ID: 1079112344

View in Genome Browser
Species Human (GRCh38)
Location 11:17612004-17612026
Sequence ACATGGCTTGTGGTGGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 251}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079112332_1079112344 9 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112344 11:17612004-17612026 ACATGGCTTGTGGTGGGTAGGGG 0: 1
1: 0
2: 2
3: 15
4: 251
1079112328_1079112344 17 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112344 11:17612004-17612026 ACATGGCTTGTGGTGGGTAGGGG 0: 1
1: 0
2: 2
3: 15
4: 251
1079112329_1079112344 12 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112344 11:17612004-17612026 ACATGGCTTGTGGTGGGTAGGGG 0: 1
1: 0
2: 2
3: 15
4: 251
1079112331_1079112344 10 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112344 11:17612004-17612026 ACATGGCTTGTGGTGGGTAGGGG 0: 1
1: 0
2: 2
3: 15
4: 251
1079112327_1079112344 18 Left 1079112327 11:17611963-17611985 CCCTGACCCCCGAGCTCACACTA 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1079112344 11:17612004-17612026 ACATGGCTTGTGGTGGGTAGGGG 0: 1
1: 0
2: 2
3: 15
4: 251
1079112330_1079112344 11 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112344 11:17612004-17612026 ACATGGCTTGTGGTGGGTAGGGG 0: 1
1: 0
2: 2
3: 15
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079112344 Original CRISPR ACATGGCTTGTGGTGGGTAG GGG Intronic
900731703 1:4266151-4266173 CCCTGGCATCTGGTGGGTAGAGG - Intergenic
905297410 1:36962951-36962973 AGATGACCTGGGGTGGGTAGAGG + Intronic
906273792 1:44501201-44501223 ACATTGCTGGGGGTGGGGAGTGG + Intronic
907596091 1:55721280-55721302 CTATGGCATCTGGTGGGTAGAGG + Intergenic
907820815 1:57966454-57966476 ACATGTCTAGTGGTGGGTGCTGG - Intronic
907984786 1:59519996-59520018 CACTGGCCTGTGGTGGGTAGAGG + Intronic
909451883 1:75806676-75806698 AGGTGGCTTGTGGAGGGTACAGG - Intronic
909463268 1:75943537-75943559 ACACTGATTGTGGTGGGCAGGGG - Intergenic
910712948 1:90200620-90200642 AAATGGAGTGTGGTGGGCAGAGG + Intergenic
911852040 1:102832484-102832506 CCAGGGCTTGTGGTGGGGTGGGG + Intergenic
912556142 1:110517539-110517561 TGATGGCTTCTGGTGGGCAGTGG - Exonic
912630886 1:111245863-111245885 AAAGGGGTTGTAGTGGGTAGGGG - Intergenic
915893582 1:159793620-159793642 ACTTAGCTGGTGGTGGGGAGGGG - Intergenic
919232793 1:194797006-194797028 AAATAGCTCCTGGTGGGTAGAGG + Intergenic
920180262 1:204128049-204128071 ACATGGCTGGGGTTGGGGAGTGG + Intergenic
921418786 1:214921933-214921955 ACATGGATTTTGTGGGGTAGAGG + Intergenic
921769692 1:219021835-219021857 GCATTGCCTGTGGTGGGAAGAGG - Intergenic
924164572 1:241268402-241268424 TCCTGGCGTGTAGTGGGTAGAGG - Intronic
1064178416 10:13095419-13095441 CCATGGATGGTGGTGGGTGGGGG + Intronic
1065123425 10:22550162-22550184 ACATGGTTTGTGGTGACTGGTGG + Intronic
1065153773 10:22849251-22849273 AAGTGGCTTGGGGTGGGGAGTGG + Intergenic
1065875501 10:29994128-29994150 TCCTGGCATCTGGTGGGTAGAGG - Intergenic
