106-2214128 AGACCTCCCTTGGCTTGTGGTGG + Intergenic
900548787 1:3243292-3243314 ATGTCCCCCATGGCTTTTGGAGG - Intronic
900692134 1:3987332-3987354 AGGCACCCCAGGGATTGTGGTGG - Intergenic
901107211 1:6765822-6765844 ACGCCCCACATGGCTGGAGCAGG - Intergenic
901318443 1:8324382-8324404 TGGCCCCACAGGACTTCTGGAGG + Exonic
903135377 1:21306036-21306058 AGGCCCCATATGGCTGGATGTGG - Intronic
903451398 1:23456013-23456035 ATTCTCCACATGGCCTGTGGAGG + Exonic
903588206 1:24433360-24433382 AGGCCACAAATGGGTTGAGGGGG + Intronic
903753684 1:25646202-25646224 GGTCCCCGCAGGGCTTGTGGTGG + Intronic
916575182 1:166060453-166060475 AAGTGCCACATGGCTCGTGGAGG + Intronic
916811226 1:168307369-168307391 AGGCATCACATGGATGGTGGGGG + Intronic
916925827 1:169519739-169519761 AGGCCCCACTTGGCTGCTGAAGG - Intronic
917921653 1:179755701-179755723 AGGCCCTACCTGTTTTGTGGTGG - Intronic
919191793 1:194230517-194230539 AGGCCCTCCCTGGCTTGAGGTGG + Intergenic
920060420 1:203223418-203223440 AGCCCCCACATGTGCTGTGGGGG + Intronic
920676370 1:208041215-208041237 AGGCCCCACGTGGGGTGAGGAGG - Intronic
920920574 1:210294382-210294404 AGGGCCCACAGTGCTTTTGGGGG - Intergenic
923262836 1:232283827-232283849 AGGGCCCACAGGCATTGTGGAGG + Intergenic
924702885 1:246472127-246472149 AGGCCCCTTGTGGCTTGTGCTGG - Intronic
1069709726 10:70480506-70480528 AGGGCCCAGGTGGCTTGAGGTGG + Intronic
1069848617 10:71390597-71390619 CGGCCCAGCTTGGCTTGTGGAGG - Intergenic
1070656270 10:78273783-78273805 AGGGGTCACAGGGCTTGTGGAGG - Intergenic
1073006784 10:100330644-100330666 AGGGCCGACATGGATTGGGGTGG + Intergenic
1074911865 10:117918131-117918153 CAGTTCCACATGGCTTGTGGAGG - Intergenic
1075067779 10:119301242-119301264 AGGCCCCATCTACCTTGTGGTGG + Intronic
1075682111 10:124340559-124340581 ATCCCCCAGATGGCTGGTGGGGG - Intergenic
1075923632 10:126233495-126233517 AGGGCCCACATGGTTTGGGTGGG + Intronic
1076540728 10:131213142-131213164 AGGCCCCACATAGCCTCTGGGGG - Intronic
1076606694 10:131694247-131694269 AGGCACCACCTGGCCTTTGGAGG + Intergenic
1076807506 10:132866439-132866461 AGGCTCTACGTGGCTAGTGGTGG - Intronic
1077162641 11:1120751-1120773 AGGCCCCTCTTGGCTTCTGCTGG + Intergenic
1077186954 11:1239692-1239714 AGGCCCCTGCTGGCTGGTGGGGG + Intronic
1077239385 11:1502680-1502702 TGGCCCCACCTGGGCTGTGGGGG - Intergenic
1077895272 11:6448997-6449019 AGGCCCTGCCTGGCTTGTGGAGG - Exonic
1077916630 11:6615821-6615843 AGGCCCCAAATCTCTTGTGTGGG - Intronic
1077919627 11:6632656-6632678 AAGCCGTACATGGCCTGTGGTGG + Exonic
1079112337 11:17611997-17612019 AGGCCCCACATGGCTTGTGGTGG + Intronic
1079120889 11:17684137-17684159 AGGCATCGCATGGTTTGTGGGGG - Intergenic
