ID: 1079112342

View in Genome Browser
Species Human (GRCh38)
Location 11:17612002-17612024
Sequence CCACATGGCTTGTGGTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 208}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079112330_1079112342 9 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112342 11:17612002-17612024 CCACATGGCTTGTGGTGGGTAGG 0: 1
1: 0
2: 2
3: 25
4: 208
1079112332_1079112342 7 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112342 11:17612002-17612024 CCACATGGCTTGTGGTGGGTAGG 0: 1
1: 0
2: 2
3: 25
4: 208
1079112331_1079112342 8 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112342 11:17612002-17612024 CCACATGGCTTGTGGTGGGTAGG 0: 1
1: 0
2: 2
3: 25
4: 208
1079112329_1079112342 10 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112342 11:17612002-17612024 CCACATGGCTTGTGGTGGGTAGG 0: 1
1: 0
2: 2
3: 25
4: 208
1079112327_1079112342 16 Left 1079112327 11:17611963-17611985 CCCTGACCCCCGAGCTCACACTA 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1079112342 11:17612002-17612024 CCACATGGCTTGTGGTGGGTAGG 0: 1
1: 0
2: 2
3: 25
4: 208
1079112328_1079112342 15 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112342 11:17612002-17612024 CCACATGGCTTGTGGTGGGTAGG 0: 1
1: 0
2: 2
3: 25
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079112342 Original CRISPR CCACATGGCTTGTGGTGGGT AGG Intronic
900166527 1:1246278-1246300 CCAGCTGGCCTGGGGTGGGTGGG - Intronic
900768187 1:4519594-4519616 CCACATGGCTTGCAGTGTGGGGG - Intergenic
901173892 1:7284719-7284741 GCAAAGGCCTTGTGGTGGGTGGG - Intronic
901925682 1:12564769-12564791 CCAGATGTGCTGTGGTGGGTGGG + Intergenic
901957673 1:12798084-12798106 CAACATGGTTGGTGGTGGGAGGG + Intergenic
902622640 1:17659367-17659389 CTACATGGTATGTGGTGGGCAGG + Intronic
907250452 1:53134620-53134642 CCACACAGCTTGTGGGGGATTGG - Intronic
908831783 1:68185919-68185941 CCTCCTGGCTGTTGGTGGGTGGG + Intronic
908936566 1:69383487-69383509 CCTCATGGCCTGTGATGAGTGGG + Intergenic
909964591 1:81892408-81892430 CTACAGGGAGTGTGGTGGGTGGG - Intronic
911852037 1:102832482-102832504 CACCAGGGCTTGTGGTGGGGTGG + Intergenic
915858573 1:159418288-159418310 CCTCCTGGCCTGTGGTGGGAGGG - Intergenic
916575186 1:166060458-166060480 CCACATGGCTCGTGGAGGGTGGG + Intronic
917443023 1:175083496-175083518 CCACATGGCCTCTGATGGGATGG + Intronic
918598092 1:186317151-186317173 CTACAGGGGTTGTAGTGGGTGGG - Intronic
923610828 1:235491892-235491914 GCACAGGGCTTGTGGTGGTGGGG - Intronic
1064169940 10:13022096-13022118 CCTCATCTCTTGTGGTGGGCTGG - Intronic
1067008645 10:42690342-42690364 CCACCTGGCCTGGCGTGGGTAGG - Intergenic
1069873529 10:71547639-71547661 CCGCAGGGGTGGTGGTGGGTGGG + Intronic
1069910188 10:71754198-71754220 ACCCATGGCTGGGGGTGGGTGGG - Intronic
1070141356 10:73740690-73740712 CCCCAGGGGTTGTGGTGGCTGGG - Intergenic
1071973226 10:90929530-90929552 CCAGATCGATCGTGGTGGGTGGG - Intergenic
1072620499 10:97076064-97076086 CCACAGGGCTGGTGGGGGGCAGG + Intronic
