ID: 1079112343

View in Genome Browser
Species Human (GRCh38)
Location 11:17612003-17612025
Sequence CACATGGCTTGTGGTGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079112331_1079112343 9 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112343 11:17612003-17612025 CACATGGCTTGTGGTGGGTAGGG 0: 1
1: 0
2: 1
3: 16
4: 170
1079112332_1079112343 8 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112343 11:17612003-17612025 CACATGGCTTGTGGTGGGTAGGG 0: 1
1: 0
2: 1
3: 16
4: 170
1079112328_1079112343 16 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112343 11:17612003-17612025 CACATGGCTTGTGGTGGGTAGGG 0: 1
1: 0
2: 1
3: 16
4: 170
1079112329_1079112343 11 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112343 11:17612003-17612025 CACATGGCTTGTGGTGGGTAGGG 0: 1
1: 0
2: 1
3: 16
4: 170
1079112330_1079112343 10 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112343 11:17612003-17612025 CACATGGCTTGTGGTGGGTAGGG 0: 1
1: 0
2: 1
3: 16
4: 170
1079112327_1079112343 17 Left 1079112327 11:17611963-17611985 CCCTGACCCCCGAGCTCACACTA 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1079112343 11:17612003-17612025 CACATGGCTTGTGGTGGGTAGGG 0: 1
1: 0
2: 1
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079112343 Original CRISPR CACATGGCTTGTGGTGGGTA GGG Intronic
903361556 1:22780357-22780379 CACATGGCCTGTGGGGGTTCAGG - Intronic
903484491 1:23679472-23679494 CGCATGGGTTGTGATGGGCATGG + Intergenic
903642346 1:24868577-24868599 CACATTTCCTGTGGTGGGTCAGG + Intergenic
905187096 1:36204421-36204443 CCAATGGCATGTGGTGGATAAGG - Intergenic
905740208 1:40363739-40363761 CACACGGCTGCTGGTGGGGAAGG - Intronic
912630887 1:111245864-111245886 CAAAGGGGTTGTAGTGGGTAGGG - Intergenic
914451423 1:147795929-147795951 CACAAGGCATGTGGTGGCTATGG + Intergenic
917796190 1:178534455-178534477 AACCTGGCTTGCGGTGGGAAGGG - Intronic
919764506 1:201117618-201117640 CACTTGGCTTGTGCTGGCTCCGG + Intronic
921860267 1:220035904-220035926 CACCTGGCTTGTGATGGGTTTGG - Intronic
922919668 1:229291713-229291735 CACCTCGCTTGTGGAGAGTAGGG + Intronic
923119863 1:230979633-230979655 AACATGGGTTGTGGAGGGTAAGG - Intronic
923400141 1:233608847-233608869 CACATGGCTGGTGATGGGTCTGG - Intergenic
923610827 1:235491891-235491913 CACAGGGCTTGTGGTGGTGGGGG - Intronic
1063486363 10:6424365-6424387 CTGGTGGCTTGTGGTGGGGAAGG + Intergenic
1067581360 10:47448317-47448339 TACATGGTTTGTAGTGTGTATGG + Intergenic
1069910186 10:71754197-71754219 CCCATGGCTGGGGGTGGGTGGGG - Intronic
1072620500 10:97076065-97076087 CACAGGGCTGGTGGGGGGCAGGG + Intronic
1072938643 10:99737700-99737722 CACATAGCTTGTTTTGGCTATGG - Intronic
1073532404 10:104244570-104244592 TACTTGGTTTGTGGTGGGCATGG + Intronic
1077315812 11:1918963-1918985 CACATGGAGTTTGCTGGGTAAGG - Intergenic
1079112343 11:17612003-17612025 CACATGGCTTGTGGTGGGTAGGG + Intronic
1079546784 11:21642967-21642989 CACCTGGCTTGTGATGGGAGGGG - Intergenic