1080230282 11:30012468-30012490 AGGCCCCGCGTGACTGGTGGTGG + Exonic
1083625884 11:64071770-64071792 AGGCCCCACAGGCCCTGAGGAGG - Intronic
1085284447 11:75350829-75350851 AGGCCCCACATGGCCAGAAGTGG - Intronic
1085644413 11:78213843-78213865 AGGCCCTACCTGGCTCCTGGAGG - Exonic
1085762582 11:79255036-79255058 GGGTCCCACTGGGCTTGTGGGGG + Intronic
1087119707 11:94560546-94560568 AGGGCCCACAGTGCTTTTGGGGG + Intronic
1087423810 11:97965502-97965524 GGGCCCCAAATGGGTTTTGGGGG + Intergenic
1090908280 11:131096327-131096349 AGACACCTCATGGCCTGTGGCGG - Intergenic
1091238206 11:134035526-134035548 AGGCCTCACAAGGCATGTGAAGG + Intergenic
1091389663 12:118291-118313 AGGTCCCAGATGGCATGAGGGGG - Intronic
1091601661 12:1921592-1921614 AGGCCCCACCTGGCTGGAGCTGG + Intergenic
1091601673 12:1921686-1921708 AGGCCCCACCTGGCTGGAGCTGG + Intergenic
1091601685 12:1921780-1921802 AGGCCCCACCTGGCTGGAGCTGG + Intergenic
1091601697 12:1921874-1921896 AGGCCCCACCTGGCTGGAGCTGG + Intergenic
1091601709 12:1921968-1921990 AGGCCCCACCTGGCTGGAGCTGG + Intergenic
1091601721 12:1922062-1922084 AGGCCCCACCTGGCTGGAGCTGG + Intergenic
1101127576 12:101653216-101653238 CGGCTCCACATGGCTTTAGGAGG - Exonic
1101736536 12:107467390-107467412 AGGCCACACCAGGCTTGTGGGGG - Intronic
1105020960 12:132816673-132816695 AGGGCCCACTGGGCTTGTGGTGG + Exonic
1111322821 13:86651883-86651905 AGTTCCCACATGGCTTGGAGAGG + Intergenic
1113135463 13:107083989-107084011 AGGTACCACATGGGTTCTGGTGG + Intergenic
1118005688 14:61562634-61562656 AGGCACCACAGGGCCCGTGGAGG - Intronic
1122263245 14:100535020-100535042 AGGGTCCACATGGCTTGCAGCGG - Intergenic
1122270492 14:100566763-100566785 AGGACCAACATGTCTTGTGCTGG - Intronic
1122425496 14:101603067-101603089 AGGCCACACATGGCCCCTGGAGG + Intergenic
1122570012 14:102690860-102690882 AGTCCCCTCTTGGCATGTGGTGG + Intronic
1124150674 15:27175202-27175224 AGGCTCCACATTGCAGGTGGAGG - Intronic
1124361026 15:29036527-29036549 AGGCCCCATATCGCTTGCTGGGG - Intronic
1124436944 15:29658113-29658135 AATCCCCACATGTCTTGGGGGGG + Intergenic
1124710476 15:32006026-32006048 CCCCCTCACATGGCTTGTGGAGG - Intergenic
1125889174 15:43252979-43253001 AGCCCACACATGGCATGTTGAGG - Intronic
1127413380 15:58731817-58731839 AGGCCGCACATGTCATGGGGTGG - Intronic
1128355540 15:66923896-66923918 AGGCCCCGTAGGGCATGTGGAGG + Intergenic
1130933648 15:88450442-88450464 AGTCCCCACCAGGATTGTGGAGG + Intergenic
1132418918 15:101647522-101647544 AAGCACCACATGGTGTGTGGAGG + Intronic
1137290543 16:47049348-47049370 AGGCCCCACATGGCTGGCTCGGG - Intergenic
1137705961 16:50535992-50536014 GGGCTCCAGCTGGCTTGTGGAGG + Intergenic
