ID: 1079112345

View in Genome Browser
Species Human (GRCh38)
Location 11:17612005-17612027
Sequence CATGGCTTGTGGTGGGTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 433}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079112327_1079112345 19 Left 1079112327 11:17611963-17611985 CCCTGACCCCCGAGCTCACACTA 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1079112345 11:17612005-17612027 CATGGCTTGTGGTGGGTAGGGGG 0: 1
1: 0
2: 1
3: 33
4: 433
1079112329_1079112345 13 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112345 11:17612005-17612027 CATGGCTTGTGGTGGGTAGGGGG 0: 1
1: 0
2: 1
3: 33
4: 433
1079112332_1079112345 10 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112345 11:17612005-17612027 CATGGCTTGTGGTGGGTAGGGGG 0: 1
1: 0
2: 1
3: 33
4: 433
1079112331_1079112345 11 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112345 11:17612005-17612027 CATGGCTTGTGGTGGGTAGGGGG 0: 1
1: 0
2: 1
3: 33
4: 433
1079112328_1079112345 18 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112345 11:17612005-17612027 CATGGCTTGTGGTGGGTAGGGGG 0: 1
1: 0
2: 1
3: 33
4: 433
1079112330_1079112345 12 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112345 11:17612005-17612027 CATGGCTTGTGGTGGGTAGGGGG 0: 1
1: 0
2: 1
3: 33
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079112345 Original CRISPR CATGGCTTGTGGTGGGTAGG GGG Intronic
901417613 1:9128529-9128551 CACTGCTTGCTGTGGGTAGGGGG + Intronic
901957674 1:12798087-12798109 CATGGTTGGTGGTGGGAGGGAGG + Intergenic
902785512 1:18730521-18730543 CAGGGTTTGTGGTGGGTGGGTGG - Intronic
903232297 1:21929316-21929338 CCTGGCTGGAGATGGGTAGGGGG + Intronic
903417212 1:23192019-23192041 CAAAGCTTGCGGTGGGTGGGGGG + Exonic
903484493 1:23679474-23679496 CATGGGTTGTGATGGGCATGGGG + Intergenic
905099530 1:35506970-35506992 CATGTCTTTTGGTGGCTAGAAGG - Exonic
905174632 1:36127740-36127762 AATGGCATGTGGCTGGTAGGTGG - Intergenic
905277031 1:36825025-36825047 CCTGGCTGGTGGGTGGTAGGAGG - Intronic
906014561 1:42563444-42563466 CAGGGCCTGTTGGGGGTAGGGGG + Intronic
907058134 1:51391302-51391324 CATGGCCTTTCGTGGGTTGGGGG + Intronic
908016050 1:59837847-59837869 CAGGGCCTGTGGGGGGTGGGGGG - Intronic
909654915 1:78021135-78021157 CAGGGCCTGTTGTGGGTTGGGGG - Intronic
909805286 1:79867265-79867287 CATGGCCTGTTGTGGGGTGGAGG - Intergenic
909853771 1:80502653-80502675 CAGGGCCTGTCGTGGGTGGGGGG + Intergenic
910925528 1:92394314-92394336 CAGGGCCTGTGGGGGGTGGGGGG + Exonic
911516640 1:98875783-98875805 CAGGGCTTGTTGTGGGGTGGGGG - Intergenic
911713794 1:101107621-101107643 CAGGGCCTGTGGTGGGGTGGGGG - Intergenic
911932861 1:103927132-103927154 CATGGCACCTGGTGGGTATGTGG + Intergenic
912140754 1:106723201-106723223 AATGGTTTGGGGTGGGGAGGGGG - Intergenic
913090519 1:115473712-115473734 AAGGGAATGTGGTGGGTAGGAGG + Intergenic
913332212 1:117677059-117677081 CATGGCCTGTAGGGGTTAGGGGG - Intergenic
915893581 1:159793619-159793641 CTTAGCTGGTGGTGGGGAGGGGG - Intergenic
916018325 1:160770406-160770428 CCTGGCTTTTTGTGGGTAAGTGG + Intergenic
917968515 1:180193317-180193339 GAGGCCTTGTGGTGGGGAGGTGG + Intronic
918259937 1:182786504-182786526 TATGGCTGGGGGTGGGGAGGGGG + Intergenic
918665306 1:187143383-187143405 CAGGGCCTGTGGGGGGTTGGGGG + Intergenic
920349122 1:205326078-205326100 CATGGCATGGTGTGGGTTGGTGG - Intergenic
921803002 1:219422969-219422991 CATGGGTTCTTGTGGGAAGGAGG - Intergenic
921940732 1:220836411-220836433 AATGGCTGCTGGTGGGAAGGTGG + Intergenic
922571826 1:226638937-226638959 CCTGGCGTGCGGCGGGTAGGCGG - Intronic
923039323 1:230308589-230308611 CAGGGCTAGGGGTGGGGAGGCGG + Intergenic
923215706 1:231845945-231845967 CAGGGCTCGGGGTGGGGAGGAGG + Intronic
924184532 1:241474422-241474444 CAGGGTTGGTGGTGGGAAGGAGG - Intergenic
924708769 1:246518166-246518188 CCTGGGTGGTGGTGGGTGGGAGG - Intergenic
1063214993 10:3916268-3916290 CATGGAGTGTGGTGGGATGGTGG + Intergenic
1063267360 10:4468589-4468611 CATGGCCTGGTGTGGGGAGGTGG - Intergenic
1063524833 10:6775344-6775366 CAGGGCATGTGGTGGGTGTGAGG - Intergenic
1064169937 10:13022093-13022115 CATCTCTTGTGGTGGGCTGGGGG - Intronic
1064178417 10:13095420-13095442 CATGGATGGTGGTGGGTGGGGGG + Intronic
1064206756 10:13330987-13331009 CAGGGCCTGTCGGGGGTAGGGGG - Intronic
1067903889 10:50270838-50270860 CAGGGCCTGTTGTGGGTTGGTGG + Intergenic
