ID: 1079112346

View in Genome Browser
Species Human (GRCh38)
Location 11:17612010-17612032
Sequence CTTGTGGTGGGTAGGGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1217
Summary {0: 1, 1: 0, 2: 5, 3: 121, 4: 1090}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079112329_1079112346 18 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112346 11:17612010-17612032 CTTGTGGTGGGTAGGGGGTGAGG 0: 1
1: 0
2: 5
3: 121
4: 1090
1079112332_1079112346 15 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112346 11:17612010-17612032 CTTGTGGTGGGTAGGGGGTGAGG 0: 1
1: 0
2: 5
3: 121
4: 1090
1079112328_1079112346 23 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112346 11:17612010-17612032 CTTGTGGTGGGTAGGGGGTGAGG 0: 1
1: 0
2: 5
3: 121
4: 1090
1079112330_1079112346 17 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112346 11:17612010-17612032 CTTGTGGTGGGTAGGGGGTGAGG 0: 1
1: 0
2: 5
3: 121
4: 1090
1079112327_1079112346 24 Left 1079112327 11:17611963-17611985 CCCTGACCCCCGAGCTCACACTA 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1079112346 11:17612010-17612032 CTTGTGGTGGGTAGGGGGTGAGG 0: 1
1: 0
2: 5
3: 121
4: 1090
1079112336_1079112346 -8 Left 1079112336 11:17611995-17612017 CCAGGCCCCACATGGCTTGTGGT 0: 1
1: 0
2: 1
3: 23
4: 192
Right 1079112346 11:17612010-17612032 CTTGTGGTGGGTAGGGGGTGAGG 0: 1
1: 0
2: 5
3: 121
4: 1090
1079112331_1079112346 16 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112346 11:17612010-17612032 CTTGTGGTGGGTAGGGGGTGAGG 0: 1
1: 0
2: 5
3: 121
4: 1090

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079112346 Original CRISPR CTTGTGGTGGGTAGGGGGTG AGG Intronic
900286303 1:1902200-1902222 CCTGAGCTGGGTGGGGGGTGGGG - Intergenic
900381183 1:2384912-2384934 CTCGTGGTGGGCAGGGCGCGTGG - Intronic
900529228 1:3144531-3144553 CTTGGGGTGGGTGGGGGAGGGGG + Intronic
900888999 1:5435711-5435733 CTCATGGTGGGGAGGGGGTGGGG + Intergenic
900923926 1:5691341-5691363 CTTGGGGTGGGAGAGGGGTGAGG + Intergenic
901296369 1:8164151-8164173 AGTGTGGTGGGTGGGGGGTGAGG - Intergenic
901436571 1:9250488-9250510 CCTGTGGTGTGTGTGGGGTGGGG - Intronic
901496329 1:9624472-9624494 GGTGTGGTGGGTAGGAGGTGTGG - Intergenic
901659410 1:10789159-10789181 CCTGTCTTGGGTGGGGGGTGTGG - Intronic
901759825 1:11463472-11463494 CTAGTGGTGGGGAGGGCGTGAGG - Intergenic
902252039 1:15160209-15160231 CCTGTGCTGGTTAGGGTGTGGGG + Intronic
902286376 1:15410735-15410757 CGTGTGTTGGGGTGGGGGTGGGG - Intronic
902372981 1:16017044-16017066 GATGCGGTGAGTAGGGGGTGGGG + Intronic
903368623 1:22820030-22820052 CTTGGGGAGGGTCTGGGGTGGGG - Intronic
903424889 1:23246194-23246216 ATTTGGGTGGGAAGGGGGTGAGG + Intergenic
903742284 1:25565221-25565243 CCTGTGCTGGGTAGGGGGCCTGG + Intronic
