ID: 1079112338

View in Genome Browser
Species Human (GRCh38)
Location 11:17611998-17612020
Sequence GGCCCCACATGGCTTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 151}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079112328_1079112338 11 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112338 11:17611998-17612020 GGCCCCACATGGCTTGTGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 151
1079112330_1079112338 5 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112338 11:17611998-17612020 GGCCCCACATGGCTTGTGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 151
1079112329_1079112338 6 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112338 11:17611998-17612020 GGCCCCACATGGCTTGTGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 151
1079112327_1079112338 12 Left 1079112327 11:17611963-17611985 CCCTGACCCCCGAGCTCACACTA 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1079112338 11:17611998-17612020 GGCCCCACATGGCTTGTGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 151
1079112332_1079112338 3 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112338 11:17611998-17612020 GGCCCCACATGGCTTGTGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 151
1079112331_1079112338 4 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112338 11:17611998-17612020 GGCCCCACATGGCTTGTGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079112338 Original CRISPR GGCCCCACATGGCTTGTGGT GGG Intronic
900013710 1:135594-135616 GGCCCCAAATGGCCTCCGGTCGG - Intergenic
900043780 1:491577-491599 GGCCCCAAATGGCCTCCGGTCGG - Intergenic
900065217 1:726580-726602 GGCCCCAAATGGCCTCCGGTCGG - Intergenic
900098955 1:952839-952861 GGCCACCCATGGCTTGGGGACGG + Intronic
900692133 1:3987331-3987353 GGCACCCCAGGGATTGTGGTGGG - Intergenic
900885201 1:5410140-5410162 AGCCCCACATGCCCTGTGATAGG - Intergenic
901005918 1:6171444-6171466 CTCCCCAGATGGCTTCTGGTGGG + Intronic
904312592 1:29638723-29638745 TGCTCCACATGGTTTGTGGGTGG + Intergenic
906149831 1:43581254-43581276 ATCCCCACATGCCTTTTGGTAGG + Intronic
907282975 1:53362900-53362922 GGCCCTAGATGGCTTTTGTTGGG - Intergenic
910678505 1:89839380-89839402 GGCCCTACCTGCCTGGTGGTTGG + Intronic
917695381 1:177517611-177517633 GGCAGCACCTGGCTTGTGGTAGG - Intergenic
919191794 1:194230518-194230540 GGCCCTCCCTGGCTTGAGGTGGG + Intergenic
920513792 1:206569285-206569307 GGCCCCAAATAGGTTATGGTTGG + Intronic
922767493 1:228163469-228163491 GGCCTCACAGGGCTTGGGGCAGG + Intergenic
924787640 1:247213236-247213258 GGTCCCACAGGGCTTGTGACTGG + Intergenic
1066212125 10:33250866-33250888 GGCCCCACCTGGCTAGAGGGAGG - Intronic
1066733170 10:38451338-38451360 GGCCCCAAATGGCCTCCGGTCGG + Intergenic
1068302883 10:55168237-55168259 GGCCACACTGGGCTTGGGGTCGG - Intronic
1069709727 10:70480507-70480529 GGGCCCAGGTGGCTTGAGGTGGG + Intronic
1070664649 10:78334436-78334458 GGCCTCTCCTGGCTTCTGGTGGG - Intergenic
1072871235 10:99123534-99123556 GCCCCCACTTGCCTTGTTGTGGG - Intronic
1073006785 10:100330645-100330667 GGGCCGACATGGATTGGGGTGGG + Intergenic
1073433558 10:103502430-103502452 GGCCTCACATGGCCTGTCCTTGG + Intronic
1076215586 10:128691001-128691023 GGCCACACATGGCTCGTGGGCGG + Intergenic