1138203073 16:55104519-55104541 AGGCCCCAAAGGGCTTGTGGAGG + Intergenic
1139482146 16:67236646-67236668 AGGGCCCACAGGGCTGGAGGCGG + Exonic
1141961915 16:87414445-87414467 GGGCCCGACGTGGCTGGTGGGGG + Exonic
1142175866 16:88645024-88645046 TGGGGCCACATGGCTGGTGGTGG + Intronic
1145722089 17:27082932-27082954 AGGACACAAAGGGCTTGTGGTGG + Intergenic
1145829815 17:27906936-27906958 GGGCCCCTCCTGGCTTGGGGAGG + Intergenic
1146300478 17:31685400-31685422 AAGACCCCCATGCCTTGTGGTGG - Intergenic
1147339321 17:39744473-39744495 TCTCCCCACCTGGCTTGTGGGGG + Intronic
1147402992 17:40192097-40192119 AGGGCCTGCATGGCTTGTAGGGG - Intronic
1148770498 17:50063404-50063426 AGTCTCCACATGGCTTCAGGAGG + Intronic
1148905248 17:50907837-50907859 AGGGCCCTCATGGCTCATGGTGG + Intergenic
1150602020 17:66659380-66659402 AGTCTCCTCATGGCTGGTGGAGG - Intronic
1151618323 17:75229317-75229339 AGGCCCCATCTTGCTTGTTGGGG - Intronic
1156061383 18:33080500-33080522 CAGCCCCACATTGCTTGTAGGGG - Intronic
1158511948 18:58098314-58098336 AGGCCCCACATTGCCTGATGAGG + Intronic
1160854797 19:1211942-1211964 AGGCCTCACATGGCTGGCGCAGG - Intronic
1160932988 19:1579364-1579386 AGGCCCCCCATCCCTGGTGGTGG - Intronic
1160951058 19:1667613-1667635 AGGCCCCAGATGGATGCTGGAGG - Intergenic
1161982599 19:7637615-7637637 AGGCCCCACAGGGGTGGTGTAGG + Intronic
1163143955 19:15368530-15368552 ACTCCCCACATGGCCTGAGGCGG + Intronic
1163413076 19:17169016-17169038 AGAGCCCACCTGGCTTGTAGCGG - Intronic
1166303343 19:41924044-41924066 TGGCCCCAAACAGCTTGTGGGGG + Intronic
925189577 2:1871936-1871958 AAGCGCCACATGGATTCTGGAGG + Intronic
926424069 2:12725477-12725499 AGGCCTCACCTGGGCTGTGGAGG + Intronic
931709799 2:64978637-64978659 ATGCTCCACATTGCATGTGGTGG + Intergenic
932749283 2:74361243-74361265 AGGGGCCTCAGGGCTTGTGGGGG - Exonic
932801793 2:74747759-74747781 GGGCCCCACCAGGCTGGTGGAGG - Intergenic
933641184 2:84762032-84762054 AGGCTCCATATGGGTTGGGGAGG + Intronic
933991530 2:87637578-87637600 AGACCCCCCACGGCTTTTGGGGG - Intergenic
937153533 2:119702336-119702358 AGGCCCCACATTCCTGATGGTGG - Intergenic
937249900 2:120516926-120516948 AGGCTCCACTGGGCTTGTGGAGG - Intergenic
937332282 2:121039020-121039042 AGGCCCCACCTGGCCTCTGCTGG + Intergenic
947714311 2:232332134-232332156 TGGCCCCTCTTGGCTGGTGGAGG - Intronic
947733519 2:232443513-232443535 TGGCCCCTCTTGGCTGGTGGAGG - Intergenic
949020842 2:241740500-241740522 AGGTCCCACATGGGAGGTGGTGG - Intronic
1169906736 20:10612159-10612181 CAGCCCCACATGGTTTGTGAAGG + Intronic
1171202574 20:23254181-23254203 AGCCCCCACATGGCGTGGGAGGG - Intergenic