904287833 1:29463526-29463548 TGTGTGGTGGGCAGGGGGTAGGG - Intergenic
904325502 1:29725125-29725147 AGTGTGCTGGGTGGGGGGTGGGG + Intergenic
904384837 1:30134536-30134558 CTTGCGGTGGGTGGGTGGGGTGG - Intergenic
904403397 1:30271542-30271564 CTGGTGTTGGGTGGAGGGTGGGG + Intergenic
904439511 1:30521350-30521372 CTTGTGGTCAGTGTGGGGTGGGG - Intergenic
904563049 1:31411599-31411621 CAGGTAGTGGGTTGGGGGTGAGG + Intronic
904703925 1:32376413-32376435 CTTGGAGTGAATAGGGGGTGAGG + Exonic
904957056 1:34293475-34293497 CTTTTGGAGGGTGGAGGGTGGGG - Intergenic
905349516 1:37335270-37335292 CCTGTTGGGGGTGGGGGGTGAGG + Intergenic
905357024 1:37391761-37391783 CTCTTGGTGGTTGGGGGGTGGGG - Intergenic
905387214 1:37613272-37613294 CTGGTGGCGGATAGGGGATGGGG - Intronic
905769721 1:40629566-40629588 CTTGGGGTGGGTTGGGGTAGGGG + Intronic
905820033 1:40981857-40981879 CTTGCTCTGGGGAGGGGGTGGGG + Intronic
905874789 1:41426004-41426026 ATTCTGGTGGGCTGGGGGTGAGG + Intergenic
906014563 1:42563449-42563471 CCTGTTGGGGGTAGGGGGTGAGG + Intronic
906528224 1:46508811-46508833 GTGGTGGGGGGTGGGGGGTGGGG - Intronic
906678078 1:47707912-47707934 TTTGTGGGGGGGGGGGGGTGGGG + Intergenic
907468820 1:54658110-54658132 ATGGTGGTGGCTAGGGGCTGGGG - Intronic
908177851 1:61573529-61573551 CTTATGGTGGGTTGGGGGGCAGG - Intergenic
908260569 1:62336859-62336881 CGGGTGGTGGGTAGTGGATGAGG + Intergenic
909053450 1:70795536-70795558 CTTGTTGGGGGTAGGGGGCAAGG - Intergenic
909068721 1:70966596-70966618 CTGTTGGGGGGTCGGGGGTGAGG - Intronic
909256397 1:73429059-73429081 CGTGTGGTGGGGGGGGGCTGGGG - Intergenic
909431341 1:75590686-75590708 GTGGTGGTGGCTATGGGGTGAGG + Intronic
909723914 1:78810988-78811010 CCTGTTGTGGGGTGGGGGTGGGG + Intergenic
910194249 1:84624178-84624200 TTTTTGGGGGGTGGGGGGTGGGG + Intergenic
910468230 1:87523393-87523415 CTTGTGTTGGGGAGGGGCTAGGG - Intergenic
910673295 1:89794725-89794747 ATTTTGGGGGGTGGGGGGTGGGG + Intronic
911266424 1:95750079-95750101 TGTGTGGTGGGGTGGGGGTGTGG - Intergenic
911423292 1:97673719-97673741 TTTGTGTGGGGTGGGGGGTGAGG + Intronic
912127737 1:106560607-106560629 CTTTTGGGGGGTGGGGGGTAGGG + Intergenic
912262621 1:108124154-108124176 CTTTTTGTGGGGAGGGGATGGGG + Intergenic
912313698 1:108647522-108647544 CTACTGGTGGGGAGGAGGTGAGG + Intergenic
912448956 1:109758127-109758149 CTTGTGGTGGGGAGGGGTGCGGG - Intronic
912942708 1:114059170-114059192 CTGGTGGTGGTAAGGGGATGGGG + Intergenic
913090521 1:115473717-115473739 AATGTGGTGGGTAGGAGGTTGGG + Intergenic
914903892 1:151728470-151728492 CTCGGGGTAGGTGGGGGGTGGGG + Intronic
915436561 1:155911185-155911207 CTGGGGGTGGGGAGGGGGTTCGG - Intronic
915528051 1:156488163-156488185 CTTGTGGGTGGCAGGGGGTTGGG + Intronic