1068603616 10:58981175-58981197 CAAGGCTTGTTGTGGGTTAGCGG + Intergenic
1068765549 10:60759232-60759254 CATGGATGGAGGTGGGTGGGGGG + Intergenic
1069873530 10:71547642-71547664 CAGGGGTGGTGGTGGGTGGGAGG + Intronic
1071516189 10:86299488-86299510 CAGGGCCTGTTGTGGGGAGGGGG - Intronic
1072287838 10:93933652-93933674 CATGACCTGTCGTGGGTTGGGGG + Intronic
1072631922 10:97152182-97152204 GCTGGCATGTGGTGGGCAGGAGG - Intronic
1072674545 10:97455796-97455818 GAAGGCTCGGGGTGGGTAGGTGG + Intronic
1072736948 10:97885632-97885654 GATGGATTGGGGTGGGGAGGAGG + Intronic
1073777087 10:106798440-106798462 CAGGGCCTGTCGTGGGTGGGGGG - Intronic
1074009682 10:109465243-109465265 CATGGCTAGAGGTGGGGAGCTGG + Intergenic
1074425766 10:113349829-113349851 TAATGCTTGTGGTGGCTAGGAGG + Intergenic
1074781589 10:116806285-116806307 GATGGCTTGAGCTGGGGAGGTGG - Intergenic
1075783684 10:125033693-125033715 CAGTGCTTGGGGTGGGCAGGGGG - Intronic
1075856121 10:125631671-125631693 CCTCCCTTCTGGTGGGTAGGGGG + Intronic
1076516611 10:131048798-131048820 CAGGGGTTCTTGTGGGTAGGCGG - Intergenic
1077808391 11:5611827-5611849 CAGGTCTTGAGGTGGATAGGGGG + Exonic
1078080360 11:8199898-8199920 CATGGCTGGAGGAGTGTAGGGGG - Intergenic
1078642375 11:13108638-13108660 CAGGGCTTGTGGAGGGAAGAGGG + Intergenic
1079112345 11:17612005-17612027 CATGGCTTGTGGTGGGTAGGGGG + Intronic
1079221316 11:18563502-18563524 GATGGCTTGAGCTGGGGAGGTGG + Intronic
1079429100 11:20371516-20371538 GATTGCTTGAGCTGGGTAGGTGG - Intronic
1080330366 11:31130435-31130457 CATGGGGTGGGGTGGGCAGGCGG - Intronic
1082064628 11:47889875-47889897 CATGGCTCGTGGCAGGTATGTGG + Intergenic
1082139645 11:48593517-48593539 CAGGGCCTGTTGTGGGTTGGTGG + Intergenic
1082987078 11:59178256-59178278 CATGTATGTTGGTGGGTAGGGGG + Intronic
1083428779 11:62602917-62602939 CGTGGGTGGCGGTGGGTAGGAGG - Intronic
1084502568 11:69543571-69543593 CATGGCTTATGGAGGGAATGGGG + Intergenic
1084537360 11:69764893-69764915 CATGTCCTGTGGTGGGGAAGGGG - Intergenic
1085003305 11:73061223-73061245 CATGGCTTCCCCTGGGTAGGGGG - Intronic
1085267430 11:75245544-75245566 AATGGCTGGGGGTAGGTAGGAGG + Intergenic
1085368244 11:75973710-75973732 CAGGGCCTGTCGTGGGTTGGGGG - Intronic
1085702979 11:78761700-78761722 CATGGCTTGTCGGGGCTGGGGGG - Intronic
1086470788 11:87107417-87107439 CAGGGCTTGTCGTGGGGTGGGGG - Intronic
1086545967 11:87967863-87967885 AATGCCCTGCGGTGGGTAGGAGG + Intergenic
1087719401 11:101644875-101644897 CAGGGCCTGTTGTGGGTGGGGGG + Intronic
1088108740 11:106236502-106236524 CATGCCTTATGGTGGCAAGGTGG + Intergenic
1089067120 11:115670424-115670446 GATGGCTGCTGGTGAGTAGGGGG + Intergenic
1089159649 11:116427876-116427898 GAGGGCTGGTGGTGGGTGGGAGG - Intergenic
1090754997 11:129782729-129782751 CAGGGCCTGTCGTGGGGAGGCGG + Intergenic
1091741653 12:2963871-2963893 CTTGGCTTGGTGTGGGCAGGCGG + Intronic
1092946364 12:13457818-13457840 GTTGGCTGGTGGTGGGGAGGTGG + Intergenic
1095319790 12:40813347-40813369 CCTGGCCTGTTGTGGGTTGGGGG - Intronic
1096075289 12:48800234-48800256 TATGGCTTGGGGTGGGGAGTGGG + Intergenic
1096365281 12:51023983-51024005 CTTGTCTTGTGGGGGGTGGGAGG + Intronic
1096453959 12:51770049-51770071 CAGGGCTAGTGGTGGGTGAGGGG + Intronic
1097656048 12:62364714-62364736 CAGGGCTTGTTGGGGGTTGGGGG - Intronic
1097916872 12:65030614-65030636 CAGGGCTTGTCGTGGGGTGGGGG - Intergenic
1098038688 12:66333232-66333254 CAGGGGGTGTGGTGGGCAGGAGG + Intronic
1098347726 12:69524066-69524088 CATGGCTGGAGGAGGGCAGGGGG + Intronic
1099045066 12:77707211-77707233 CAGGGCTTGTTGTGGGGTGGGGG - Intergenic
1099596543 12:84673473-84673495 CATGGCCTGAGGTGGGGAGTGGG + Intergenic
1099614698 12:84919580-84919602 TATTGCTTGTGGTGGGGAGGGGG - Intergenic
1099819819 12:87695684-87695706 CAGGGCTTGTCGTGGGGTGGGGG - Intergenic
1100494160 12:95109376-95109398 ACTGGCCTTTGGTGGGTAGGAGG + Intronic
1100686467 12:96991893-96991915 CATGGCTATTGGTGGGGACGAGG - Intergenic
1101406985 12:104437270-104437292 CATTCCTGGTGGTGGGTGGGGGG + Intergenic
1101459696 12:104878465-104878487 CAGGGCCTGTGGTGGGGTGGGGG - Intronic
1101672802 12:106892390-106892412 CCTGGCTTATGCTGGGGAGGTGG - Intergenic
1101877509 12:108605645-108605667 CCTGGTTAGTGGTGGTTAGGTGG + Intergenic
1101900201 12:108786356-108786378 CAAAGCTTGTGGTCGGGAGGAGG + Exonic