1066107328 10:32167384-32167406 ACATGGCTTGTCTTGGTCAGTGG + Intergenic
1066289390 10:33999876-33999898 ACATCCCTGGTGGTGGGTGGAGG + Intergenic
1069751165 10:70745849-70745871 ACATGTCTGGTGGTTGGTACTGG + Intronic
1069910184 10:71754196-71754218 CCATGGCTGGGGGTGGGTGGGGG - Intronic
1070813066 10:79307857-79307879 TGATGGCGTGTGCTGGGTAGTGG - Intronic
1073532405 10:104244571-104244593 ACTTGGTTTGTGGTGGGCATGGG + Intronic
1073879629 10:107965770-107965792 TCATTGCATGTGGTGGGGAGGGG + Intergenic
1074706890 10:116141170-116141192 AAATGGCTTGTGCTGGATAATGG + Intronic
1074974431 10:118568614-118568636 AATTAGATTGTGGTGGGTAGTGG - Intergenic
1077808390 11:5611826-5611848 ACAGGTCTTGAGGTGGATAGGGG + Exonic
1078642374 11:13108637-13108659 ACAGGGCTTGTGGAGGGAAGAGG + Intergenic
1079112344 11:17612004-17612026 ACATGGCTTGTGGTGGGTAGGGG + Intronic
1082950096 11:58805453-58805475 ACTTGGTTTGTGGTGGGGCGAGG + Intergenic
1083601687 11:63952573-63952595 CCATGGCTTGGGGGAGGTAGGGG + Intronic
1083923435 11:65792479-65792501 ACAGGGCTGGGGGTGGGCAGGGG - Intronic
1084125906 11:67098873-67098895 ACATGGGGTGTGGAGGGTGGTGG - Intergenic
1085304082 11:75475441-75475463 ACAGGGCTGGTGCAGGGTAGGGG - Intronic
1089067119 11:115670423-115670445 AGATGGCTGCTGGTGAGTAGGGG + Intergenic
1091650831 12:2308002-2308024 ACATGGGTGGAGGTGGGAAGAGG - Intronic
1091937096 12:4442840-4442862 ACATGGCCTCTGGAGGGCAGGGG - Intronic
1092204980 12:6609071-6609093 ACATGAGTAGTGGTGAGTAGCGG - Intergenic
1095398397 12:41787379-41787401 CCATGGCTTGTGCTGGACAGGGG - Intergenic
1096075288 12:48800233-48800255 CTATGGCTTGGGGTGGGGAGTGG + Intergenic
1096864928 12:54556855-54556877 ACTTGGCTGGTGGGGGGTTGAGG + Intronic
1097721448 12:63025940-63025962 ACATGACTTTGGGTGTGTAGGGG + Intergenic
1099596542 12:84673472-84673494 ACATGGCCTGAGGTGGGGAGTGG + Intergenic
1099614699 12:84919581-84919603 ATATTGCTTGTGGTGGGGAGGGG - Intergenic
1100686569 12:96992738-96992760 AAATTCCTTGTGGTGGGTGGCGG - Intergenic
1101406984 12:104437269-104437291 ACATTCCTGGTGGTGGGTGGGGG + Intergenic
1102040546 12:109798114-109798136 TCCTGGCATCTGGTGGGTAGAGG + Intronic
1102637140 12:114334365-114334387 TCCTGGCTTTGGGTGGGTAGAGG - Intergenic
1102839752 12:116106039-116106061 ACATGAGTTGTGGAGGGAAGAGG + Intronic
1102887411 12:116532624-116532646 TCATGGCTGCTGGTGGGTAGTGG + Intergenic
1103075036 12:117975038-117975060 TCTTGGCTTGTGGTTGGGAGAGG + Intergenic
1106391234 13:29337374-29337396 TCATGGCTTCTGTTGGCTAGGGG + Intronic
1107254142 13:38403328-38403350 ACAGGGCTTGTGAAGGGTTGAGG + Intergenic
1109261468 13:60149901-60149923 TCATGGCAGGTGGTGGGGAGGGG + Intronic
1110499243 13:76207478-76207500 CCAGGGCCTGTGGGGGGTAGGGG - Intergenic
1111439384 13:88259692-88259714 ACATGGTTTGTCATGGGAAGTGG - Intergenic
1111948227 13:94687875-94687897 TCCTGGCATGTAGTGGGTAGAGG - Intergenic