1076796628 10:132801541-132801563 GGCCCCACGTGGCAGGTGGCTGG + Intergenic
1076807505 10:132866438-132866460 GGCTCTACGTGGCTAGTGGTGGG - Intronic
1076970054 11:127808-127830 GGCCCCAAATGGCCTCCGGTCGG - Intergenic
1077069148 11:659942-659964 GGCCCCACCTGCCCTGTGTTGGG - Intronic
1077080083 11:721228-721250 GGCTCCACAGGGCTCGTTGTGGG + Intronic
1077895271 11:6448996-6449018 GGCCCTGCCTGGCTTGTGGAGGG - Exonic
1077919628 11:6632657-6632679 AGCCGTACATGGCCTGTGGTGGG + Exonic
1078662536 11:13298987-13299009 GCCCCCAGCTGGCATGTGGTAGG + Intronic
1079112338 11:17611998-17612020 GGCCCCACATGGCTTGTGGTGGG + Intronic
1084461367 11:69298415-69298437 GGCCCCAGATGGGGTGTGGGTGG + Intronic
1084538260 11:69770943-69770965 AGCCTCACATGGCTGGGGGTTGG - Intergenic
1084649372 11:70479649-70479671 GGTCCCCCATGGCTTCTGTTAGG - Intronic
1087423811 11:97965503-97965525 GGCCCCAAATGGGTTTTGGGGGG + Intergenic
1090355429 11:126137399-126137421 AGCCCCACAAGGCTTGATGTGGG + Intergenic
1097079311 12:56418179-56418201 GGGCCCTCAGGGCTTGTGCTCGG + Exonic
1097547557 12:61023492-61023514 GGCCCCACATTCCATGTGGCTGG + Intergenic
1099401751 12:82209828-82209850 GGCCGCACCTGGCTTGTGCATGG - Intergenic
1099581150 12:84448628-84448650 TGCCCCACATGGGAAGTGGTAGG + Intergenic
1101510369 12:105387671-105387693 GGCCCCACACTGCTGGTGGCTGG - Intronic
1104431181 12:128717634-128717656 GCCCCTACGTGGCTTTTGGTGGG - Intergenic
1105020961 12:132816674-132816696 GGGCCCACTGGGCTTGTGGTGGG + Exonic
1105707125 13:22974881-22974903 GACACCACATGGCATTTGGTTGG + Intergenic
1114352122 14:21864271-21864293 GGGCACACATGTCTTTTGGTAGG + Intergenic
1117687029 14:58263974-58263996 GGCCCCATGTGGCCTGTGGCTGG + Intronic
1121656947 14:95604175-95604197 TCCCTCACATGGCTTCTGGTAGG - Intergenic
1122270491 14:100566762-100566784 GGACCAACATGTCTTGTGCTGGG - Intronic
1122570013 14:102690861-102690883 GTCCCCTCTTGGCATGTGGTGGG + Intronic
1123111019 14:105866894-105866916 GGCCCCTCGTGGCTGGAGGTGGG - Intergenic
1127413379 15:58731816-58731838 GGCCGCACATGTCATGGGGTGGG - Intronic
1127438241 15:58979518-58979540 GCCCACACATGCCTGGTGGTAGG - Intronic
1128069138 15:64783135-64783157 GGCTCCACATGGAATGAGGTGGG + Intergenic
1129868773 15:78927986-78928008 GGGCACACATGGTGTGTGGTGGG + Intronic
1132156556 15:99499837-99499859 TCACCCACATGGCTTGTGGCAGG - Intergenic
1132815187 16:1822449-1822471 GGCCCCTCATGGCGTGTCCTGGG - Intronic
1132854104 16:2037165-2037187 GGCCCCACGTGGCTTGTGTGTGG - Intronic
1133773622 16:8882173-8882195 GGCCCCACATGGTGGGTGGGTGG - Intergenic
1135106367 16:19653408-19653430 GGCCCCATGTGGCTTCTGGGAGG - Intronic
1136571539 16:31100568-31100590 GGCCCAACATGGCTTGACATGGG + Intergenic
1138203074 16:55104520-55104542 GGCCCCAAAGGGCTTGTGGAGGG + Intergenic
1139196433 16:64924146-64924168 GGTCCCAGATGGCTAGGGGTGGG - Intergenic
1140044614 16:71432265-71432287 GGCCCCACAGGGCTCCTGGAAGG - Intergenic
1141424803 16:83937952-83937974 TGCCCCCCAAGGCTGGTGGTTGG + Intronic
1141930158 16:87196828-87196850 GGCCCCTCCTCCCTTGTGGTGGG + Intronic
1141961916 16:87414446-87414468 GGCCCGACGTGGCTGGTGGGGGG + Exonic
1142175867 16:88645025-88645047 GGGGCCACATGGCTGGTGGTGGG + Intronic
1142456939 17:62367-62389 GGCCCCAAATGGCCTCCGGTCGG - Intergenic
1144648161 17:16989378-16989400 GGCCACACCTGCTTTGTGGTGGG - Intergenic