1101901603 12:108794850-108794872 CATAGATTGTGGGGGGTGGGTGG + Intronic
1103502742 12:121416295-121416317 CGTAGCTGCTGGTGGGTAGGTGG - Exonic
1103863113 12:124029933-124029955 CCTGGGTTGTGGTGGGCAGTAGG + Intronic
1104006948 12:124899785-124899807 CATGCATGGTGGTGGGCAGGAGG - Intergenic
1104088820 12:125497339-125497361 CATGGCCTGTGCTGGGTGTGGGG + Intronic
1104289310 12:127454339-127454361 CCAGGCTTGTGGGGGGTTGGGGG + Intergenic
1104868663 12:131977850-131977872 CATGGCTGGTGGTGGCTGTGTGG + Intronic
1104926013 12:132314162-132314184 AATGGATGATGGTGGGTAGGTGG - Intronic
1106075438 13:26456768-26456790 CATGGGTTGGGGCGGGGAGGGGG + Intergenic
1106653061 13:31712661-31712683 CATGGCCTGTTGTGGGGTGGGGG - Intergenic
1108661938 13:52595602-52595624 CTTTGGTGGTGGTGGGTAGGGGG + Intergenic
1109261469 13:60149902-60149924 CATGGCAGGTGGTGGGGAGGGGG + Intronic
1109268840 13:60231809-60231831 CGGGGCTTGTCGTGGGTGGGAGG + Intergenic
1109496525 13:63178828-63178850 CATGTGTTGTGGTGGGGAGTTGG + Intergenic
1109867494 13:68284402-68284424 CTTGTCTTGGGGTGGGGAGGGGG + Intergenic
1110499242 13:76207477-76207499 CAGGGCCTGTGGGGGGTAGGGGG - Intergenic
1110504329 13:76267998-76268020 CATGGCCTGTTGTGGGGTGGGGG - Intergenic
1112057824 13:95707033-95707055 CATGGACTGGGTTGGGTAGGGGG + Intronic
1113386117 13:109849954-109849976 CGTGGCCTGTGGTGGGGTGGGGG - Intergenic
1113641918 13:111963670-111963692 CAGGGTTTGTTGGGGGTAGGAGG + Intergenic
1114363793 14:22005153-22005175 CAGGGCCTGTTGTGGGTGGGAGG - Intergenic
1115624331 14:35174895-35174917 CAGGGCTTGTCGTGGGGTGGGGG - Intronic
1115883513 14:37946141-37946163 CATAGCTGGTGGTGAGTAGGGGG - Intronic
1116989205 14:51256554-51256576 AATTGATTATGGTGGGTAGGTGG - Exonic
1117489736 14:56234589-56234611 CAGGGCCTGTGGTGGGTTGTGGG + Intronic
1120067532 14:80060965-80060987 CGTGGTTTGGGGTGGGTGGGTGG + Intergenic
1121266699 14:92608000-92608022 CAGGGCTAGTGATGGGGAGGGGG + Intronic
1121472656 14:94167284-94167306 CAGGGTTTGGGGTGGGAAGGAGG + Intronic
1121522113 14:94593289-94593311 CAAGGCTTGAAGTGGTTAGGTGG + Intronic
1121579296 14:95014760-95014782 CATGGCTAGTGGAGGCTAAGTGG - Intergenic
1121946734 14:98130245-98130267 CCTGTGTTGTGGTGGGTGGGTGG + Intergenic
1122160894 14:99783144-99783166 CAGGGCCTGTTGTGGGTGGGGGG - Intronic
1122423012 14:101589214-101589236 CAGGCCTGGTGGTGGGTGGGGGG + Intergenic
1202887899 14_KI270722v1_random:125614-125636 CATGGCCTGTTGTGGGGTGGGGG + Intergenic
1123486540 15:20745259-20745281 CAGGGCCTGTTGTGGGTTGGGGG - Intergenic
1124029055 15:25992603-25992625 CATGGGCTGTGGAGGGTAGAGGG - Intergenic
1125601540 15:40918329-40918351 CAGGGCATGGGGTGGGGAGGGGG + Intergenic
1127446977 15:59073084-59073106 GATTGCTTGAGCTGGGTAGGTGG + Intronic
1128546734 15:68573489-68573511 GAAGGGTTGTGGTGGGTAGAGGG + Intergenic
1128580316 15:68805392-68805414 CATGGCTGGGTGTGGGGAGGGGG - Intronic
1129195792 15:73965440-73965462 CAGAGCATGTGGTGGGCAGGAGG - Intergenic
1130876483 15:88018953-88018975 CATAGCTTTTGGAGAGTAGGTGG - Intronic
1132152277 15:99470923-99470945 CATGTCATGTGGTGGGTGGAAGG - Intergenic
1132159932 15:99531242-99531264 TAGGGCTTGTTGTGGGTGGGGGG - Intergenic
1133567029 16:7005587-7005609 GATGGCTTGGTGTTGGTAGGAGG + Intronic
1134431620 16:14214044-14214066 GGTGGCTTGTTGTGGGTAAGTGG - Intronic
1135005001 16:18812822-18812844 CGGGGCTTGTTGTGGGTGGGGGG - Intronic
1137946159 16:52734984-52735006 CTTAGCTTGTGGTGGACAGGTGG - Intergenic
1138160403 16:54747794-54747816 CAAGGCTTGTGGCGGGGGGGGGG - Intergenic
1138418629 16:56885512-56885534 CCTGTCTTGTGGTGGCTGGGTGG - Intronic
1139075737 16:63444745-63444767 CAGGGCTTGTTGTGGGGTGGGGG + Intergenic
1139349667 16:66327231-66327253 CATCGCCTGTGGGGGGTGGGGGG + Intergenic
1140657531 16:77155843-77155865 CAGGGCCTGTGGGGGGTGGGGGG + Intergenic
1140870372 16:79100975-79100997 AAGGTCTTGTGGTGGGCAGGGGG + Intronic
1141052764 16:80786908-80786930 CAGGGCCTGTGGGGGGTGGGGGG + Intronic
1141145079 16:81523630-81523652 CATGGCTTTTCGCGGGAAGGGGG - Intronic
1141441594 16:84032939-84032961 CATGGGTGGGTGTGGGTAGGTGG + Intronic
1141665207 16:85462322-85462344 CCTGGCTTTTGCTGGGCAGGAGG + Intergenic
1141789618 16:86225761-86225783 AATGGGTGGTGGTGGGTGGGTGG - Intergenic
1141900440 16:86987203-86987225 CAAGGCCTGGGGTGGGCAGGAGG - Intergenic