915553372 1:156647677-156647699 CGTGAGGTGGGCAGGGGCTGTGG + Exonic
915757535 1:158277298-158277320 CTGTTGGGGGGTAGGGGGAGGGG - Intergenic
915841280 1:159215419-159215441 CTTGTTGTGGGAAGGTGGAGCGG + Intergenic
915867887 1:159525194-159525216 CTTGTTGTGGGGTGGGGGGGGGG - Intergenic
916296434 1:163225576-163225598 TGTGGGGTGGGTAGGGGGTGTGG - Intronic
916331182 1:163619017-163619039 CTTGTGGGGGGAAGGGTGGGAGG - Intergenic
916397044 1:164402274-164402296 CTGGTGGTGGGGATGGGGGGTGG + Intergenic
916425333 1:164674852-164674874 TTGGTGGTGGGTGGGGGGGGGGG - Intronic
916819015 1:168379949-168379971 CTTATGGTGGGCAACGGGTGTGG + Intergenic
917055938 1:170981601-170981623 CTTGTTGGAGGTGGGGGGTGCGG + Intronic
917086943 1:171313069-171313091 CTGTTGTAGGGTAGGGGGTGAGG - Intergenic
918126947 1:181592489-181592511 CCGGTGGGGGGTGGGGGGTGGGG + Intronic
918215414 1:182389334-182389356 CTTTTGGTGGGGAGGGGCGGTGG - Intronic
918306273 1:183249730-183249752 TGTTTGGGGGGTAGGGGGTGCGG + Exonic
918558078 1:185829405-185829427 CTGTTGGGGGGTAAGGGGTGAGG - Intronic
918756513 1:188345158-188345180 GTGGTGGTGGCTATGGGGTGAGG - Intergenic
919422686 1:197390176-197390198 TGTGTGGGGGGGAGGGGGTGGGG + Intronic
919467986 1:197945405-197945427 CTGTTAGGGGGTAGGGGGTGAGG - Intergenic
919569304 1:199226286-199226308 TTTTTGGGGGGTTGGGGGTGTGG - Intergenic
919586092 1:199442313-199442335 CTGTTGGGGGTTAGGGGGTGAGG - Intergenic
919727888 1:200895527-200895549 CCTGTGTTAGGGAGGGGGTGGGG + Intronic
919745684 1:201008012-201008034 GTTGTGGTAGGCAGGGGCTGGGG + Intronic
920047588 1:203143469-203143491 GTGGTGGTGGGTGGGGGGAGGGG - Intronic
920071234 1:203304836-203304858 TTTCTGGTGGGTAGGGGTAGGGG - Intergenic
920123669 1:203676802-203676824 CTTGGGGTGGGGGTGGGGTGAGG + Intronic
920248734 1:204607954-204607976 TCTGTGGTGGGTGGGAGGTGGGG + Intergenic
920302326 1:204996734-204996756 CTAGAGGTGGGCAGGCGGTGGGG - Intronic
920379287 1:205526496-205526518 CTTGTGGTGGAAACGGGGTGTGG + Intronic
920850523 1:209625222-209625244 CTGCTGGTGGGATGGGGGTGTGG + Intronic
920951927 1:210580487-210580509 CTGCTGGGGGGTGGGGGGTGGGG - Intronic
920985597 1:210885692-210885714 CTTGAGCTTGGTAGGGGGAGAGG + Intronic
921137482 1:212274524-212274546 TCTGTGGTGGGTATGGGGTTTGG + Intergenic
921180974 1:212630877-212630899 CTGGAGGAGAGTAGGGGGTGGGG + Intergenic
921319311 1:213922981-213923003 CTTGTGGTGGGGTGGGGGGAGGG - Intergenic
921794438 1:219326291-219326313 TTTTTGGTGGGTGGGGGGTTGGG + Intergenic
922085063 1:222338656-222338678 CCCCTGGTGGGTATGGGGTGTGG - Intergenic
922129458 1:222762566-222762588 CTTGTTGTGGGGTGGGGGGGAGG + Intergenic
922266279 1:223987068-223987090 TTTTTGGTAGGGAGGGGGTGGGG - Intergenic
922478812 1:225924508-225924530 CTTGGGGTGGGGGGGGGGGGTGG - Intergenic