1114163489 14:20195087-20195109 ACTTGGCTTTTGGTGGGAATAGG - Intergenic
1115883514 14:37946142-37946164 ACATAGCTGGTGGTGAGTAGGGG - Intronic
1116493718 14:45536322-45536344 ACATGGGTTGGGGTGGCTGGGGG + Intergenic
1117336725 14:54762390-54762412 ACATGCCTTAAGGTGGGTGGTGG - Intronic
1117478021 14:56117683-56117705 ACCTGGCTTTTGGGGGGTGGCGG - Intergenic
1117489735 14:56234588-56234610 CCAGGGCCTGTGGTGGGTTGTGG + Intronic
1120869855 14:89327541-89327563 ATAGGGCTTTTGGCGGGTAGAGG - Intronic
1121110786 14:91311482-91311504 CCTCGGCCTGTGGTGGGTAGAGG - Intronic
1121558234 14:94854650-94854672 TCCTGGCATCTGGTGGGTAGAGG + Intergenic
1122270488 14:100566756-100566778 ACATGTCTTGTGCTGGGAGGAGG - Intronic
1122960000 14:105089954-105089976 ACAAGGCTAGGGGTGGGTGGGGG - Intergenic
1124029056 15:25992604-25992626 TCATGGGCTGTGGAGGGTAGAGG - Intergenic
1124493520 15:30172721-30172743 ATGTGGGTAGTGGTGGGTAGTGG + Intergenic
1124750014 15:32365604-32365626 ATGTGGGTAGTGGTGGGTAGTGG - Intergenic
1128546733 15:68573488-68573510 GGAAGGGTTGTGGTGGGTAGAGG + Intergenic
1131434904 15:92414805-92414827 CGATAGCTTGTGGTGGGTACGGG - Intronic
1131794384 15:95999462-95999484 AAATGGCATGTGGAGGGAAGAGG - Intergenic
1132229192 15:100169224-100169246 ACCTGGCATGTGTTGGGCAGTGG - Intronic
1132269054 15:100506796-100506818 AAATGGCTTCTGATGGGTACAGG + Intronic
1132582438 16:691191-691213 CCATGGCTGGAGGTGGGCAGGGG - Intronic
1134176729 16:12012995-12013017 GCATGGGTTGGGGTGGGTGGAGG + Intronic
1134605831 16:15570506-15570528 TAATGGCCTGTAGTGGGTAGAGG - Intronic
1134654768 16:15939807-15939829 TCCTGGCATTTGGTGGGTAGGGG + Intergenic
1136233742 16:28902564-28902586 ACATAGCCTGTGGTGGAGAGAGG - Exonic
1136748087 16:32609793-32609815 ACATTGCTTGAGGTGGGTGTGGG - Intergenic
1140823945 16:78688711-78688733 TCCTGGCATCTGGTGGGTAGGGG + Intronic
1140870371 16:79100974-79100996 AAAGGTCTTGTGGTGGGCAGGGG + Intronic
1141188887 16:81809197-81809219 AAGTGGCTTGTGGTGTGCAGAGG - Intronic
1141278481 16:82608875-82608897 ACATGGCCTGTGGTTGTCAGGGG + Intergenic
1141294292 16:82752390-82752412 ACATGGGGTGTGGTGGGTAGGGG - Intronic
1142171542 16:88625120-88625142 ACAGGGCTGCTGGTGGGGAGGGG + Intronic
1203050224 16_KI270728v1_random:869000-869022 ACATTGCTTGAGGTGGGTGTGGG - Intergenic
1142867126 17:2797814-2797836 ACTTGGCTTCTGGTTGGGAGGGG + Intronic
1144642255 17:16944017-16944039 ACATGGCGCTTGGTGGGGAGAGG - Intronic
1144858605 17:18285374-18285396 ACAGAGCTTGCAGTGGGTAGTGG - Intronic
1146791872 17:35755554-35755576 TGCTGGCTTTTGGTGGGTAGTGG - Intronic
1147316902 17:39625382-39625404 AGATGGGGTGTGGTGGGGAGTGG - Intergenic
1148111090 17:45144868-45144890 ACAGGGCTTGTGCTGGACAGAGG - Intergenic
1149175086 17:53859737-53859759 ACATGGCTTGTTGTGGGCTGGGG + Intergenic
1150224630 17:63517327-63517349 ATATGGTTTGTGGAGGGGAGAGG + Intronic
1150545703 17:66155303-66155325 TCATGGCTTCTGTTGGCTAGGGG - Intronic