1142399539 16:89852094-89852116 CATGGGATCTGGTGGGTGGGGGG - Intronic
1142399601 16:89852250-89852272 CATGGGATCTGGTGGGTGGGGGG - Intronic
1142854445 17:2722028-2722050 TATGGCTTTTAGTGGGTGGGTGG + Intergenic
1143211828 17:5193662-5193684 CAGGGCTGGTGGGGGGTGGGGGG + Intergenic
1143633511 17:8151758-8151780 CAAGGCTTGGGGTTGGTGGGGGG - Intronic
1144715323 17:17431293-17431315 CATGGCCTGTTGTGGGGTGGGGG + Intergenic
1147624512 17:41891283-41891305 CATGGCTTGTGTTTGTTGGGCGG - Intronic
1148091904 17:45027632-45027654 CATGGGTTTTGGTGGGTGAGTGG - Intronic
1149175087 17:53859738-53859760 CATGGCTTGTTGTGGGCTGGGGG + Intergenic
1150279217 17:63919177-63919199 AATGGGATGTGGTCGGTAGGGGG - Intergenic
1152747802 17:82049263-82049285 CATGGCATGAGCTGAGTAGGGGG + Intronic
1153804551 18:8700976-8700998 CTTGGCGGGTGGTGGGGAGGCGG + Intergenic
1154364619 18:13695702-13695724 CAGGGCCTGCGGTGGGTGGGGGG + Intronic
1155065540 18:22266039-22266061 CATGGCATGTGGGAGGGAGGGGG - Intergenic
1155963631 18:32016650-32016672 CATGGGTGGTGGGGGGCAGGCGG - Intergenic
1156176118 18:34548663-34548685 CCTGGCTTGGGATGGTTAGGAGG - Intronic
1156457655 18:37303814-37303836 CATGGGGTGGGGTGGGGAGGAGG - Intronic
1156506841 18:37601498-37601520 CATGGCCTGTCGTGGGGTGGGGG - Intergenic
1156756516 18:40533967-40533989 CAGGGCCTGTGGTGGGGTGGAGG + Intergenic
1156766445 18:40662614-40662636 CAGGGCGTGTGGTGGGGATGTGG + Intergenic
1157216955 18:45792187-45792209 CAGGGCTTGTGGGGGGTGGAGGG + Intergenic
1158053761 18:53255368-53255390 CATGGCCTGTTGTGGGGTGGGGG - Intronic
1158393338 18:57061212-57061234 CATGGCTGGTGGGGCTTAGGTGG + Intergenic
1160296534 18:77643094-77643116 CAGGGCTTGTCGTGGGGTGGAGG + Intergenic
1160428230 18:78792940-78792962 CATGGCCTGTGGACGGTGGGTGG + Intergenic
1160989278 19:1853967-1853989 CATGGCTTTCGGTGGGGTGGGGG + Exonic
1161157930 19:2743577-2743599 CATGGCTTCTGGTGCACAGGAGG - Intergenic
1161378228 19:3950836-3950858 CAGGGGTTGGGGTGGGGAGGGGG + Intergenic
1161916651 19:7233424-7233446 CCTGGCATGTGCTAGGTAGGGGG + Intronic
1162967630 19:14163579-14163601 TATGGCTGGTGATGGGAAGGGGG + Intronic
1163298914 19:16430647-16430669 CATGCCTTGTGCTGGGCAGTGGG - Intronic
1163408438 19:17138053-17138075 CAGGGCCTGTAGGGGGTAGGGGG - Intronic
1163587691 19:18173045-18173067 CAAGGCTTGTGGGGGGTGGGGGG - Intronic
1163634372 19:18431474-18431496 CATGGCTTGAGGGTGGGAGGGGG - Intronic
1165767832 19:38361967-38361989 CAGGACTGGTGGTGGGTGGGCGG + Intronic
1165924348 19:39318107-39318129 GAGGGCTTGTGGTGGCCAGGTGG - Intergenic
1165950659 19:39472512-39472534 CAGGGGATGTGGTGGGTAGAAGG + Intronic
1166794711 19:45419517-45419539 CATGGCTCGCGGTGGGAAGCAGG + Intronic
1167159787 19:47759854-47759876 TGTGGCATGTGGTGGGGAGGTGG - Intergenic
1167569906 19:50280521-50280543 CATGGGCTGTGGGGGGTAAGGGG - Intronic
925408535 2:3625377-3625399 GCTGCCTTGTGGTGGGTGGGGGG + Intronic
929592406 2:43155856-43155878 CATGGCATGTGGAGGGTACGAGG - Intergenic
929666869 2:43840120-43840142 CTTTGCCTGTTGTGGGTAGGAGG + Intronic
929913430 2:46113660-46113682 CCTGGCTTGCAGTGGGAAGGGGG + Intronic
929920701 2:46169228-46169250 CATTGTTTGTGCTGGGGAGGGGG + Intronic
930151977 2:48068618-48068640 AATGGCGAGTGGTGGGTGGGTGG + Intergenic
930729673 2:54715916-54715938 TATAGCTGGAGGTGGGTAGGCGG - Intergenic
932787407 2:74619162-74619184 CTTGACTTTTGGTGGGTAGGAGG - Intronic
932815239 2:74855974-74855996 CATGACGGGTGGTGGGTGGGGGG + Intronic
935918073 2:107979456-107979478 CAGGGCCTGTGGTGGCTGGGGGG + Intergenic
935991353 2:108721525-108721547 CATCGCTTGAGCTGGGGAGGCGG - Intronic
936133763 2:109871195-109871217 CATGGTATGTGGTGGGAAGGGGG - Intergenic
936210934 2:110500290-110500312 CATGGTATGTGGTGGGAAGGGGG + Intergenic
936435462 2:112501393-112501415 CATGGTATGTGGTGGGAAGGGGG + Intronic
936897750 2:117447007-117447029 CAGGGCTTGTCGGGGGTTGGGGG - Intergenic
937358408 2:121212579-121212601 CATGGCTTGTAGTGGCTGGGTGG - Intergenic
937454572 2:122030304-122030326 CATAGCCTGTGGTAGTTAGGTGG + Intergenic
937875590 2:126823160-126823182 CAGGGCTGGAGGTGGGAAGGCGG - Intergenic
937905188 2:127049675-127049697 CTTTGCTTGTGGGGGGTCGGTGG - Intronic
938586866 2:132699482-132699504 CAGGGCCTGTCGTGGGGAGGGGG - Intronic
938909561 2:135874213-135874235 AATGTGATGTGGTGGGTAGGTGG + Intronic
939473295 2:142652976-142652998 CAGGGCCTGTCGGGGGTAGGGGG - Intergenic