922689444 1:227676669-227676691 CCTGTTGTGGGGAGGGGGAGGGG - Intronic
923110270 1:230884692-230884714 GATTTGGTGGGCAGGGGGTGAGG - Intergenic
923140999 1:231161805-231161827 ATGGCGGTGGGTTGGGGGTGGGG + Intergenic
923296738 1:232601686-232601708 CGTTTGGTGTGTTGGGGGTGTGG - Intergenic
923493777 1:234507346-234507368 CTTGGGGTGGGGCGGGGGGGGGG - Intergenic
923796631 1:237163360-237163382 GTTGTGGAGGGGTGGGGGTGGGG - Intronic
1063117982 10:3085206-3085228 ACTGTGCTGGGGAGGGGGTGAGG - Intronic
1063117991 10:3085230-3085252 ACTGTGCTGGGGAGGGGGTGGGG - Intronic
1063118002 10:3085254-3085276 ACTGTGCTGGGGAGGGGGTGGGG - Intronic
1063219586 10:3954365-3954387 CTGTTGGTGGGTAGGGGGCAGGG + Intergenic
1063417661 10:5887691-5887713 CATCTGGGGGGGAGGGGGTGGGG - Intronic
1063862876 10:10331084-10331106 TTTGTGGGGGGTGGGGGGTGGGG + Intergenic
1064138510 10:12770923-12770945 TTTGTGGGGGGTGGGGGGTGTGG + Intronic
1064577011 10:16756881-16756903 CGTGTGGTGTGTGAGGGGTGGGG + Intronic
1064660714 10:17605070-17605092 ATAGTGGTGGCTAGGGGCTGGGG + Intronic
1064848813 10:19686756-19686778 TTTGTGGAGGGTAGGGAGTGAGG + Intronic
1064868032 10:19904474-19904496 CTGGGGGTGGGCAGGGGTTGGGG - Intronic
1065446028 10:25800523-25800545 CCTGTTGTGGGTGGGGGGAGGGG + Intergenic
1065680592 10:28227464-28227486 CCTGTCGGGGGTTGGGGGTGGGG - Intronic
1065697782 10:28395684-28395706 ATTGTGGGGGGTAGGTGGAGTGG + Intergenic
1065901330 10:30210683-30210705 GATTTGGTGGGTAGGGGGTCGGG + Intergenic
1066034558 10:31468257-31468279 TTGGTGATGGGTGGGGGGTGTGG - Intronic
1066080839 10:31928947-31928969 TCTGGGGTGGCTAGGGGGTGCGG + Intergenic
1066381972 10:34909543-34909565 CTTTTTGTGGGTGGTGGGTGGGG + Intergenic
1067037438 10:42930823-42930845 CTTATAGTGGGGAGGGGGTGGGG + Intergenic
1067145279 10:43689568-43689590 CGGGGGGTGGTTAGGGGGTGAGG + Intergenic
1067146703 10:43699575-43699597 CTTCTGCTGGGTGGGGGGAGTGG - Intergenic
1067146890 10:43700861-43700883 CTAGTGTTGGGAAGGGTGTGAGG + Intergenic
1067213571 10:44281752-44281774 GCTGGGGTGGGTAGAGGGTGGGG + Intergenic
1067214681 10:44292824-44292846 CCTGTTGGGGGGAGGGGGTGGGG - Exonic
1067428429 10:46226497-46226519 CTGGTGGTGGGTGTGGGGTGGGG + Intergenic
1068004260 10:51374241-51374263 CCTGTCGGGGGTTGGGGGTGGGG - Intronic
1068093810 10:52465639-52465661 CTTGTGTTGGGTAGGGGTGGCGG + Intergenic
1068310026 10:55264321-55264343 CTTCTGTGGGGTTGGGGGTGGGG - Intronic
1068546509 10:58352503-58352525 CTTGGGGAGGGTAGGGCGGGAGG + Intronic
1068673408 10:59745490-59745512 ATGGTGGGGGGTGGGGGGTGGGG - Intergenic
1069579891 10:69558830-69558852 CTTGTTGGGGTTAGGGGCTGAGG + Intergenic
1069997610 10:72352549-72352571 CTGATGGTGGGGAGGAGGTGCGG - Intronic
1070411198 10:76142838-76142860 CTGTTGTTGGGTAGGGGGAGGGG - Intronic