1074530726 10:114297152-114297174 GGACATGGGTTGGGGTGGGTGGG - Intronic
1075201363 10:120407193-120407215 GCACATCCCTTTTGGTGGGTGGG + Intergenic
1075684896 10:124357031-124357053 CCAAATGGCATGTGGTGTATTGG + Intergenic
1077798597 11:5516436-5516458 CCACATGGGCTTTAGTGGGTGGG + Exonic
1079112342 11:17612002-17612024 CCACATGGCTTGTGGTGGGTAGG + Intronic
1079546785 11:21642968-21642990 CCACCTGGCTTGTGATGGGAGGG - Intergenic
1081386588 11:42480014-42480036 CCTCCTGGCTTGTGATGGGAGGG - Intergenic
1083923437 11:65792481-65792503 CCACAGGGCTGGGGGTGGGCAGG - Intronic
1085035521 11:73297563-73297585 CCGCATGGTTTGGGGTTGGTGGG - Exonic
1092946363 12:13457815-13457837 CCAGTTGGCTGGTGGTGGGGAGG + Intergenic
1093426375 12:19033037-19033059 CCACTGGGCTTGTGATGGGAGGG + Intergenic
1095382762 12:41615366-41615388 CCTCAGGGCCTGTGGTGGGAGGG - Intergenic
1095948979 12:47771403-47771425 CCAGAGGGGGTGTGGTGGGTGGG + Intronic
1100307083 12:93360545-93360567 CCATATGGCTTGTGGGGGGGTGG + Intergenic
1100818377 12:98407653-98407675 TCACAGGGCTTGTGGTGGTTTGG - Intergenic
1101828454 12:108239217-108239239 GCAAAGGGCCTGTGGTGGGTGGG - Intronic
1104184377 12:126415442-126415464 CCAAAATGCGTGTGGTGGGTGGG + Intergenic
1104547014 12:129721849-129721871 CCAACTGGCTGGTGATGGGTGGG - Intronic
1106391232 13:29337372-29337394 CCTCATGGCTTCTGTTGGCTAGG + Intronic
1107905326 13:45056354-45056376 CCACAGGGCTTGGGGTGAGGAGG - Intergenic
1109294498 13:60513311-60513333 CCTCCTGGCTTGTGATGGGAGGG + Intronic
1112434679 13:99383565-99383587 CCAAATGCCTTGCGGTGGGGAGG - Intronic
1112720986 13:102244770-102244792 CCACATGGCCTCTGCTGGGATGG - Intronic
1112825086 13:103382585-103382607 CCTCAGGGCTTGTGATGGGAGGG + Intergenic
1113693837 13:112330368-112330390 CCTCGTGGCATGTGGAGGGTGGG - Intergenic
1115063433 14:29223558-29223580 CAAGATGGATAGTGGTGGGTGGG - Intergenic
1115883516 14:37946144-37946166 CAACATAGCTGGTGGTGAGTAGG - Intronic
1120132598 14:80824243-80824265 CCACTGGGCTTGTGATGGGAGGG + Intronic
1121946732 14:98130242-98130264 CCACCTGTGTTGTGGTGGGTGGG + Intergenic
1122960002 14:105089956-105089978 CGACAAGGCTAGGGGTGGGTGGG - Intergenic
1123696286 15:22881391-22881413 CCACGTGACTTGCTGTGGGTTGG - Intronic
1124556109 15:30727327-30727349 CCTCCTGGCTTGTGATGGGAGGG + Intronic
1124675162 15:31678443-31678465 CCTCCTGGCTTGTGATGGGAGGG - Intronic
1126692535 15:51298942-51298964 CCACATGGCTAGTGGGAAGTTGG + Intronic
1127387811 15:58481200-58481222 CCTCATGACTTGTGGTGGGAGGG + Intronic
1128543934 15:68555012-68555034 CCACATGGCTGGGGCTGGGGTGG + Intergenic
1130170260 15:81504732-81504754 CCACAGGGCTTGTGTTGGTACGG - Intergenic
1132980848 16:2738070-2738092 CCCCATGGCTTGTGGGAGGGAGG - Intergenic
1133712149 16:8411682-8411704 CCACAGAGCCTGTGGTGGGTGGG - Intergenic
1136085807 16:27884158-27884180 CCACATGGTCTGTGATGGATTGG - Intronic
1137873437 16:51972531-51972553 CCACATGGCTAGGAGTGTGTGGG + Intergenic
1139545485 16:67647831-67647853 CCTCATTCCTGGTGGTGGGTCGG - Exonic