940042507 2:149375325-149375347 CATGGACTGTGGGAGGTAGGTGG + Intronic
940312365 2:152292117-152292139 CATGGATGGTGGTGGGGTGGGGG - Intergenic
941345298 2:164361352-164361374 CAGGGCTTGTTGTGGGGTGGGGG + Intergenic
943291555 2:186078630-186078652 CAGGGCCTGTTGTGGGTGGGGGG + Intergenic
944155111 2:196599467-196599489 AATGGCTTGTGGGAGGGAGGAGG + Intergenic
944630393 2:201618547-201618569 CACGGCCTGTCGTGGGTTGGGGG + Intronic
945136824 2:206638614-206638636 CAGGTAGTGTGGTGGGTAGGGGG - Intergenic
945467595 2:210187301-210187323 CAGGGCCTGTGGAGGGTAGGGGG + Intergenic
945734611 2:213584208-213584230 CATGCCTGGTGGTGTGTTGGAGG + Intronic
945734672 2:213584836-213584858 CATGCCTGGTGGTGTGTTGGAGG + Intronic
945818293 2:214632522-214632544 CAGGGCTTGTTGTGGGGTGGGGG - Intergenic
946147495 2:217741923-217741945 CATGCCCTGTGGGGGGTATGAGG - Intronic
946308927 2:218872159-218872181 CAAAGCTTGCAGTGGGTAGGAGG + Intronic
946537143 2:220643391-220643413 CATGGTGGGTGGTGGGTATGAGG + Intergenic
946760405 2:222988140-222988162 CATGGCTAGTGGGGGGGAGCGGG + Intergenic
946923144 2:224599828-224599850 CTTGGTTTGCGGTGGGTATGGGG + Intergenic
947523608 2:230865801-230865823 CAGGGCGTGGGGTGGGAAGGGGG - Intronic
948664148 2:239524030-239524052 CAGGGCTGGGGGTGGGCAGGGGG - Intergenic
948776258 2:240290444-240290466 CTGTGCTTGTGGTGGGGAGGCGG - Intergenic
948965241 2:241374560-241374582 CATTGCATGGGGTGGGAAGGAGG + Intronic
1168816582 20:741800-741822 CATGGCTGGAGCGGGGTAGGAGG - Intergenic
1168888534 20:1277208-1277230 CCTGGTTTGTGCTGGGTACGGGG - Intronic
1169863330 20:10173921-10173943 AATAGATTGGGGTGGGTAGGTGG - Intergenic
1174532663 20:51226358-51226380 AATCGCTTGTACTGGGTAGGTGG + Intergenic
1174539048 20:51275052-51275074 CAGGGCTTGTGGGTGGGAGGGGG + Intergenic
1175956966 20:62616242-62616264 CCTGGCCTTTGGTGGGTAGGGGG + Intergenic
1176316379 21:5248486-5248508 CATGGACTGTTGTGGGTTGGGGG - Intergenic
1176545854 21:8198371-8198393 CATCGCTTGGGGTCGGGAGGTGG - Intergenic
1176564805 21:8381416-8381438 CATCGCTTGGGGTCGGGAGGTGG - Intergenic
1176936992 21:14878797-14878819 CACGTGTTGTGGTGGGTCGGGGG - Intergenic
1178363984 21:31973309-31973331 CAGGGCCTGTGGTGGGGAAGGGG - Intronic
1178369586 21:32016507-32016529 CATGAATTGGGGTGGGTAGCAGG - Intronic
1178604387 21:34023080-34023102 CATGCCATTTGGTGGGTGGGTGG + Intergenic
1179389386 21:40973666-40973688 CAGGGCTTGTTGTGGGGTGGGGG + Intergenic
1180016625 21:45090417-45090439 CCTGGCTTTTGGTGGGAAGGAGG + Intronic
1180330042 22:11469336-11469358 CATGGCCTGTTGTGGGGTGGGGG + Intergenic
1181633245 22:24162331-24162353 CATGGCTGGTGGTGGGTCTTAGG + Intronic
1181752350 22:24997560-24997582 CATGGCTTGTGGGAGGCTGGTGG + Intronic
1182254802 22:29030733-29030755 CAGGGCTGGTGGAGGGGAGGAGG + Intronic
1182515448 22:30856119-30856141 CATGGCCTGAGGTGGGCAGGTGG + Intronic
1184045848 22:41971774-41971796 CAAGGCTGCTGGTGGGCAGGGGG - Intergenic
1184078777 22:42202679-42202701 CTTGGCTTGGGGTGCGGAGGAGG + Intronic
1184164089 22:42717270-42717292 AAGGGCTTGTGGTTGGTATGTGG + Intronic
1184220098 22:43094512-43094534 CAGGGCCTGTGGTGGGAAGTGGG - Intergenic
1184292594 22:43506026-43506048 CCTGGGTTGGGGTGGGTGGGAGG + Exonic
1184895187 22:47402627-47402649 CAGGGCTTCTCGTGGGTGGGCGG + Intergenic
1184901254 22:47447929-47447951 CATGGAGTGGGGTGGGTTGGAGG + Intergenic
1185276936 22:49953892-49953914 CAGGGCCTGCGGTGGGTAGGGGG - Intergenic
1203250725 22_KI270733v1_random:114608-114630 CATCGCTTGGGGTCGGGAGGTGG - Intergenic
949310656 3:2694171-2694193 GATGGCTTCTGATGGGCAGGGGG - Intronic
949745708 3:7289846-7289868 CATGGCCTGTTGTGGGGTGGGGG + Intronic
950390716 3:12694427-12694449 CAGGCCCTGTGATGGGTAGGAGG - Intergenic
950740845 3:15050770-15050792 GATGGCTTGTCGGGGGTGGGAGG - Exonic
951495967 3:23326826-23326848 CAGGGCCTGTGGTGGGGTGGGGG - Intronic
952820433 3:37481634-37481656 TAGGGCATGAGGTGGGTAGGGGG - Intronic
953523436 3:43665362-43665384 CAGGGCCTGTGGGGGGTGGGCGG + Intronic
954077874 3:48194486-48194508 TATGGCTTGGGGTGGTGAGGTGG + Intergenic
954647629 3:52141183-52141205 CATGGCTTGTGGGCAGTAGGTGG + Intronic
954828478 3:53397119-53397141 CCTGTCGTGAGGTGGGTAGGAGG + Intergenic
955223909 3:57045525-57045547 CATTGCTTGTGGTGAGGAGGAGG - Intronic
956235840 3:67069880-67069902 AATGGGTTGTGGTGGTGAGGAGG + Intergenic