1070507459 10:77126721-77126743 GTGGTGGTGGGGGGGGGGTGGGG - Intronic
1070614733 10:77960952-77960974 GTTGCTATGGGTAGGGGGTGGGG - Intergenic
1070680065 10:78442812-78442834 TCTGGGGTGGGTAGGGGATGAGG - Intergenic
1070712937 10:78696682-78696704 CGGGGGGTGGGAAGGGGGTGGGG + Intergenic
1070774285 10:79100763-79100785 CATGTGGCTGGTAGGGGGTGAGG + Intronic
1071283732 10:84125563-84125585 CATGGGGTGGGGAGGGGGCGAGG - Intergenic
1071567891 10:86681004-86681026 CTGGTTGTGGGCAGGTGGTGGGG - Intronic
1071880165 10:89888639-89888661 CTTGTGGGGGGTGGGGGGGTAGG - Intergenic
1072174185 10:92900267-92900289 TTTTTGGGGGGAAGGGGGTGGGG - Intronic
1072373969 10:94795151-94795173 CCTGTCGTGGGGTGGGGGTGGGG - Intronic
1072633222 10:97161205-97161227 CTTGTGCTGGGAAGGAGGGGAGG - Intronic
1072757712 10:98031398-98031420 CTGCTGGTGGGGACGGGGTGGGG - Intergenic
1073077949 10:100836359-100836381 GGTGTTGGGGGTAGGGGGTGGGG - Intergenic
1073585224 10:104703593-104703615 CTGCTGGAGGGTGGGGGGTGAGG + Intronic
1073843807 10:107528969-107528991 ACTGTGGTGGGGAGGGGGAGGGG + Intergenic
1073975658 10:109097767-109097789 CTGTTGTGGGGTAGGGGGTGGGG + Intergenic
1074554138 10:114472708-114472730 CGGGAGGTGGGGAGGGGGTGGGG - Intronic
1074971120 10:118539810-118539832 TAGGTGGTGGGTGGGGGGTGGGG - Intergenic
1075018157 10:118926405-118926427 CTTGGGGTGGGAGAGGGGTGAGG - Intergenic
1075112180 10:119596509-119596531 GTTGGGGAGGGGAGGGGGTGGGG + Intronic
1076230336 10:128815032-128815054 CAGCTGGGGGGTAGGGGGTGGGG + Intergenic
1076371983 10:129961296-129961318 GTTGTGGTGGGGAGGGGGGCAGG - Intronic
1076605707 10:131688891-131688913 GATGTGGTGGGGTGGGGGTGGGG - Intergenic
1076652188 10:131997353-131997375 CCGGTGGTGGGTGTGGGGTGGGG + Intergenic
1076694498 10:132240599-132240621 CTCGGGGTGGGTGGGGGCTGTGG + Intronic
1076698360 10:132257726-132257748 CTGGTGGAGGGTGGGGGTTGGGG - Intronic
1076706394 10:132304316-132304338 GGTTTGGTGGGTTGGGGGTGGGG - Intronic
1076755779 10:132570953-132570975 CTCCTGGTGGGTGGGGGCTGAGG + Intronic
1076854922 10:133111325-133111347 CCTGTGGTGGGCAGGTGGTCTGG - Intronic
1076855059 10:133111787-133111809 CCTGTGGTGGGCAGGTGGTCTGG - Intronic
1076855109 10:133111955-133111977 CCTGTGGTGGGCAGGTGGTCTGG - Intronic
1077149521 11:1064077-1064099 CTGGTGGGGGGTGGGAGGTGAGG - Intergenic
1077190772 11:1255219-1255241 GCTGTGGTGGGCATGGGGTGGGG - Exonic
1077311687 11:1891625-1891647 CCTGTGGTGGAGTGGGGGTGTGG + Intronic
1077409414 11:2396487-2396509 TCCGAGGTGGGTAGGGGGTGGGG + Intronic
1077551666 11:3203242-3203264 CGTGTGGTGGGGAGGGGGCTGGG - Intergenic
1077780086 11:5318275-5318297 CCTGTTGTGGGGTGGGGGTGGGG - Intronic
1078290382 11:10004999-10005021 CTGGTGGTGGCATGGGGGTGGGG - Intronic
1078577926 11:12517309-12517331 ATGGTGGGGGGTGGGGGGTGGGG - Intronic