1172138470 20:32704582-32704604 TGCCCCCACATGGCTTCTGCTGG - Intronic
1172395020 20:34596329-34596351 AGGTCCCACATTGCATTTGGTGG - Intronic
1176058844 20:63163169-63163191 AAGCCCCACCTGGCCTGTGAGGG + Intergenic
1177271876 21:18858981-18859003 AGGCCCCACATGCATTATGGAGG - Intergenic
1179540099 21:42078481-42078503 TGGCCCCACCTGGCTTCTGTTGG - Intronic
1179786988 21:43735647-43735669 AGGCCCCCCATGGCATCTGGAGG - Intronic
1179983913 21:44910772-44910794 AGGCCCAGCATGTCCTGTGGAGG + Exonic
1181896117 22:26109266-26109288 AGGCCCCACTTAGCTTCTGGTGG + Intergenic
1184767201 22:46577921-46577943 AGGCCCCACATGTCTAGAGCAGG + Intronic
1185008368 22:48299223-48299245 AGGCTCCACCTGGCCAGTGGCGG + Intergenic
1185373008 22:50469540-50469562 AGGCCTCCCAGGGCTTGTGGAGG + Intronic
950569110 3:13789017-13789039 AGGCCCCACAGGGCTGGGGCAGG + Intergenic
955352812 3:58206548-58206570 AGGCCCATCCTGGCTTGTGGGGG + Intronic
956023702 3:64959524-64959546 ATGCCATACATGGCTTGTGTTGG + Intergenic
956209403 3:66787754-66787776 AGGCCCTACATGGTTTGTTCTGG - Intergenic
956316527 3:67943788-67943810 AGAGCCCACATGGCTTCTGGAGG + Intergenic
958447488 3:94233335-94233357 AGGTACCAAATGGCTTGTGGAGG + Intergenic
960948175 3:122981268-122981290 AGGCCCCTCGGGGCTTGTGTTGG + Intronic
961313092 3:126016286-126016308 TGGCCACACATGGCTACTGGTGG - Intronic
962850376 3:139303952-139303974 AGGCCCAACGTGGCTAATGGAGG + Intronic
963727426 3:148937847-148937869 AGGTCCCGCATGCCTTCTGGTGG - Intergenic
966861102 3:184231138-184231160 AGGCAGCACAGGGCTTGCGGGGG + Intronic
968742324 4:2337520-2337542 AGGCCGCACCTGGGCTGTGGCGG + Intronic
970242545 4:14024596-14024618 TGGCCACACATGGCATGAGGTGG - Intergenic
972050276 4:34723061-34723083 AGGAACCACATGGCTTGTGAGGG - Intergenic
972056872 4:34814873-34814895 TGGCCCCAAATGGCTCCTGGGGG + Intergenic
972739004 4:41873540-41873562 AAGCCCCAAATGGCCGGTGGCGG - Intergenic
974637416 4:64582775-64582797 AGGCCCCACCTGCTTTGGGGTGG + Intergenic
977465950 4:97383055-97383077 AGGCACAACATGGATTTTGGAGG + Intronic
981084901 4:140673479-140673501 AGACCCCACATGGATGGTGGGGG + Intronic
982004356 4:151049750-151049772 AGGCCCCATATGGCCCCTGGGGG - Intergenic
986300343 5:6473545-6473567 AGGACCCACATGGCTATTTGTGG + Intronic
987074703 5:14369961-14369983 GAGCGCCACACGGCTTGTGGTGG + Intronic
995278940 5:110310449-110310471 AATCCCCACATGTCTTGTCGAGG + Intronic
995639826 5:114242895-114242917 AGGCCCAACATGCCTTGTTTGGG + Intergenic
997077701 5:130700076-130700098 AAGCCCAATATGGCTTTTGGTGG + Intergenic
1011612291 6:89164964-89164986 ATGCCCCAGAAAGCTTGTGGTGG + Exonic
1018679713 6:166253606-166253628 GGGCCCCACCTGCCTTGTGACGG + Intergenic