956632624 3:71331368-71331390 CATGGCGGGGGGTGGGGAGGGGG - Intronic
956800469 3:72753468-72753490 CAGGGGTTGTGGGGGGTGGGGGG - Intronic
957530242 3:81431515-81431537 CAGGGCTTGTTGGGGGTGGGGGG + Intergenic
957964505 3:87305023-87305045 CATGGCCTGTGGAGGCTGGGGGG - Intergenic
958061888 3:88494431-88494453 CAGGGCCTGTTGTGGGTTGGGGG - Intergenic
958475513 3:94575849-94575871 CATAGCTTCTGGTGGTTTGGGGG + Intergenic
958627825 3:96648685-96648707 AATGGCTGGTGGTGGGTTGGGGG - Intergenic
960469782 3:118048659-118048681 CAGGGCTTGTTGTGGGGTGGGGG - Intergenic
960587204 3:119331018-119331040 CATGGCTAGTGGTGGGAGTGAGG + Intronic
961249978 3:125493565-125493587 AATGGCTTGAGCTGGGGAGGTGG + Intronic
961583135 3:127899598-127899620 CATGGCTTGGGGCTGGTAGAAGG + Intergenic
962151186 3:132895062-132895084 CAGGGCCTGTGGTGGGGTGGGGG + Intergenic
963098619 3:141575088-141575110 AATGGGAGGTGGTGGGTAGGAGG + Intronic
963288359 3:143460637-143460659 CATGGCTTGTGGATGATAGCTGG + Intronic
963931289 3:151006640-151006662 CAGGGCCTGTGGGGGGTGGGGGG - Intergenic
964385936 3:156147918-156147940 CTTGGCATGTGGTGGGATGGAGG - Intronic
964584531 3:158282081-158282103 CAGGGCTGGGGGTGGGGAGGTGG - Intronic
964855447 3:161141063-161141085 CATTGCCTGTGGTGGGGAGGGGG - Intronic
965003713 3:162988754-162988776 CATGGCATGTGGTGTTTAAGGGG + Intergenic
966737498 3:183199779-183199801 CAGGGCCTGTGGTGGGGTGGGGG - Intronic
966941753 3:184752406-184752428 AATGGCCTGTGGTGCCTAGGAGG + Intergenic
967195981 3:187026011-187026033 CATGGCTCATGGTGGGGAGGGGG - Intronic
967982725 3:195075515-195075537 CAGGGCTTGTTTTGGGTAGGTGG - Intronic
969640456 4:8395281-8395303 GATGGTGGGTGGTGGGTAGGTGG + Intronic
973596758 4:52499542-52499564 CATGGCCTGTTGTGGGGCGGGGG - Intergenic
974728927 4:65835992-65836014 CTTGGCATGTCGTGGGGAGGAGG - Intergenic
974820228 4:67058122-67058144 CAGGGCCTGTGGCGGGTGGGGGG - Intergenic
975701802 4:77074960-77074982 CAGGGCTTGGGGCGGGTGGGTGG - Intronic
976733636 4:88288387-88288409 CAGGGCTTTGGGTGGGTGGGTGG + Intergenic
977839314 4:101682233-101682255 GATGGCTCGTGGTGGGGTGGAGG + Intronic
978101421 4:104845542-104845564 CCTGTCTTGTTGGGGGTAGGGGG + Intergenic
978236986 4:106471792-106471814 CATGGCTTCCTTTGGGTAGGGGG + Intergenic
978289544 4:107120783-107120805 CCTGGCTGGGGGTGGGGAGGTGG + Intronic
979769731 4:124508045-124508067 CATTTCTAGTGGTGGGTGGGGGG - Intergenic
980744160 4:136993669-136993691 CATGGCCTGTTGGGGGTGGGGGG - Intergenic
983367491 4:166812897-166812919 TATGGCTTTTGGGGGGTTGGTGG + Intronic
983399135 4:167240968-167240990 CATGTCTTGTGGAGGGAAGAAGG + Intergenic
983403447 4:167295122-167295144 CATGGCTTATGCTAGGAAGGAGG - Intergenic
983464520 4:168070245-168070267 CAGGGCCTGTCGTGGGTTGGGGG + Intergenic
983962196 4:173768356-173768378 CAGGGCCTGTTGTGGGTTGGGGG - Intergenic
985820849 5:2159232-2159254 CCTGGTTGGTGCTGGGTAGGGGG + Intergenic
987444852 5:18005090-18005112 CAGGGCCTGTGGGGGGTAGGTGG - Intergenic
988005782 5:25408368-25408390 CAGGGCCTGTGGGGGGTAGGGGG - Intergenic
990151263 5:52820361-52820383 CAGGGCCTGTTGTGGGTGGGGGG + Intronic
990872146 5:60443957-60443979 CATGGCTTTGGGTGAGTGGGTGG - Intronic
991217504 5:64172375-64172397 CATTCCTTGTGGGGGGTGGGGGG - Intronic
991438353 5:66619021-66619043 CAAGTCTTGTGGAGGGTAGTAGG + Intronic
992434301 5:76740562-76740584 CATGGGGGGTGGTGGGTAGGGGG - Intergenic
993117114 5:83732737-83732759 CAGGGCCTGTTGGGGGTAGGGGG - Intergenic
994109138 5:95980898-95980920 CATGGGTATTGGTGGGCAGGAGG - Intergenic
994477435 5:100289061-100289083 CATGGCCTGTTGTGGGGTGGGGG + Intergenic
994964644 5:106653262-106653284 CAGGGCCTGTTGGGGGTAGGGGG + Intergenic
995993790 5:118274431-118274453 CAGGGCCTGTCGTGGGTTGGGGG + Intergenic
998204605 5:140149644-140149666 CATGGCTGGTGGCTGGGAGGAGG + Intergenic
999480140 5:151940749-151940771 CATGGGTTGTGGGGGTCAGGGGG + Intergenic
1001072832 5:168601551-168601573 CTTGGCTTGTGGTGGGAGGAAGG + Intergenic
1001287123 5:170431776-170431798 CATGGGTCCTGCTGGGTAGGTGG - Intronic
1001875609 5:175197826-175197848 CAGGGCATGTGGTGTGTAGCTGG + Intergenic
1002011913 5:176290243-176290265 CAAGGCTCGTGGTGGGCATGAGG - Intronic
1002058725 5:176613633-176613655 CATGGGCTGGGGTGGGGAGGTGG - Intergenic
1003396696 6:5759491-5759513 CATGGCATATGGTGGGTGGTCGG + Intronic