1078812631 11:14783602-14783624 CTTGTAGTGGGGTGGGGGAGTGG + Intronic
1078822902 11:14900131-14900153 CTCTTTGTGGGTAGGGGGGGTGG - Intergenic
1079112346 11:17612010-17612032 CTTGTGGTGGGTAGGGGGTGAGG + Intronic
1079448079 11:20574545-20574567 TTTTTGGGGGGTGGGGGGTGGGG - Intergenic
1080244549 11:30164517-30164539 CAGGTGGTGGGGTGGGGGTGAGG + Intergenic
1080250521 11:30228419-30228441 ATGGTGGTGGGTGGGCGGTGTGG - Intergenic
1080655669 11:34256159-34256181 CTTGTGGGGGGTGGGGCGGGGGG + Intronic
1080820532 11:35801774-35801796 TTGGTTGTGGGTAGGGGATGGGG - Intronic
1080949631 11:37016510-37016532 ATTGTGGTTGCTAGGGGCTGAGG + Intergenic
1081401860 11:42653144-42653166 CTGGTGGTGGGGTGGGGGGGCGG - Intergenic
1081946755 11:47002630-47002652 CTTGTAGAAGGCAGGGGGTGGGG - Intronic
1082084912 11:48041975-48041997 CTTGAGGTGGGGGGTGGGTGGGG + Intronic
1082108742 11:48248754-48248776 CTGTTGGGGGGTGGGGGGTGAGG - Intergenic
1082262832 11:50090499-50090521 TTGGTGGGGGGTGGGGGGTGGGG - Intergenic
1082265087 11:50109575-50109597 CTTGTGGTGGTGTGGTGGTGGGG - Intergenic
1082654901 11:55842511-55842533 CCTGTTGTGGGGTGGGGGTGGGG - Intergenic
1082967480 11:58981663-58981685 CCTGTTGTGGGGTGGGGGTGGGG - Intronic
1083060674 11:59867540-59867562 CTAGTGGTGGGAAGGAGATGCGG + Intergenic
1083245643 11:61425793-61425815 CTCCTGGTGGGTAGGGGTGGTGG - Intronic
1083326851 11:61877296-61877318 CGTGTGGTGGGGGGGGGTTGAGG - Intronic
1083592795 11:63905098-63905120 CTCGGGGTGGGTTGGGGGTTGGG + Intronic
1083620230 11:64045553-64045575 AATTTGGTAGGTAGGGGGTGAGG + Intronic
1083765258 11:64838554-64838576 CCTGGGGTGGGCTGGGGGTGAGG - Intronic
1083951693 11:65960060-65960082 CTCCTGGTGGGGAGGGGGTGCGG - Intergenic
1084002251 11:66302759-66302781 CTTGGGGTGGAGAGGAGGTGGGG - Intergenic
1084164292 11:67367713-67367735 CTTGGGCTGGGTGGGGGGTGAGG + Intronic
1084179612 11:67439881-67439903 CTGGCGGTGGGTGGGGGGGGCGG - Intronic
1084208677 11:67610950-67610972 CTGGTGGCTGCTAGGGGGTGGGG - Intronic
1084405854 11:68972735-68972757 CATTTGGTGGGTAGGGGCTTGGG + Intergenic
1084490946 11:69477953-69477975 CCTGTGGTGGGGATGGGGCGAGG + Intergenic
1084576222 11:69989595-69989617 CAGGTGGTGGGGAGGGGGTGGGG - Intergenic
1084780394 11:71404426-71404448 AGTGTGGTGGGTAGGCGGTGGGG + Intergenic
1084945447 11:72635940-72635962 CTCGTGGTGTGGAGGGGGAGCGG - Intronic
1085064140 11:73476444-73476466 CTGATGGTGGGGTGGGGGTGGGG + Intronic
1086328807 11:85732589-85732611 GTTGGGGTGGGCAGGGGGTGGGG + Intronic
1086819995 11:91424104-91424126 CCTGTGGGGAGTGGGGGGTGAGG - Intergenic
1086872620 11:92056929-92056951 CTTCTGGTGGGGGGAGGGTGCGG - Intergenic
1086882608 11:92167064-92167086 ATGGTGGTGGGGAGGGGATGGGG - Intergenic