1080949396 11:37013080-37013102 CCCATGGCATGTGGAGAGTATGG - Intergenic
1081433032 11:42997285-42997307 CACATGGCGTGTGTTTGGGAAGG - Intergenic
1083923436 11:65792480-65792502 CACAGGGCTGGGGGTGGGCAGGG - Intronic
1084937486 11:72594878-72594900 CATCTGGCCTGTGGTGGGGAGGG + Intronic
1085568678 11:77539931-77539953 TTCATGCCTTGTGGTAGGTATGG - Intronic
1085861947 11:80245028-80245050 CCCATGGCATGTGGTGATTATGG - Intergenic
1086501171 11:87455395-87455417 CACCTGGTCAGTGGTGGGTAGGG + Intergenic
1088003227 11:104907900-104907922 CACATGACTCTTGGTAGGTAAGG - Intergenic
1089064198 11:115650080-115650102 CTCATGGCTTGTGCTGGAGAAGG + Intergenic
1090668038 11:128927856-128927878 CAGATGGGTTGCGGTGGGGATGG - Intergenic
1091835598 12:3583522-3583544 CACATTCTGTGTGGTGGGTATGG + Intronic
1099614700 12:84919582-84919604 TATATTGCTTGTGGTGGGGAGGG - Intergenic
1099781561 12:87202277-87202299 CACACGGCTGCTGTTGGGTATGG - Intergenic
1100307084 12:93360546-93360568 CATATGGCTTGTGGGGGGGTGGG + Intergenic
1103611343 12:122126087-122126109 CAGATGGCTTGAGATGGGCAAGG - Intronic
1103694010 12:122799519-122799541 CACACTGCTTGTTGTGGGGATGG - Intronic
1104898376 12:132175297-132175319 CACAAGGCCTGTGGTGGGGGTGG - Intergenic
1106249682 13:27974024-27974046 CACATTCTTTGTGGTGGGTGAGG + Intergenic
1106391233 13:29337373-29337395 CTCATGGCTTCTGTTGGCTAGGG + Intronic
1108515515 13:51199106-51199128 CAAATGGATTGTGCTGGGTGTGG + Intergenic
1112434678 13:99383564-99383586 CAAATGCCTTGCGGTGGGGAGGG - Intronic
1112564983 13:100545212-100545234 CACTTGGCATGGGGTGGGCATGG - Intronic
1112892793 13:104259493-104259515 CACCTGGCATTGGGTGGGTATGG - Intergenic
1113439810 13:110319578-110319600 CACCTGGCTGTTGGAGGGTACGG - Intronic
1113607540 13:111621184-111621206 CATATGGTTTGTGATGTGTATGG + Intronic
1115165153 14:30439727-30439749 CATAAGCCTTGTGGTGGGTGAGG + Intergenic
1115883515 14:37946143-37946165 AACATAGCTGGTGGTGAGTAGGG - Intronic
1118452217 14:65913355-65913377 CCCATGGCTGGTGCTGGGAAAGG - Intergenic
1121096507 14:91221231-91221253 CACATGCCCAGTGGTAGGTAGGG + Intronic
1123826742 15:24089766-24089788 TACATGGCATGTGGTGGAAACGG - Intergenic
1123851230 15:24359225-24359247 TACATGGCATGTGGTGGAAACGG - Intergenic
1125350226 15:38759091-38759113 CACATGGCTTGTAGCCAGTAAGG + Intergenic
1126555297 15:49980848-49980870 TACATAGCTTATGGTGGGCAGGG - Intronic
1128325545 15:66721697-66721719 CACACTGCATGTGGTGGGTGTGG + Intronic
1131434905 15:92414806-92414828 ACGATAGCTTGTGGTGGGTACGG - Intronic
1132980846 16:2738069-2738091 CCCATGGCTTGTGGGAGGGAGGG - Intergenic
1133712148 16:8411681-8411703 CACAGAGCCTGTGGTGGGTGGGG - Intergenic
1136748088 16:32609794-32609816 AACATTGCTTGAGGTGGGTGTGG - Intergenic
1138068896 16:53970629-53970651 AACAGGGATGGTGGTGGGTATGG + Intronic
1140823944 16:78688710-78688732 CTCCTGGCATCTGGTGGGTAGGG + Intronic