1003540500 6:7014268-7014290 CAGGGCCTGTTGGGGGTAGGGGG - Intergenic
1003854080 6:10254313-10254335 CAGGGCCTGTCGGGGGTAGGGGG + Intergenic
1004447126 6:15710622-15710644 CATAGCTTCTGGTGGTTTGGTGG - Intergenic
1006872653 6:37266546-37266568 AATGGCTTGAGCTGGGGAGGCGG - Intronic
1007183085 6:39944814-39944836 CATGGCTTGATGTGGCTAGTAGG - Intergenic
1007387387 6:41528956-41528978 TAAGGTGTGTGGTGGGTAGGGGG + Intergenic
1007433727 6:41792948-41792970 GATGGCGGGTGGTGGGTGGGAGG - Exonic
1007781258 6:44256330-44256352 CAGGGCTCCAGGTGGGTAGGTGG - Exonic
1008543089 6:52562712-52562734 CAGGGCCTGTGGTGGGGTGGGGG - Intronic
1009696796 6:67116774-67116796 CAGGGCCTGTGGTGGGGTGGGGG - Intergenic
1010857348 6:80857185-80857207 CAGGGCCTGTGGTGGGGTGGGGG - Intergenic
1011082179 6:83501625-83501647 CAGGGCTTGTTGTGGGGTGGGGG + Intergenic
1011516139 6:88156031-88156053 CATGGCTCATGGTGGGAAGTTGG - Intronic
1012204397 6:96442592-96442614 CAGGGCCTGTGGTGGGGTGGGGG + Intergenic
1012678039 6:102142093-102142115 CAGGGCCTGTTGTGGGTTGGGGG - Intergenic
1013155667 6:107489830-107489852 CCTGGCGTGTGGCGGGGAGGTGG + Intergenic
1013683230 6:112547968-112547990 CAGGGCTTGTTGGGGGTTGGGGG + Intergenic
1013873822 6:114800059-114800081 CAGGGCCTGTTGTGGGTTGGGGG - Intergenic
1014368882 6:120580315-120580337 CAGGGCTTGTTGTGGGGTGGGGG - Intergenic
1017079709 6:150655935-150655957 CAGGGCCTGTGGGGGGTTGGGGG + Intronic
1017230542 6:152068891-152068913 CATGGACTGGGTTGGGTAGGAGG + Intronic
1017615589 6:156243538-156243560 CATGGCTCGAGGTGGCAAGGAGG + Intergenic
1017837143 6:158188951-158188973 AAAGGATTGCGGTGGGTAGGTGG - Intronic
1018199356 6:161380921-161380943 CATGGCTTGTTGTGGGGTGTTGG - Intronic
1018555222 6:165042559-165042581 ACTGTCTTCTGGTGGGTAGGAGG - Intergenic
1018647397 6:165961098-165961120 CCAGGCTTGTGGTGGGAGGGTGG + Intronic
1019018024 6:168894250-168894272 AATGGCTTGAGCTGGGGAGGCGG - Intergenic
1019266175 7:118668-118690 CAGGGCTGGTGGTGGGAACGGGG - Intergenic
1020107827 7:5430324-5430346 CGTGGCGTGTGCTGGGGAGGTGG - Intergenic
1020282362 7:6656070-6656092 CAGGGCTGGGGGCGGGTAGGAGG + Exonic
1021975366 7:26006940-26006962 ACTGGCATCTGGTGGGTAGGGGG - Intergenic
1022468758 7:30668879-30668901 CATGGCTAGGGGTGGGGAGCAGG - Intronic
1024143216 7:46482865-46482887 CAGGGCTTGTTGTGGGGTGGGGG + Intergenic
1024452200 7:49560236-49560258 CAGGGCCTGTTGTGGGTTGGGGG + Intergenic
1025088588 7:56043647-56043669 CAGGGGTTGGGGTGGGTGGGGGG - Intronic
1027616482 7:80430744-80430766 CATTTCTGGTGGGGGGTAGGGGG - Intronic
1028327931 7:89549833-89549855 CATGGGAAGTGGTGGGTAGCAGG + Intergenic
1028460469 7:91086319-91086341 CGTGGCTTCTGGAGGGGAGGAGG - Intronic
1028528065 7:91807540-91807562 CAGGGCCTGTGGTGGGGTGGGGG - Intronic
1028850734 7:95534532-95534554 CAGGGCTAGTGCTGGGAAGGAGG - Intronic
1029593283 7:101521431-101521453 CATGGCAATTGGTGGGAAGGTGG + Intronic
1029622482 7:101698785-101698807 GATGGCTTGGGGCGGGAAGGGGG - Intergenic
1029789500 7:102827679-102827701 CATGGCCTGTTGTGGGGTGGCGG - Intronic
1029809841 7:103036180-103036202 CATGGACTGTGGTGGGGTGGTGG - Intronic
1029967368 7:104754060-104754082 CATTACTTGTGGTGGGGAGTTGG + Intronic
1031958703 7:127969138-127969160 AATAGTTGGTGGTGGGTAGGTGG + Intronic
1032604136 7:133330688-133330710 CACAGCTTCTGTTGGGTAGGGGG + Intronic
1033410428 7:141112845-141112867 AATGGCTTTTGCTGGGTAAGTGG + Intronic
1035288251 7:157819750-157819772 CATGGCTGGCAGTGGGTGGGCGG - Intronic
1035345209 7:158192892-158192914 CATGGCTTCTGCTGGGTTTGTGG + Intronic
1035583634 8:755866-755888 CATGGTTTCTGGTGTGTGGGTGG - Intergenic
1035967239 8:4206347-4206369 CGGGGCCTGTGGTGGGTTGGGGG - Intronic
1036810473 8:11864967-11864989 CCTAGCTTGTGTGGGGTAGGAGG - Intronic
1036912548 8:12769221-12769243 CATGGCTTGTGCTGGTCAGCAGG + Intergenic
1037135354 8:15453768-15453790 CATTCCTGGTTGTGGGTAGGGGG - Intronic
1037643724 8:20771643-20771665 CATGGAGTGCAGTGGGTAGGTGG + Intergenic
1038095334 8:24302922-24302944 TGTGGCTTGTTGTGGGGAGGGGG - Intronic
1038708139 8:29915331-29915353 CAGGGCCTGTTGGGGGTAGGGGG + Intergenic
1040288233 8:46111245-46111267 CATGGCTTGTGAGGGGTGTGGGG - Intergenic
1041518660 8:58730631-58730653 CAGGGCCTGTTGTGGGGAGGGGG + Intergenic
1042130617 8:65583773-65583795 GATGGCTTGAGCTGGGGAGGTGG + Intergenic