1141146158 16:81531599-81531621 TCACATGGCTTGAGGAGGCTCGG + Intronic
1141294294 16:82752392-82752414 ACACATGGGGTGTGGTGGGTAGG - Intronic
1141524316 16:84601923-84601945 CCTTCTGGCTTGTGGTGAGTCGG - Intronic
1141665205 16:85462319-85462341 CCACCTGGCTTTTGCTGGGCAGG + Intergenic
1142685722 17:1575925-1575947 CCACATGGCCTGTGAAGAGTTGG - Intronic
1145112361 17:20174967-20174989 CCTCTTTGCCTGTGGTGGGTGGG + Intronic
1146300473 17:31685395-31685417 CCCCATGCCTTGTGGTGGGGTGG - Intergenic
1146467481 17:33097553-33097575 CCACATGGCACGTGGCAGGTGGG + Intronic
1148628484 17:49088583-49088605 CCTCATTGCTTGTGGTAGGCAGG + Intergenic
1148744542 17:49911066-49911088 CCATAGCGCTAGTGGTGGGTTGG + Intergenic
1149175084 17:53859735-53859757 CAACATGGCTTGTTGTGGGCTGG + Intergenic
1149587415 17:57801482-57801504 CCTCAGGGCCTGTGATGGGTGGG - Intergenic
1150545705 17:66155305-66155327 CCTCATGGCTTCTGTTGGCTAGG - Intronic
1151329437 17:73398265-73398287 CCTCAGGGCTGGGGGTGGGTGGG - Intronic
1152682688 17:81677286-81677308 CCACCCGGCTGGAGGTGGGTGGG - Intergenic
1152891479 17:82883947-82883969 CCACATGGCGTCTGGTGTCTTGG + Intronic
1153760575 18:8327484-8327506 CCACCTGTCTTGTAGTGAGTTGG + Intronic
1154065587 18:11104330-11104352 CCTCCTGGCTTGAGGTGGGGTGG - Intronic
1154168603 18:12034840-12034862 CGACATGGCTTGTGGTGTTTGGG - Intergenic
1156481929 18:37441750-37441772 CCACAAGCCTAGTGGTGAGTGGG - Intronic
1157287947 18:46390137-46390159 CCACAGGGGTTGGGGTGGGGAGG - Intronic
1157692027 18:49691573-49691595 CCATGTGGCTTTTGGAGGGTTGG + Intergenic
1158319719 18:56249384-56249406 CCACATGGGCTGAGGTTGGTGGG - Intergenic
1158768544 18:60485996-60486018 CTGCATGGCTGGTGGTGGGGGGG - Intergenic
1160044453 18:75373637-75373659 CCACAATGCTGGAGGTGGGTAGG - Intergenic
1160295264 18:77631456-77631478 CCTCCTGGCTTGTGTTGGGAGGG + Intergenic
1161291736 19:3497430-3497452 TCACATGGCTGTTGGTGGGAGGG - Intronic
1162327456 19:10007500-10007522 CCACATGGCTTGGGCAGGGGCGG + Intronic
1163651525 19:18521026-18521048 CCACCTGGCTGGTGGTGGGGAGG - Intronic
1163806875 19:19405142-19405164 CCAAGTGTCTTGAGGTGGGTGGG + Intronic
1164885115 19:31772012-31772034 CAACATGGATTGTGGTTGATGGG + Intergenic
927396144 2:22654294-22654316 CCTCAGGGCCTGTGATGGGTGGG - Intergenic
927641035 2:24845778-24845800 CCTCAGGGCCTGTGGTGGGAGGG - Intronic
932749280 2:74361238-74361260 CCTCAGGGCTTGTGGGGGGTAGG - Exonic
936071472 2:109374434-109374456 CCACATGGATCCTGGTGGATCGG + Intronic
936257492 2:110929645-110929667 CCTCCTGGCTTGTGATGGGAGGG - Intronic
937782132 2:125850671-125850693 CCACATGGCTTGTATTGTGGAGG - Intergenic
938365188 2:130728381-130728403 GCACCTGGCTTGTCGGGGGTGGG - Intergenic
942981557 2:182089380-182089402 CCAAATGGATTGTGGTAGTTGGG - Intronic
943556030 2:189404799-189404821 CAACATGGATTGTGGTAAGTAGG - Intergenic
943577374 2:189646293-189646315 CCACAGAAATTGTGGTGGGTAGG + Intergenic
943581277 2:189686030-189686052 CCTCATGGCTTGGGGTGGCTGGG - Intronic
944505966 2:200411151-200411173 ACCCATGGCTTGTGCTGGGTGGG + Intronic