1141146159 16:81531600-81531622 CACATGGCTTGAGGAGGCTCGGG + Intronic
1141294293 16:82752391-82752413 CACATGGGGTGTGGTGGGTAGGG - Intronic
1142171541 16:88625119-88625141 CACAGGGCTGCTGGTGGGGAGGG + Intronic
1142270197 16:89085012-89085034 CACGAGGCTTGTCCTGGGTAAGG - Intergenic
1203050225 16_KI270728v1_random:869001-869023 AACATTGCTTGAGGTGGGTGTGG - Intergenic
1144846384 17:18221827-18221849 CACATGGGTTGTAATGGGTAAGG - Intergenic
1147419446 17:40314856-40314878 CACCAGGCTTGTGGTGGGGGTGG + Intronic
1149175085 17:53859736-53859758 AACATGGCTTGTTGTGGGCTGGG + Intergenic
1150545704 17:66155304-66155326 CTCATGGCTTCTGTTGGCTAGGG - Intronic
1151737201 17:75950873-75950895 CGGATGGCTTGTGGTGGGCATGG - Exonic
1152575542 17:81139249-81139271 CACGTGGCTTGTGGAGGGGCAGG - Intronic
1153536138 18:6103967-6103989 AGCATGGCTTGTTGTGGGGAGGG - Intronic
1153893718 18:9540757-9540779 GTCATGGCTTGTGGTGGTCACGG - Intergenic
1154168602 18:12034839-12034861 GACATGGCTTGTGGTGTTTGGGG - Intergenic
1155871156 18:31030079-31030101 CACATGACTTATGGTGGCCAAGG - Intronic
1156452979 18:37277087-37277109 CAGGTGGCTTGTGGAGGGCAGGG - Intronic
1158940249 18:62400984-62401006 CCCATTGCTTGTGGTGGAGATGG - Intergenic
1160911628 19:1476571-1476593 CACATGGCTGGTGGCTGGTGTGG - Intronic
1161155475 19:2730303-2730325 CTGATGGCTGGTGGAGGGTAGGG + Intronic
1161770846 19:6230018-6230040 CGCAGGGCTGGTGGTGGTTATGG - Intronic
1163050873 19:14682705-14682727 CACATGATTTGTTGGGGGTAAGG + Intronic
1163651524 19:18521025-18521047 CACCTGGCTGGTGGTGGGGAGGG - Intronic
925553699 2:5105122-5105144 CCCATTGCTTGAGGTGGGTTTGG - Intergenic
928085529 2:28344185-28344207 CAAATGGCTTGTGGAGGGTGTGG + Intergenic
928179445 2:29057612-29057634 CACTTGGCCTCTGGTGGGGACGG + Exonic
929688321 2:44053768-44053790 CACATGGCTGGAAGTTGGTATGG - Intergenic
929749742 2:44697720-44697742 CAGATGGCGTGGGGTGGATAAGG + Intronic
938365187 2:130728380-130728402 CACCTGGCTTGTCGGGGGTGGGG - Intergenic
938837279 2:135118975-135118997 CACATGCCTTGAGGTGTGGAAGG - Intronic
943577375 2:189646294-189646316 CACAGAAATTGTGGTGGGTAGGG + Intergenic
945540882 2:211085211-211085233 CATATGGCTTGGGGTGGAAAAGG - Intergenic
948145982 2:235708365-235708387 GAAATGGCATGTGGTGGGTGTGG + Intronic
948807039 2:240457498-240457520 CAGATGGCCTCTAGTGGGTAAGG + Intronic
1168888537 20:1277210-1277232 TACCTGGTTTGTGCTGGGTACGG - Intronic
1170771104 20:19333129-19333151 CACATGGCTTGAAGTGTGAAGGG - Intronic
1176117772 20:63440476-63440498 CCCGTGGCTTGTGGTGCGTGCGG - Intronic
1180790586 22:18573571-18573593 CACATGGGGTGTGGTGAGGAGGG - Intergenic
1181231152 22:21421744-21421766 CACATGGGGTGTGGTGAGGAGGG + Intronic
1181247498 22:21513124-21513146 CACATGGGTTGTGGTGAGGAGGG - Intergenic
1184741114 22:46429656-46429678 CCCATGGCTTCTGGTGGCTTTGG + Intronic
949238722 3:1843441-1843463 CACAAGGTTTGTGATGGGAAAGG - Intergenic
950573168 3:13814646-13814668 GCCATGGCTGGTGGTAGGTATGG + Intergenic