1150803992 17:68304523-68304545 ACATGGATGGGGGTGGTTAGAGG - Intronic
1151966171 17:77432942-77432964 TCAGGGCTGGGGGTGGGTAGTGG + Intronic
1152719264 17:81914884-81914906 AGAGGGCCTGTGGTGGGGAGGGG + Intronic
1153483318 18:5569688-5569710 CCATGCCTTCAGGTGGGTAGTGG + Intronic
1154009299 18:10561589-10561611 ACATGACCTGTGGGGGGAAGGGG - Intergenic
1155294646 18:24374005-24374027 ACATGGGTGGAGGTGGGAAGGGG + Intronic
1156452978 18:37277086-37277108 AGGTGGCTTGTGGAGGGCAGGGG - Intronic
1157216954 18:45792186-45792208 CCAGGGCTTGTGGGGGGTGGAGG + Intergenic
1157780092 18:50430724-50430746 GGATGGCATGTGGTGGGTGGGGG + Intergenic
1158463173 18:57665021-57665043 TCCTGGCTTCTAGTGGGTAGAGG - Intronic
1160223203 18:76992203-76992225 CCATGGATGGGGGTGGGTAGGGG + Intronic
1161079056 19:2301374-2301396 TCCTGGCTTGGAGTGGGTAGAGG - Intronic
1161429258 19:4221883-4221905 TCTTGGCTTGGAGTGGGTAGAGG - Intronic
1162475414 19:10896595-10896617 ACGTGGGTTGATGTGGGTAGGGG - Intronic
1163298915 19:16430648-16430670 CCATGCCTTGTGCTGGGCAGTGG - Intronic
1163405270 19:17118093-17118115 TACTGGCTTCTGGTGGGTAGAGG + Intronic
1163587692 19:18173046-18173068 TCAAGGCTTGTGGGGGGTGGGGG - Intronic
1163651523 19:18521024-18521046 ACCTGGCTGGTGGTGGGGAGGGG - Intronic
1166330443 19:42075394-42075416 ATAGGGAGTGTGGTGGGTAGAGG - Intronic
1167706871 19:51086347-51086369 ACCTAGCATGTGGTGGGAAGAGG - Intergenic
1168318140 19:55493210-55493232 CACTGGCATGTGGTGGGTAGAGG + Intronic
925740196 2:6998882-6998904 AAATGCCTTGTGGGGGGTGGGGG + Intronic
925875570 2:8308627-8308649 GCATGGTATGTGGGGGGTAGAGG - Intergenic
931005224 2:57843011-57843033 AAATAGCTTTTGGTGGGAAGAGG + Intergenic
932185364 2:69690757-69690779 AGATGGCATGTGATGGGTAAAGG - Intronic
933290682 2:80435084-80435106 TCCTGGCTTCTAGTGGGTAGAGG - Intronic
935544266 2:104384228-104384250 ACAGAGCTTTTGGTGGGTACAGG - Intergenic
936133764 2:109871196-109871218 CCATGGTATGTGGTGGGAAGGGG - Intergenic
936210933 2:110500289-110500311 CCATGGTATGTGGTGGGAAGGGG + Intergenic
936435461 2:112501392-112501414 CCATGGTATGTGGTGGGAAGGGG + Intronic
937298904 2:120826530-120826552 ACCTTGCTTGAGGTGGGCAGAGG + Intronic
940770552 2:157835158-157835180 ACATGGGATGTGGTGGGATGTGG - Intronic
942491519 2:176494375-176494397 ACATTGGTTTTGGTGGGAAGTGG - Intergenic
945136825 2:206638615-206638637 ACAGGTAGTGTGGTGGGTAGGGG - Intergenic
945467594 2:210187300-210187322 CCAGGGCCTGTGGAGGGTAGGGG + Intergenic
945935875 2:215902188-215902210 AAAAGGCTTGTTGTGGGGAGAGG - Intergenic
946760404 2:222988139-222988161 ACATGGCTAGTGGGGGGGAGCGG + Intergenic
947473122 2:230415800-230415822 ACATGGCTTGGGGTGGGAGTTGG - Intergenic
1168888536 20:1277209-1277231 ACCTGGTTTGTGCTGGGTACGGG - Intronic
1170157149 20:13279419-13279441 ACATGGCTTTGGGTTGGGAGGGG - Intronic
1173565012 20:44032347-44032369 TCCTGGCATCTGGTGGGTAGAGG - Intronic
1174422006 20:50405357-50405379 ACATGACTTATGGTGGGGTGTGG - Intergenic