1145030007 17:19497357-19497379 GGACCTACAGGGCTTATGGTCGG + Intronic
1145829816 17:27906937-27906959 GGCCCCTCCTGGCTTGGGGAGGG + Intergenic
1146300477 17:31685399-31685421 AGACCCCCATGCCTTGTGGTGGG - Intergenic
1147339322 17:39744474-39744496 CTCCCCACCTGGCTTGTGGGGGG + Intronic
1148079371 17:44959517-44959539 AGGCCCACTTGGGTTGTGGTGGG + Intergenic
1148460280 17:47835801-47835823 GGCCCCACAGGGGATGTGTTTGG - Intronic
1148905249 17:50907838-50907860 GGGCCCTCATGGCTCATGGTGGG + Intergenic
1152805130 17:82352114-82352136 ACCCCCACATGGCTTGGGGCAGG - Intergenic
1156061382 18:33080499-33080521 AGCCCCACATTGCTTGTAGGGGG - Intronic
1156258933 18:35426667-35426689 GGCCTCACAAACCTTGTGGTGGG - Intergenic
1158220001 18:55140640-55140662 GGCTAGACATGGGTTGTGGTTGG - Intergenic
1160503622 18:79415039-79415061 GGACGCACATGGCCTGTGGCAGG - Intronic
1160527631 18:79546808-79546830 GGGCCCACATGTCTTCTGTTTGG + Intergenic
1160646852 19:197726-197748 GGCCCCAAATGGCCTCCGGTCGG - Intergenic
1160758963 19:773023-773045 GGCCTCATTTGGCTTGGGGTTGG - Intergenic
1160862944 19:1245314-1245336 GGCCCCAGATGGAGTGGGGTGGG + Intergenic
1160911630 19:1476576-1476598 AGCCACACATGGCTGGTGGCTGG - Intronic
1160932987 19:1579363-1579385 GGCCCCCCATCCCTGGTGGTGGG - Intronic
1161701820 19:5800035-5800057 GGACCCACAAGGCCTGTGGGTGG - Intergenic
1165100693 19:33436842-33436864 GGCATCACATGGCTGGTGCTCGG - Intronic
929924349 2:46196461-46196483 GGCCCCACATGCCTTGACTTTGG - Intergenic
932901808 2:75710469-75710491 GACTCAGCATGGCTTGTGGTCGG + Intronic
934897595 2:98132299-98132321 GACACCCCATGGCTTCTGGTTGG + Intronic
936615427 2:114043188-114043210 GGCCCCAGATGGCTGGTGCCAGG - Intergenic
937153532 2:119702335-119702357 GGCCCCACATTCCTGATGGTGGG - Intergenic
937544819 2:123004212-123004234 GGCTGCACACGGCTTGTGGGAGG + Intergenic
947826257 2:233107793-233107815 GGCCCCAGCTGGCGGGTGGTTGG + Intronic
949020841 2:241740499-241740521 GGTCCCACATGGGAGGTGGTGGG - Intronic
1169140072 20:3222764-3222786 AGCCCCATATGGCTAGTGGCTGG - Intronic
1170451144 20:16485194-16485216 GGACTCACATGGCTGGTGGTTGG - Intronic
1170771613 20:19337832-19337854 GGCCTCTCATGTCTTGTGGTTGG + Intronic
1172147210 20:32764893-32764915 GGCCCCACGTGGCTGGAGGAAGG - Intronic
1173500577 20:43549886-43549908 GGCCCCTACTGGGTTGTGGTAGG - Intronic
1174444905 20:50584042-50584064 GGCCCCACAGGGTTTGAGGGTGG - Exonic
1174526090 20:51172702-51172724 GGCCCCAGATTGCTTGTAGGTGG + Intergenic
1175947735 20:62566535-62566557 GGCACCACACAGCTTGGGGTTGG - Intronic
1177271875 21:18858980-18859002 GGCCCCACATGCATTATGGAGGG - Intergenic
1184156056 22:42667931-42667953 GGCCACACAGGGCTTGTGCCTGG - Intergenic
950133914 3:10567149-10567171 GGCCCCAGTTAGATTGTGGTTGG - Intronic
950659134 3:14455818-14455840 GGCCCCAGCTGGGATGTGGTTGG + Intronic
951773159 3:26281177-26281199 GGCCCAACATGGCTGCAGGTTGG - Intergenic
954148123 3:48644301-48644323 GGCCCCACATGTCTGGCCGTGGG - Intronic
955929646 3:64043903-64043925 GGTCCCACATGGCTGGAGCTCGG + Intergenic
960948176 3:122981269-122981291 GGCCCCTCGGGGCTTGTGTTGGG + Intronic
961313091 3:126016285-126016307 GGCCACACATGGCTACTGGTGGG - Intronic
963102439 3:141620324-141620346 AGCCCCACAGGGCTGGGGGTGGG + Intergenic
963973194 3:151452000-151452022 TGCCTCACTTGGCATGTGGTAGG - Intronic