946420984 2:219564591-219564613 CCACATAGCCTCTGCTGGGTTGG - Intronic
947889685 2:233605839-233605861 CCTCAAGGCTTGTGATGGGAGGG + Intergenic
949020838 2:241740495-241740517 CCACATGGGAGGTGGTGGGCCGG - Intronic
1168847247 20:953790-953812 CCACAGGGCCTGGGCTGGGTGGG - Intergenic
1170419766 20:16181173-16181195 CCACATGGGGTCTGGGGGGTGGG - Intergenic
1170771105 20:19333130-19333152 CCACATGGCTTGAAGTGTGAAGG - Intronic
1171297709 20:24033305-24033327 TCACATGACTGGTGGTTGGTTGG - Intergenic
1172657286 20:36544865-36544887 CATCTTGGCTTCTGGTGGGTGGG - Exonic
1173913929 20:46692684-46692706 CCACATGGCTGCTGGCAGGTTGG + Intergenic
1175789716 20:61733561-61733583 CCACATGGCATGTAGTGTGGTGG - Intronic
1175947732 20:62566531-62566553 CCACACAGCTTGGGGTTGGTGGG - Intronic
1176167703 20:63682672-63682694 CCATAGGGCTGGTGCTGGGTTGG + Intronic
1177057097 21:16319472-16319494 ACACATGGCTTCTGCTGAGTTGG - Intergenic
1177394143 21:20511140-20511162 CCTCTGGGCTTGTGGTGGGAGGG + Intergenic
1177893659 21:26836620-26836642 TCACTTGTCTTGTGGTGGGGAGG - Exonic
1178604386 21:34023077-34023099 CCACATGCCATTTGGTGGGTGGG + Intergenic
1180016623 21:45090414-45090436 ACACCTGGCTTTTGGTGGGAAGG + Intronic
1181247499 22:21513125-21513147 ACACATGGGTTGTGGTGAGGAGG - Intergenic
1183348475 22:37320697-37320719 CCATTTGGCTTTTGGTGGGCTGG + Intergenic
1183361181 22:37384298-37384320 CCAGGTGCCTGGTGGTGGGTGGG - Intronic
1184892756 22:47389723-47389745 CCACAGGCCTTGTCCTGGGTGGG - Intergenic
1184901253 22:47447926-47447948 TCACATGGAGTGGGGTGGGTTGG + Intergenic
949226898 3:1705600-1705622 CCTCATGGCTTCTCTTGGGTAGG - Intergenic
950424135 3:12915498-12915520 CCACACGGAGTGGGGTGGGTGGG + Intronic
954129164 3:48551046-48551068 GCACATGGATGGTGGTGGGTGGG - Intronic
955082028 3:55666556-55666578 CAACATGGCTCCTGGTTGGTTGG - Intronic
955182408 3:56683948-56683970 CTCCATGGCGTGTGGTGGGGGGG - Intergenic
957431970 3:80122327-80122349 CCAGATGGCTTGTTCTGGGATGG - Intergenic
958627829 3:96648688-96648710 TCCAATGGCTGGTGGTGGGTTGG - Intergenic
960115220 3:113886046-113886068 CCACTTGGGTTGGGGTGGGGGGG + Intronic
960581403 3:119282466-119282488 CCTCCTGGCTTGTGATGGGTGGG - Intergenic
960721023 3:120624454-120624476 CCAGATGTCTTGGGGTGGGAAGG + Intergenic
960872446 3:122263550-122263572 CCAAAGGGTTTGTGGTGGTTGGG - Intronic
962237318 3:133717698-133717720 CCACATGGATTGAGGCGGCTGGG + Intergenic
963190702 3:142469358-142469380 CCACATTGCTTGTTGAGGATAGG + Exonic
967982726 3:195075518-195075540 CCACAGGGCTTGTTTTGGGTAGG - Intronic
969477287 4:7428748-7428770 CCACCCGGCTGGTGGTGGGTTGG + Intronic
969854905 4:9991232-9991254 ACACATGGCTTGTGGAGGAAGGG - Intronic
970115826 4:12694932-12694954 CCAAATGGCTTTTGGTAGGTAGG - Intergenic
971937155 4:33166173-33166195 TCACATGGTTTGTTGAGGGTGGG - Intergenic
972968935 4:44548546-44548568 CCACATAAATGGTGGTGGGTAGG - Intergenic
974219509 4:58948100-58948122 CCTCCTGGCTTGTGATGGGAAGG + Intergenic
974483136 4:62471627-62471649 CACCATGGCCTGTTGTGGGTGGG - Intergenic