1175249870 20:57602815-57602837 CCATGGGGTGGGGTGGGTAGTGG - Intergenic
1175471499 20:59233100-59233122 ACATGGCTTGGTGTTGGCAGAGG + Intronic
1175792626 20:61751247-61751269 ACCTGGCGTTTAGTGGGTAGAGG - Intronic
1175956964 20:62616241-62616263 TCCTGGCCTTTGGTGGGTAGGGG + Intergenic
1176081519 20:63275770-63275792 GCATGGCTTGTGCTGGCTGGTGG + Intronic
1177344588 21:19853553-19853575 ACATGGCAAGAGGTGGGGAGAGG + Intergenic
1182598682 22:31442432-31442454 AGAAGGCTTGGGGTGGGTGGTGG - Intronic
1182640879 22:31766344-31766366 ACATTGAGTGTGATGGGTAGTGG - Intronic
1182836110 22:33342680-33342702 AGACGGCTTGCGGTGGGTTGTGG - Intronic
1183618733 22:38960415-38960437 ACATGGTTTGTGCTGAGAAGGGG - Intronic
1183623935 22:38990360-38990382 ACATGGTTTGTGCTGAGAAGGGG - Intronic
1184045849 22:41971775-41971797 ACAAGGCTGCTGGTGGGCAGGGG - Intergenic
1184146278 22:42613306-42613328 ACCTGGCTTGTGGTTCGTAACGG - Intronic
1184220099 22:43094513-43094535 TCAGGGCCTGTGGTGGGAAGTGG - Intergenic
1184807094 22:46802336-46802358 TCAAGGCATGTGGAGGGTAGAGG + Intronic
1185276937 22:49953893-49953915 CCAGGGCCTGCGGTGGGTAGGGG - Intergenic
949310657 3:2694172-2694194 AGATGGCTTCTGATGGGCAGGGG - Intronic
949473974 3:4424979-4425001 AACTGGCATCTGGTGGGTAGAGG - Intronic
949982417 3:9510108-9510130 CCCTGGCATCTGGTGGGTAGAGG - Intronic
951456551 3:22898817-22898839 ACATGTCCAGTGTTGGGTAGAGG - Intergenic
952235767 3:31478303-31478325 GCATGGCTTGTGCTGGTTACAGG - Intergenic
952513245 3:34077873-34077895 GCAAGGCTTGTTGTGGGTACAGG + Intergenic
954706236 3:52482091-52482113 ACAGGGCTTGTGGGAGGTAGTGG + Intronic
955182405 3:56683946-56683968 CCATGGCGTGTGGTGGGGGGGGG - Intergenic
956726603 3:72161800-72161822 AACTGGCCTCTGGTGGGTAGAGG - Intergenic
956856436 3:73279726-73279748 ACATGGGTTGTAATGTGTAGGGG + Intergenic
957364461 3:79204554-79204576 ACATGCTTTGTAGTGGGTTGTGG + Intronic
958495143 3:94835574-94835596 GCATGGTCTGTGGTGGGAAGTGG + Intergenic
958627826 3:96648686-96648708 CAATGGCTGGTGGTGGGTTGGGG - Intergenic
959861729 3:111223977-111223999 CCATGGCTTGTGCTGAGTATTGG - Intronic
962658302 3:137572239-137572261 ACATGTCTTGTGGAAGATAGTGG - Intergenic
962974347 3:140433220-140433242 CCATGGCTTGTGGATGGTGGAGG + Intronic
963550311 3:146713163-146713185 ATATGGCTCATGGTGGGTAAGGG - Intergenic
964855448 3:161141064-161141086 GCATTGCCTGTGGTGGGGAGGGG - Intronic
966461303 3:180179823-180179845 GCATAGCTTGGGGTGGGGAGCGG + Intergenic
967071822 3:185969001-185969023 ACATGGCATGGGGGGGGTGGTGG + Intergenic
967195982 3:187026012-187026034 GCATGGCTCATGGTGGGGAGGGG - Intronic
967888832 3:194350982-194351004 ACAAGGCTGGTAGTGAGTAGAGG - Intronic
967952916 3:194854595-194854617 ACAGGGGTTGTTGGGGGTAGAGG + Intergenic
968005488 3:195239842-195239864 ACATGGGTTCTTGTGGGTTGGGG - Intronic
968243163 3:197111630-197111652 ACATGTCTTGTCTGGGGTAGTGG - Intronic