1042504888 8:69549502-69549524 CCTGGCTTGTGGGGTGCAGGAGG - Intronic
1043940928 8:86194752-86194774 CAGGGCTTGTCGTGGGGTGGGGG + Intergenic
1044405204 8:91818669-91818691 CATGGCTTCCCTTGGGTAGGGGG - Intergenic
1045585238 8:103527543-103527565 CAGGGCCTGTTGTGGGGAGGGGG - Intronic
1045833272 8:106490312-106490334 CATGTCTTGTGGAAGGTAGGAGG + Intronic
1046473380 8:114709177-114709199 CATGGCATGTGTTGGGTATAGGG - Intergenic
1046903946 8:119552777-119552799 GATGGTATGTGGTGGGTATGAGG + Intergenic
1047157533 8:122337585-122337607 CATGGCTGGCGGTGGGTGGTGGG + Intergenic
1047641160 8:126823094-126823116 AATGGTTTGTGGTGGGAAAGAGG + Intergenic
1047649252 8:126901722-126901744 CAGGGCCTGTGGGGGGTTGGGGG + Intergenic
1048375999 8:133822725-133822747 CTTGGCTTGGGCTGGGAAGGAGG + Intergenic
1049148577 8:141019863-141019885 CATGGCTTGTGGGGAGCAAGAGG - Intergenic
1049159663 8:141089164-141089186 CATGGCTTGTGATGGGTGGGTGG + Intergenic
1050011518 9:1189962-1189984 CAGGGCCTGTGGTGGGGTGGGGG - Intergenic
1050041571 9:1500522-1500544 CGGGGCTTGTTGTGGGGAGGGGG - Intergenic
1050863790 9:10471133-10471155 CAGGGCCTGTTGTGGGTTGGGGG + Intronic
1052165918 9:25327627-25327649 CAGGGCCTGTAGTGGGTAGTGGG - Intergenic
1052757345 9:32554602-32554624 CAGGGATTGGGGTGGGTATGGGG - Intronic
1053122847 9:35559352-35559374 CATTGCTGGAGGTGGGGAGGGGG + Intronic
1054165626 9:61724504-61724526 CAGGGCTTGTCGTGGGGTGGGGG + Intergenic
1055485890 9:76756064-76756086 CAAAGCTGGTGGTTGGTAGGAGG - Intronic
1056552372 9:87663005-87663027 AATTGCTTCTGGAGGGTAGGAGG - Intronic
1056614672 9:88153665-88153687 CAGGGCCTGTTGTGGGTTGGGGG + Intergenic
1057934345 9:99223985-99224007 CATGCCTTATGGTGGGTACCTGG - Intronic
1059087882 9:111323916-111323938 GATTGCTAGTGGTGGTTAGGTGG - Intergenic
1059608056 9:115858043-115858065 CAGGGCGTGTGGTGGGGTGGGGG - Intergenic
1203467126 Un_GL000220v1:97876-97898 CATCGCTTGGGGTCGGGAGGTGG - Intergenic
1203485090 Un_GL000224v1:45740-45762 CATGGCCTGTTGTGGGGTGGGGG + Intergenic
1185512334 X:672971-672993 AAAGGCATGTGGTGGGTGGGGGG + Intergenic
1185880561 X:3736243-3736265 CATGGCCTGTGCTGGCTTGGAGG - Intergenic
1186723824 X:12335511-12335533 CATTCCTTGTGTTGGGTAGGAGG - Intronic
1186893322 X:13981641-13981663 GATGGCTTGTGTTGGGTATGTGG + Intergenic
1187276170 X:17818147-17818169 CAGGGCTTGAGGTGGGTCTGGGG - Intronic
1187337491 X:18393852-18393874 GAAGGCTTGTGGGGGGTGGGAGG - Intergenic
1187441209 X:19321935-19321957 CAAGGATTGGGGTGGGTGGGGGG + Intergenic
1187568163 X:20473765-20473787 CATGGTTGTTGGTGGGTGGGAGG + Intergenic
1188118980 X:26281460-26281482 CAGGGCCTGTGGTGGGGTGGGGG - Intergenic
1188949212 X:36347768-36347790 CATGGCCTGTTGTGGGGTGGGGG + Intronic
1188987297 X:36779272-36779294 TATGGCATGAGGTGTGTAGGTGG - Intergenic
1190004441 X:46721690-46721712 CATAGCCTTTGGTGGGTTGGTGG - Intronic
1190595464 X:52049147-52049169 CGGGGCCTGTTGTGGGTAGGGGG + Intergenic
1190613360 X:52204926-52204948 CGGGGCCTGTTGTGGGTAGGGGG - Intergenic
1190693309 X:52930586-52930608 CAGGGCCTGTGGTGGGTGGGGGG + Intronic
1191690835 X:63936172-63936194 CATGGGGTGTGGTGGGGAAGGGG + Intergenic
1192182591 X:68925615-68925637 AATGGCTGGTGGTTGATAGGTGG + Intergenic
1192183711 X:68931658-68931680 CATGGTTTGGGGTGGGGAGTAGG + Intergenic
1192391589 X:70734141-70734163 CAGGGCCTGTTGTGGGTTGGGGG + Intronic
1192977350 X:76300248-76300270 CATGGCTTCCCTTGGGTAGGGGG + Intergenic
1193403687 X:81076915-81076937 CATGGGGTGTGGAGGGCAGGGGG + Intergenic
1195103293 X:101577293-101577315 CAGGGCCTGTTGTGGGGAGGGGG - Intergenic
1195701524 X:107709187-107709209 CAGGGCTCATGGTGGGAAGGGGG - Intergenic
1196565940 X:117205834-117205856 CATGTGTTGTGGTAGGTGGGAGG - Intergenic
1196701610 X:118675565-118675587 CAGGGCTTGTTGTGGGGTGGGGG + Intronic
1196785543 X:119418739-119418761 AATGGCTTCTGGTGGGAAGGGGG + Intronic
1197538897 X:127729558-127729580 CAGGGCCTGTCGCGGGTAGGGGG - Intergenic
1198664030 X:139002178-139002200 CAGGGCCTGTTGGGGGTAGGGGG + Intronic
1199115897 X:143991689-143991711 CATGTCTTTTGGTAGGTATGTGG + Intergenic
1200067895 X:153513240-153513262 CATGGCTTCTTGTGGGGGGGGGG + Intergenic
1200269164 X:154665285-154665307 CAGGGCCTGTTGTGGGTTGGGGG - Intergenic
1200732648 Y:6758879-6758901 CATGGCTTACCTTGGGTAGGGGG + Intergenic
1200784592 Y:7249109-7249131 CATGGCCTGTGCTGGCTTGGAGG + Intergenic