974593686 4:63988808-63988830 CCACATGGCTGGTGGTGGGGGGG - Intergenic
974624037 4:64399539-64399561 CCTCAGGGCTTCTGGTGGGAGGG - Intronic
976277125 4:83289425-83289447 CCTCCTGGCTTGTGATGGGAGGG - Intergenic
976733635 4:88288384-88288406 TCACAGGGCTTTGGGTGGGTGGG + Intergenic
977378274 4:96237197-96237219 CCACAGGGCCTGTGATGGGAGGG - Intergenic
979405959 4:120310664-120310686 CCTCAGGGCTTGTTATGGGTGGG + Intergenic
980330446 4:131403775-131403797 CCTCATGGCTTCTGTTGGCTAGG + Intergenic
980790005 4:137608168-137608190 CCAGGTGGCTGGTGGTTGGTTGG + Intergenic
984766145 4:183402020-183402042 GCACAGGGCTTGTGTTGGGAAGG - Intergenic
985835524 5:2269361-2269383 CCACACAGCTGGTGGTGGATGGG + Intergenic
985843520 5:2327310-2327332 CCACAAGGCGGGTGGAGGGTGGG + Intergenic
986853455 5:11840205-11840227 CATCATGGATTTTGGTGGGTGGG - Intronic
987254646 5:16138169-16138191 CCTCCTGGCTTGTGATGGGAGGG - Intronic
989603915 5:43225952-43225974 CTACATGGTTTATGGTGAGTGGG + Intronic
994318539 5:98361677-98361699 CCACATGTCATGGGCTGGGTTGG + Intergenic
995278946 5:110310454-110310476 CCACATGTCTTGTCGAGGGAGGG + Intronic
997077459 5:130697328-130697350 GCACCTGGATTGTGGTGGCTGGG - Intergenic
997086421 5:130805903-130805925 CCTCCTGGCTTGTGATGGGAGGG - Intergenic
997365021 5:133320106-133320128 CCACAGGGCTTGAGGTGGAGTGG + Intronic
998900443 5:146847562-146847584 CCACAGGGCTTGTGCTCTGTTGG + Intronic
1001153921 5:169256694-169256716 TCACATGGCTTTTGGTGGCAAGG + Intronic
1001436813 5:171705555-171705577 CCACATGGCTCCTGGTGTGCGGG + Intergenic
1002058726 5:176613636-176613658 CCACATGGGCTGGGGTGGGGAGG - Intergenic
1004087746 6:12467869-12467891 CAACTTGGCTTGTGGTAAGTAGG + Intergenic
1004161680 6:13219608-13219630 GCACATGGCTGGGGGTGAGTAGG - Intronic
1004447129 6:15710625-15710647 CCCCATAGCTTCTGGTGGTTTGG - Intergenic
1007583675 6:42975144-42975166 CCACAAGGCTTGTGGAAGGTGGG + Intronic
1007781259 6:44256333-44256355 CCACAGGGCTCCAGGTGGGTAGG - Exonic
1009223693 6:61004544-61004566 CCAAATGGCGTGGGGTGGGGGGG + Intergenic
1010261648 6:73824102-73824124 CCACTGGGCATGGGGTGGGTTGG - Exonic
1013386688 6:109638807-109638829 CAACATGGCCTGTCGTGGGGTGG - Intronic
1013873825 6:114800062-114800084 CAACAGGGCCTGTTGTGGGTTGG - Intergenic
1014314878 6:119851330-119851352 GTACATGTCTGGTGGTGGGTGGG - Intergenic
1014651941 6:124050600-124050622 CCACATGGATTGGGGTAAGTCGG - Intronic
1014663315 6:124201223-124201245 CTCCATGGCATGTGGTGGGGGGG + Intronic
1014721316 6:124921023-124921045 CCTCCTGGCTTGTGATGGGAGGG + Intergenic
1016935344 6:149445609-149445631 CCACATGGTTGGTGGTGGCTGGG - Intergenic
1018924710 6:168198168-168198190 TGCCATGGCTTGTGGTGTGTTGG + Intergenic
1022427173 7:30279881-30279903 CATCATGGGTTGTGGTTGGTTGG + Intergenic
1022522160 7:31015342-31015364 GCACATTGCCTGTGCTGGGTGGG + Intergenic
1022968519 7:35496381-35496403 CCACATGGCTCCTGGGTGGTTGG + Intergenic
1023822321 7:43987013-43987035 CCACATGGCCTGTGGGGACTGGG + Intergenic