972385561 4:38562352-38562374 TCCTGGCTTGTGGTGGATTGTGG - Intergenic
973599682 4:52529625-52529647 ACATCTCTGGTGGTGGGTGGGGG - Intergenic
973810110 4:54561134-54561156 ACATGGGTGGTGGTGGGGAGAGG + Intergenic
975697328 4:77026124-77026146 AGATGGCTTGTGGTTGGGACTGG + Intronic
979769732 4:124508046-124508068 ACATTTCTAGTGGTGGGTGGGGG - Intergenic
980330448 4:131403777-131403799 TCATGGCTTCTGTTGGCTAGGGG + Intergenic
981505525 4:145495144-145495166 AAATAGCTTCTAGTGGGTAGAGG + Intronic
985720329 5:1485507-1485529 ACATAGCTTGTGCTGGGCATGGG + Intronic
986006934 5:3676505-3676527 GCATGCCTTGTGTTGGGAAGAGG - Intergenic
988005783 5:25408369-25408391 CCAGGGCCTGTGGGGGGTAGGGG - Intergenic
989697827 5:44224606-44224628 AGGTGACTGGTGGTGGGTAGAGG + Intergenic
989820884 5:45794850-45794872 ACATTCCTGGTGGTGGGTTGTGG + Intergenic
990260398 5:54015702-54015724 ACATAGCTTGAGGTGTGTATGGG + Intronic
990332417 5:54740811-54740833 AACTGGCATCTGGTGGGTAGAGG - Intergenic
992360107 5:76028800-76028822 AGATGGCATCTAGTGGGTAGAGG - Intergenic
992434302 5:76740563-76740585 GCATGGGGGGTGGTGGGTAGGGG - Intergenic
993729101 5:91401347-91401369 ACTTGGCTTCTAGTGGGTTGAGG + Intergenic
995093977 5:108213516-108213538 TCATGGCTTCCGCTGGGTAGGGG + Intronic
996478376 5:123946899-123946921 ATAAGACTTGTGGAGGGTAGGGG - Intergenic
997077457 5:130697326-130697348 ACCTGGATTGTGGTGGCTGGGGG - Intergenic
999480139 5:151940748-151940770 ACATGGGTTGTGGGGGTCAGGGG + Intergenic
1001400956 5:171446230-171446252 GCTAGGCTTGTGGTGGGTGGAGG + Intronic
1001529115 5:172450038-172450060 CCATGGGCTGTGGTGGGAAGGGG + Intronic
1006502428 6:34467012-34467034 ACCTGGGCTGTTGTGGGTAGGGG - Intronic
1007264858 6:40588348-40588370 CCAAGGCATGTGGTAGGTAGCGG + Intergenic
1007387386 6:41528955-41528977 ATAAGGTGTGTGGTGGGTAGGGG + Intergenic
1007682538 6:43644575-43644597 ACCTGGCTTGGGGTGGGGTGCGG + Intergenic
1008892509 6:56511503-56511525 AAATGCCTTGTGATGGGGAGGGG - Intronic
1012433037 6:99186339-99186361 ACATCTCCTGTGGTGGGGAGAGG - Intergenic
1013180486 6:107713302-107713324 ACATGGCTGGTGGGTGGCAGGGG - Intronic
1013386686 6:109638805-109638827 ACATGGCCTGTCGTGGGGTGGGG - Intronic
1013725206 6:113086697-113086719 ACAGGGCCTGTGGGGGGTTGAGG + Intergenic
1013873823 6:114800060-114800082 ACAGGGCCTGTTGTGGGTTGGGG - Intergenic
1014314876 6:119851328-119851350 ACATGTCTGGTGGTGGGTGGGGG - Intergenic
1018442431 6:163825462-163825484 AAATGGCTCTTAGTGGGTAGAGG - Intergenic
1018542502 6:164897781-164897803 ACATGGCTTGTAGTGGTGAAGGG - Intergenic
1019693463 7:2431396-2431418 ACATGGCGTGAGGTGGTTAGAGG - Intronic
1022368775 7:29751212-29751234 CCATGCATTGTGGTTGGTAGTGG - Intergenic
1022758562 7:33321860-33321882 ACATGGCTTTTGTTGTGTTGAGG + Intronic
1023550224 7:41362157-41362179 GCATGGCTTCTGGTGGTTGGTGG + Intergenic
1024292130 7:47812322-47812344 ACATGGGTTGGGGTGGGAAATGG - Intronic
1024452199 7:49560235-49560257 ACAGGGCCTGTTGTGGGTTGGGG + Intergenic