955528579 3:59848119-59848141 CACATGGCTTGTGGGAGCCACGG - Intronic
956503224 3:69910064-69910086 CACAGGGATTGTGCTGGGAATGG - Intronic
958627827 3:96648687-96648709 CCAATGGCTGGTGGTGGGTTGGG - Intergenic
959279301 3:104317281-104317303 CACAAGGCCTGTGGTGGTCATGG + Intergenic
960055482 3:113273820-113273842 CCCATGTCCTGTGGTGGGGAAGG + Intronic
960581402 3:119282465-119282487 CTCCTGGCTTGTGATGGGTGGGG - Intergenic
961190882 3:124960400-124960422 CACATTGGGAGTGGTGGGTATGG + Intergenic
962619441 3:137162661-137162683 CTCAGGGCTTGTGGTGGGACAGG + Intergenic
963550312 3:146713164-146713186 GATATGGCTCATGGTGGGTAAGG - Intergenic
964881771 3:161431264-161431286 CACATTGCTGGTGGTGGGGTTGG + Intergenic
968945527 4:3661568-3661590 GACAAGGCTGGTGGTGGGCAGGG - Intergenic
970601996 4:17647896-17647918 CTGAAGGCTTGTGGTGGGTTAGG + Intronic
972111735 4:35570187-35570209 CACATGTCCTGTGGTGAGCATGG - Intergenic
974219510 4:58948101-58948123 CTCCTGGCTTGTGATGGGAAGGG + Intergenic
976826010 4:89261190-89261212 CAGATAGCTTGTAGTGGGGAAGG + Intronic
977431115 4:96931005-96931027 CAGATATCTTGTGGTGGTTAAGG - Intergenic
978008783 4:103652430-103652452 CACATGGCTGCTGCTGGGGATGG + Intronic
978770068 4:112446795-112446817 TACCTGGGTTGTGGTGGGGAGGG - Intergenic
980330447 4:131403776-131403798 CTCATGGCTTCTGTTGGCTAGGG + Intergenic
985425282 4:189824135-189824157 CTCTTGGCTGATGGTGGGTAAGG + Intergenic
985720328 5:1485506-1485528 CACATAGCTTGTGCTGGGCATGG + Intronic
990260397 5:54015701-54015723 AACATAGCTTGAGGTGTGTATGG + Intronic
990388710 5:55295839-55295861 CAAATGGCTTGTGGTGACTAAGG - Intronic
990758198 5:59099485-59099507 TACATGACTTGTGGTGAATATGG - Intronic
991341004 5:65609038-65609060 CCCATGGCTTATGGTGGGAAAGG + Intronic
995093976 5:108213515-108213537 CTCATGGCTTCCGCTGGGTAGGG + Intronic
995218108 5:109618316-109618338 CATATGTTTTGTGTTGGGTAGGG - Intergenic
995710517 5:115030744-115030766 CACATGGCCTGTGCTGGAGAAGG - Intergenic
997077458 5:130697327-130697349 CACCTGGATTGTGGTGGCTGGGG - Intergenic
998210609 5:140194523-140194545 CCCATTGGTTGTGGTGGATAAGG - Exonic
999670732 5:153957125-153957147 CAGATGGCCTGTGGTGTGTGTGG + Intergenic
1000986673 5:167868197-167868219 CTACTGGCTTCTGGTGGGTAGGG - Intronic
1004066666 6:12252768-12252790 CACGTGGCTTATAGTGAGTAGGG - Intergenic
1004988204 6:21106885-21106907 CAAATTGCTTATGGTGGTTATGG + Intronic
1005841476 6:29747469-29747491 CACACGGCCTGTGTTGGGTCTGG + Intergenic
1006866891 6:37215935-37215957 CACATGGCTGGTAGCAGGTAAGG - Intronic
1007583676 6:42975145-42975167 CACAAGGCTTGTGGAAGGTGGGG + Intronic
1008880439 6:56375760-56375782 CATGTGGCTTGGGGTGGGTGTGG + Intronic
1013180487 6:107713303-107713325 CACATGGCTGGTGGGTGGCAGGG - Intronic
1013316919 6:108952000-108952022 CACATGGCTGGTGAAGGGTAAGG - Intronic
1014314877 6:119851329-119851351 TACATGTCTGGTGGTGGGTGGGG - Intergenic
1016935343 6:149445608-149445630 CACATGGTTGGTGGTGGCTGGGG - Intergenic