1024244029 7:47455911-47455933 GCACACTGCGTGTGGTGGGTGGG + Intronic
1024452197 7:49560233-49560255 CAACAGGGCCTGTTGTGGGTTGG + Intergenic
1024684968 7:51734828-51734850 CCTCATGGCTTGTGATGGGAAGG + Intergenic
1025695500 7:63772367-63772389 CCAAATGGCCTCTGGTCGGTGGG - Intergenic
1026842518 7:73678120-73678142 TCACTAGTCTTGTGGTGGGTTGG - Intergenic
1027048469 7:75006861-75006883 CCACATGGCTGGTTGGTGGTTGG - Intronic
1028671991 7:93411599-93411621 CCACATGGCTGATGCTGGCTAGG + Intergenic
1028857090 7:95604819-95604841 CACCAGGGCTTGTCGTGGGTTGG - Intergenic
1030109117 7:106011464-106011486 TCACATGCCTGGTGGTGGGAAGG - Intronic
1033250607 7:139755277-139755299 CCCCATGGTTTGTGGTATGTCGG - Intronic
1034863621 7:154621798-154621820 CCACCTGACTTGAGGTGGGCAGG - Intronic
1043062245 8:75518762-75518784 CCTCCTGGCTTGTGATGGGAGGG + Intronic
1043405379 8:79926990-79927012 CCAAATGGTTTGTGGTAGTTTGG + Intronic
1046057949 8:109100754-109100776 CTACATGGCTTGTGGAGAGGCGG + Intronic
1047252446 8:123191096-123191118 CCACATTGATTGTGGAGGGGAGG + Intronic
1048329251 8:133461056-133461078 CCAGCTGGCTGGAGGTGGGTGGG + Intronic
1048523428 8:135178734-135178756 CCACATGGGTTGGGGTTTGTAGG + Intergenic
1048706128 8:137155630-137155652 CCACAGGGATTATGCTGGGTCGG + Intergenic
1049159662 8:141089161-141089183 CAGCATGGCTTGTGATGGGTGGG + Intergenic
1051743941 9:20276970-20276992 CCTCCTGGCTTGTGATGGGAAGG + Intergenic
1052540874 9:29810484-29810506 CCACCTGGCCTGTGGTGGGAGGG - Intergenic
1053286935 9:36855730-36855752 GAATATGGCTTGTGGCGGGTAGG - Intronic
1055357860 9:75455879-75455901 CCACATGGCTAATAGTGGGCAGG + Intergenic
1057039089 9:91834331-91834353 CCAAATGACTTGTGGATGGTGGG - Intronic
1058164970 9:101608936-101608958 GCAGATGGCTAGTGGTAGGTGGG + Intronic
1058811783 9:108646636-108646658 TCACTTGGCTAGGGGTGGGTTGG - Intergenic
1061297726 9:129686112-129686134 CAGGATGGCTTGTAGTGGGTGGG + Intronic
1061629822 9:131865088-131865110 GTACATGGCCTTTGGTGGGTGGG - Intronic
1062523500 9:136969258-136969280 CCAGAGCGCTGGTGGTGGGTGGG - Exonic
1186370080 X:8937617-8937639 CCTCATGGCTTGTCTTGGCTAGG + Intergenic
1187568162 X:20473762-20473784 TCACATGGTTGTTGGTGGGTGGG + Intergenic
1188794258 X:34442291-34442313 CCTCCTGGCTTGTGATGGGAGGG + Intergenic
1188987581 X:36781265-36781287 ACACCTGGCTGGTGGTGCGTGGG - Intergenic
1189594425 X:42548767-42548789 CCTCAGGGCTTGTGATGGGAGGG + Intergenic
1190004444 X:46721693-46721715 CCCCATAGCCTTTGGTGGGTTGG - Intronic
1190039347 X:47057142-47057164 CCACATGCCTTCTGATGTGTAGG + Intronic
1190693305 X:52930583-52930605 CACCAGGGCCTGTGGTGGGTGGG + Intronic
1191839581 X:65502120-65502142 CTGCATGGCTTTTGGGGGGTGGG - Exonic
1193161442 X:78233283-78233305 CCTCATGGCTTCTCTTGGGTGGG + Intergenic
1193857883 X:86626865-86626887 CCTCCTGGCTTGTGATGGGAGGG + Intronic
1196701607 X:118675562-118675584 ACACAGGGCTTGTTGTGGGGTGG + Intronic
1199352897 X:146824638-146824660 CAACAAGGCTAGTGGTTGGTGGG + Intergenic
1200067892 X:153513237-153513259 TCACATGGCTTCTTGTGGGGGGG + Intergenic