1025088589 7:56043648-56043670 ACAGGGGTTGGGGTGGGTGGGGG - Intronic
1025248823 7:57338086-57338108 ACATGACTTATGGTGGGGTGTGG + Intergenic
1027205350 7:76093559-76093581 ACATGGCAGGAGGTGAGTAGAGG - Intergenic
1027616483 7:80430745-80430767 ACATTTCTGGTGGGGGGTAGGGG - Intronic
1027725792 7:81804544-81804566 ACATGACTTGTGTAGGATAGTGG + Intergenic
1028086373 7:86642539-86642561 CTAAGGCTTGTGGTGAGTAGAGG - Intergenic
1028751598 7:94389723-94389745 AGATAGCTTGGGGTGGGGAGGGG - Intergenic
1028832368 7:95341937-95341959 ACATTCCTGGTGGTGGGCAGTGG - Intergenic
1034704710 7:153130309-153130331 AGATGGCTGGGGGTGGGTGGGGG - Intergenic
1036612238 8:10360342-10360364 ACATGCCTTGTGGTTGTTGGTGG + Intronic
1036751338 8:11445324-11445346 ACAGGACCTGTGGTGGGTGGAGG - Intronic
1037072179 8:14664874-14664896 ATATGGATTGTGGTTAGTAGAGG + Intronic
1037135355 8:15453769-15453791 ACATTCCTGGTTGTGGGTAGGGG - Intronic
1040439221 8:47423688-47423710 AAATGGCATGGGGTGGGCAGGGG + Intronic
1044963519 8:97554181-97554203 CCATGGCATGTAGTGGGTAGAGG - Intergenic
1045333462 8:101177781-101177803 ACATGGCCTATGGATGGTAGTGG + Intergenic
1045458562 8:102406781-102406803 ACAAAGGTTGTGGTGAGTAGAGG - Intronic
1046473381 8:114709178-114709200 CCATGGCATGTGTTGGGTATAGG - Intergenic
1047157532 8:122337584-122337606 TCATGGCTGGCGGTGGGTGGTGG + Intergenic
1050962659 9:11755940-11755962 ATATGGCATGTGTTGGGTTGTGG + Intergenic
1052165919 9:25327628-25327650 CCAGGGCCTGTAGTGGGTAGTGG - Intergenic
1052516541 9:29488180-29488202 ACAAGTATTGTGGTGGGGAGTGG - Intergenic
1052674272 9:31598667-31598689 ACATATCTTTTGGTAGGTAGTGG + Intergenic
1053286933 9:36855728-36855750 ATATGGCTTGTGGCGGGTAGGGG - Intronic
1058093680 9:100834888-100834910 ATAGGACTTGAGGTGGGTAGAGG + Intergenic
1060810268 9:126607949-126607971 ACAGGGGTTGTGGTTGGCAGTGG + Intergenic
1186370082 X:8937619-8937641 TCATGGCTTGTCTTGGCTAGGGG + Intergenic
1187394185 X:18905892-18905914 ACAGGGCTGGTGGCGGGTAAAGG + Intronic
1187950807 X:24468350-24468372 TCATGGCATCTAGTGGGTAGAGG - Intronic
1190123131 X:47679918-47679940 ACTTGGCTGGTGGTGGGGAGAGG + Intergenic
1190414373 X:50166890-50166912 GGATGGCTTGTGGTGGGAATGGG - Intergenic
1190693308 X:52930585-52930607 CCAGGGCCTGTGGTGGGTGGGGG + Intronic
1192417348 X:70994006-70994028 ATATGGCTTGTGTTGTGTTGAGG + Intergenic
1193386849 X:80883056-80883078 ACTTAGCTTGCTGTGGGTAGTGG + Intergenic
1195222579 X:102760731-102760753 ACATGGCTAGTAGGGGGCAGAGG - Intergenic
1196577703 X:117339296-117339318 ATATGGCTTGAGGTGGAAAGTGG - Intergenic
1196701609 X:118675564-118675586 ACAGGGCTTGTTGTGGGGTGGGG + Intronic
1196785542 X:119418738-119418760 GAATGGCTTCTGGTGGGAAGGGG + Intronic
1200067894 X:153513239-153513261 ACATGGCTTCTTGTGGGGGGGGG + Intergenic
1200137549 X:153882375-153882397 ACAGGGCCTGTGCTGGGAAGGGG - Intronic
1200760934 Y:7038528-7038550 TACTGGCTTGTGGTGGGTAGAGG + Intronic