1018542503 6:164897782-164897804 CACATGGCTTGTAGTGGTGAAGG - Intergenic
1018848500 6:167571619-167571641 CACATTGCTGGTGATGGGTGCGG + Intergenic
1018933631 6:168259059-168259081 CGCATGAGCTGTGGTGGGTATGG - Intergenic
1019266177 7:118670-118692 CGCAGGGCTGGTGGTGGGAACGG - Intergenic
1021342894 7:19487187-19487209 CAAATGCCTTGTGTTGTGTAAGG + Intergenic
1023840045 7:44091850-44091872 GACATGGCCTATGCTGGGTATGG + Intergenic
1024244030 7:47455912-47455934 CACACTGCGTGTGGTGGGTGGGG + Intronic
1026539065 7:71264451-71264473 CACTAGGATTGTGGAGGGTATGG - Intronic
1028130341 7:87164238-87164260 CTCATGGCTAGTGGGGGGAAAGG - Intronic
1029064927 7:97839822-97839844 CACCTGGCTGATGGTGGGGAAGG + Intergenic
1030574632 7:111271026-111271048 CCCATGGCATGTGGTGATTATGG - Intronic
1034863620 7:154621797-154621819 CACCTGACTTGAGGTGGGCAGGG - Intronic
1035141330 7:156765429-156765451 CACATGGCTTGGGGTGCCTCAGG - Intronic
1037133583 8:15435912-15435934 CACATTGCTTCTGTTGGTTAGGG + Intronic
1037264603 8:17044812-17044834 CAGTTGGCTTGGGGTGGGTCAGG + Intronic
1038896573 8:31790055-31790077 CACAAGGCTTGTGTTAGGTGAGG + Intronic
1041725853 8:61016769-61016791 CAGAAGGCTTGTGGTGCATATGG + Intergenic
1049750191 8:144279392-144279414 CACATGGCTGGTGGTGGTCTTGG - Intronic
1051376377 9:16406846-16406868 CACAAGGCTTCTGATGGTTATGG + Intergenic
1051743942 9:20276971-20276993 CTCCTGGCTTGTGATGGGAAGGG + Intergenic
1052540873 9:29810483-29810505 CACCTGGCCTGTGGTGGGAGGGG - Intergenic
1053286934 9:36855729-36855751 AATATGGCTTGTGGCGGGTAGGG - Intronic
1055557239 9:77487635-77487657 CATATGACTTGTGTTGGGTTAGG - Intronic
1057249109 9:93485303-93485325 CAGAGGGCTTGTGCTGGGTATGG + Intronic
1059815480 9:117908237-117908259 CACATAGCTTGTGGGAGGCAGGG + Intergenic
1060439544 9:123626215-123626237 CATCTGGCGTGTGGTGTGTATGG + Intronic
1062380847 9:136285894-136285916 CACGTGGCATGTGGTGTGTGTGG - Intronic
1186370081 X:8937618-8937640 CTCATGGCTTGTCTTGGCTAGGG + Intergenic
1190414374 X:50166891-50166913 TGGATGGCTTGTGGTGGGAATGG - Intergenic
1191061143 X:56297809-56297831 CACAGGGCTGGTGGAGGATATGG + Intergenic
1193671842 X:84396898-84396920 GACATTGGTTGTGGTAGGTAGGG + Intronic
1194348337 X:92793897-92793919 CCCATGGCCTGTGGTGGGGGTGG + Intergenic
1194358471 X:92918117-92918139 CACATGGCCTGAGGTGGAGATGG - Intergenic
1196701608 X:118675563-118675585 CACAGGGCTTGTTGTGGGGTGGG + Intronic
1198788230 X:140314108-140314130 CATGTGGCCTGTGGTGGCTATGG + Intergenic
1199114498 X:143975134-143975156 CACATGGCTCACTGTGGGTATGG + Intergenic
1200067893 X:153513238-153513260 CACATGGCTTCTTGTGGGGGGGG + Intergenic
1200656664 Y:5910525-5910547 CCCATGGCCTGTGGTGGGGGTGG + Intergenic
1200666651 Y:6033808-6033830 CACATGGCCTGAGGTGGAGATGG - Intergenic
1201355780 Y:13095722-13095744 CACAGGACTTGTGGGGGGAAGGG + Intergenic
1201980161 Y:19898613-19898635 CACCTGGGGTGTGGTGGGTGAGG + Intergenic