964881768 3:161431259-161431281 GTCCTCACATTGCTGGTGGTGGG + Intergenic
965622732 3:170656873-170656895 GGCCTCCCCTGGGTTGTGGTAGG - Intronic
968370829 3:198221796-198221818 GGCCCCAAATGGCCTCCGGTCGG + Intergenic
968830990 4:2932991-2933013 GGCCCCTCATGGCCACTGGTTGG - Intronic
970242544 4:14024595-14024617 GGCCACACATGGCATGAGGTGGG - Intergenic
974593691 4:63988812-63988834 AGTTCCACATGGCTGGTGGTGGG - Intergenic
974637417 4:64582776-64582798 GGCCCCACCTGCTTTGGGGTGGG + Intergenic
976072289 4:81255703-81255725 GGCTCCACATGGTTTGTATTTGG - Intergenic
977931350 4:102752615-102752637 GCCCCCACATGGAAAGTGGTAGG - Intronic
991301502 5:65133223-65133245 GGCCCAACATGGCTTTGGCTTGG - Intergenic
1002730063 5:181327352-181327374 GGCCCCAAATGGCCTCCGGTCGG + Intergenic
1004170021 6:13288572-13288594 GCTCCCACAGGGTTTGTGGTGGG - Exonic
1011612292 6:89164965-89164987 TGCCCCAGAAAGCTTGTGGTGGG + Exonic
1011925001 6:92631751-92631773 GGCATTCCATGGCTTGTGGTAGG + Intergenic
1017024867 6:150172836-150172858 GGCCTCACATGGCTGGATGTAGG + Intronic
1020580435 7:9992400-9992422 GGCCTAAAATGGCATGTGGTAGG - Intergenic
1024292132 7:47812328-47812350 TGCCTCACATGGGTTGGGGTGGG - Intronic
1025129909 7:56369795-56369817 GGCCCCAAATGGTCTCTGGTCGG - Intergenic
1025176287 7:56804051-56804073 GGCCCCAAATGGCCTCCGGTCGG + Intergenic
1025178204 7:56812432-56812454 GGCCCCAAATGGCCTCGGGTCGG - Intergenic
1025179074 7:56815964-56815986 GGCCCCAAATGGCCTCGGGTCGG - Intergenic
1025179529 7:56817850-56817872 GGCCCCAAATGGCCTCGGGTCGG - Intergenic
1025179979 7:56819688-56819710 GGCCCCAAATGGCCTCGGGTCGG - Intergenic
1025180453 7:56821670-56821692 GGCCCCAAATGGCCTCGGGTCGG - Intergenic
1025180898 7:56823519-56823541 GGCCCCAAATGGCCTCGGGTCGG - Exonic
1025181770 7:56827097-56827119 GGCCCCAAATGGCCTCGGGTCGG - Intronic
1025695505 7:63772371-63772393 GGCCCCAAATGGCCTCTGGTCGG - Intergenic
1031122861 7:117741097-117741119 GCCCCCAGATGCCTTGTGGAGGG + Intronic
1032002009 7:128271686-128271708 GGCCCCGCGGGGCTGGTGGTGGG + Intergenic
1032894681 7:136237231-136237253 GCCCCCAAATTGCCTGTGGTGGG - Intergenic
1038486650 8:27940117-27940139 GGCTCCACATAGCTTTCGGTTGG + Intronic
1040323374 8:46329414-46329436 GGGCCCGCATGGGTTGTGGTGGG - Intergenic
1043269907 8:78319310-78319332 GGCCCCACATGGGACATGGTGGG - Intergenic
1045524460 8:102929969-102929991 GGCCCCACGGGGCTGGTGCTTGG + Intronic
1049675991 8:143889409-143889431 GTCTCCACATGGCTTTGGGTTGG + Intergenic
1052585599 9:30424429-30424451 TGCCCCACATAGCTTCTGCTTGG - Intergenic
1053450927 9:38193293-38193315 GGACCCACAGGCCTTGGGGTAGG + Intergenic
1056765694 9:89443290-89443312 GCCCACATATGGCTTGTGGCTGG - Intronic
1059424449 9:114211931-114211953 GGCCTCCCATCGCTGGTGGTTGG + Intronic
1060058463 9:120437108-120437130 ACTTCCACATGGCTTGTGGTCGG - Intronic
1061657598 9:132104765-132104787 GACCCTACATGACTTGGGGTGGG - Intergenic
1062325472 9:136010539-136010561 AGCCCACCATGGCTTGGGGTGGG - Exonic
1062754478 9:138279866-138279888 GGCCCCAAATGGCCTCCGGTCGG + Intergenic
1203578382 Un_KI270745v1:24026-24048 GGCCCCAAATGGCCTCCGGTCGG + Intergenic
1185931996 X:4213633-4213655 GGCCCTCCATGGCTTATGGTAGG + Intergenic
1186406695 X:9310661-9310683 TCACCCACATGGCTTTTGGTAGG - Intergenic