1019539624 7:1545851-1545873 GGGCCCCACCTGGCACGTGGAGG + Exonic
1019615173 7:1956187-1956209 AGGCCTCACAGGCCCTGTGGTGG - Intronic
1020956860 7:14750597-14750619 ATGCCCCACATTGCTACTGGAGG + Intronic
1021920488 7:25480241-25480263 AGGCCCCATTTGGGTTCTGGGGG + Intergenic
1022975349 7:35550977-35550999 AGGCTACAGATGGCTTGGGGAGG + Intergenic
1024016957 7:45325767-45325789 GGTCCCCACGTGGCTTTTGGTGG + Intergenic
1025901659 7:65750087-65750109 AGGCACCAAAGGGCATGTGGTGG - Intergenic
1026930349 7:74220128-74220150 AGGCCCCACAAGGGGTATGGGGG + Intronic
1031122860 7:117741096-117741118 AGCCCCCAGATGCCTTGTGGAGG + Intronic
1032013181 7:128359991-128360013 TGGCCCCACCTGGCTTCGGGTGG + Exonic
1032390781 7:131554266-131554288 AGGCCAGAAAAGGCTTGTGGGGG - Intronic
1032477624 7:132223252-132223274 AGGACCCACCTGGTGTGTGGAGG + Intronic
1032894682 7:136237232-136237254 AGCCCCCAAATTGCCTGTGGTGG - Intergenic
1034672402 7:152868649-152868671 GGGCCCCTCCTGGCTTCTGGTGG + Intergenic
1037831457 8:22192113-22192135 AGGTCCGAGATGGCTTCTGGAGG + Exonic
1038642521 8:29339493-29339515 AGGTCCCCCAGGGCTTCTGGAGG + Intronic
1040320298 8:46290999-46291021 AGTCCCGTCATTGCTTGTGGAGG + Intergenic
1040323375 8:46329415-46329437 AGGGCCCGCATGGGTTGTGGTGG - Intergenic
1044208312 8:89518626-89518648 AGAACCCATATGTCTTGTGGAGG - Intergenic
1048900833 8:139036335-139036357 AAGCCGCACAGGGCTGGTGGAGG - Intergenic
1049083809 8:140462469-140462491 ATGCCCCACAAGGCTTGCTGAGG + Intergenic
1049522595 8:143101905-143101927 AGGCACCACCAGGCTTGTGCCGG + Intergenic
1051548589 9:18304301-18304323 AGGCCCCTCAGGGCATGTTGAGG - Intergenic
1055309521 9:74964386-74964408 AGGGCCCACAAGGATTGAGGGGG - Intergenic
1057887773 9:98844021-98844043 ATGCCACACAAGGCTTGGGGAGG - Intronic
1059451977 9:114376409-114376431 AGGCCCCTGTTGGCTTGGGGTGG - Intronic
1060931800 9:127493953-127493975 AGGCACCACTTGGCTTGTTCAGG - Intronic
1061755955 9:132812724-132812746 TGGTGCCACATGGCTGGTGGGGG + Intronic
1062173383 9:135147741-135147763 AGGCTCCACATGGCAGGCGGCGG + Intergenic
1062686635 9:137817021-137817043 AGGCCCCTCAGGGCTGGGGGAGG - Intronic
1185609247 X:1384791-1384813 AGGACCCACAGGGCTGATGGTGG + Intergenic
1186093060 X:6070717-6070739 AGGCCCCCCATGCCATGCGGAGG - Intronic
1195750156 X:108156389-108156411 GGGCCCCACATGGCTTAGAGAGG - Exonic
1196403253 X:115337974-115337996 AGGAGACACATGGCTTGTGTGGG + Intergenic
1197068638 X:122266657-122266679 AGACACCTCATGGCTTGGGGTGG - Intergenic
1198716669 X:139564996-139565018 AGGCCCCACATGTTTAGTGGTGG - Intergenic
1200885533 Y:8264714-8264736 AGGCCTCAGATGTCTTATGGTGG - Intergenic