1087085179 11:94210889-94210911 CCTGTGGGGGGTAGGGGTCGGGG + Intergenic
1087201374 11:95347468-95347490 GTGGTGGTGGCTATGGGGTGAGG + Intergenic
1087280915 11:96209220-96209242 CTTTTTTTGGGTGGGGGGTGGGG + Intronic
1087808279 11:102580346-102580368 CTTTTGGTGGGAAAGGAGTGGGG - Intronic
1088083899 11:105955268-105955290 CTGTTGGAGGGTTGGGGGTGAGG - Intronic
1088124803 11:106411741-106411763 CTTGAGGTGAGTGGGGGTTGTGG - Intergenic
1088743656 11:112786756-112786778 CTTGTGGTGGCTAGTGGAAGGGG + Intergenic
1088960699 11:114662013-114662035 CTTGCGGGGGGTAGGTGGAGAGG - Intergenic
1089103705 11:115984834-115984856 CTTGTGGTAGGAAGGTGGAGTGG - Intergenic
1089440499 11:118512298-118512320 TTTGTGGTGGCCAGGGGCTGAGG - Intronic
1089487491 11:118858291-118858313 TTTGTGCTGGGCAGGGGGTGGGG + Intergenic
1089698777 11:120231845-120231867 CTTTGGGTTGGGAGGGGGTGTGG - Intergenic
1089702808 11:120255496-120255518 GTTGGGGTGGGGAGGGGGAGAGG + Intronic
1089772855 11:120815751-120815773 GTGGTGGTGGGTAGAGGGAGAGG + Intronic
1089865119 11:121624853-121624875 CTTGTTGTGGGGGGGTGGTGTGG + Intronic
1089938336 11:122388958-122388980 CTTTTGGGGGGTGGGGGGTTGGG - Intergenic
1090189897 11:124760801-124760823 CTTGTGGGGGGTGGGGGCTGGGG - Intronic
1090362853 11:126185545-126185567 CGTGCGGTGGGCTGGGGGTGAGG - Intergenic
1090367888 11:126223085-126223107 CTTGAGGTGGGGCGGGGGAGGGG + Intronic
1090429359 11:126633219-126633241 CCTGTTGTGGGGTGGGGGTGAGG + Intronic
1090479081 11:127051999-127052021 TTGGTGGTGGGAAGGGGCTGGGG - Intergenic
1090712129 11:129396624-129396646 CATGTGGTGGGTGGGGGGACGGG + Intronic
1091155106 11:133364842-133364864 CTTGTGGGGGGTGTGTGGTGAGG + Intronic
1092026479 12:5245009-5245031 CTTGGGGTGGGGAGTGGGTCAGG + Intergenic
1092658957 12:10718513-10718535 CCTTTGGTGGGGTGGGGGTGGGG - Intronic
1093504990 12:19854766-19854788 CCTGTTGTGGGTGGGGGATGAGG - Intergenic
1093545039 12:20336452-20336474 CTTGAGGTTGGTGGGGGGAGGGG - Intergenic
1094284947 12:28782489-28782511 CCTGTGGAAGGGAGGGGGTGAGG - Intergenic
1094816102 12:34186403-34186425 CTGCTGCTGGGTGGGGGGTGGGG + Intergenic
1095101000 12:38183867-38183889 CTGCTGCTGGGTGGGGGGTGGGG - Intergenic
1095694874 12:45132847-45132869 CTTGAGCTTGGTAGGGGGAGGGG + Intergenic
1096372005 12:51076604-51076626 CTGGTGGTGAGTAGGGGCTTTGG - Exonic
1096487791 12:51995253-51995275 GTGGTGGTGGGTTTGGGGTGGGG + Intronic
1097169684 12:57105703-57105725 AGTGGGGTGGGTAGTGGGTGTGG + Intronic
1097305476 12:58063852-58063874 CCTGTTGTGGGGTGGGGGTGGGG + Intergenic
1097525534 12:60729185-60729207 CCTGTTGTGGGTAGGGGAAGCGG + Intergenic
1097641087 12:62183208-62183230 CATGTGGTGGTTGTGGGGTGGGG - Intronic
1097752861 12:63377480-63377502 CTTTTTGTGGGTTGGGAGTGGGG + Intergenic
1097759358 12:63444045-63444067 CTGTTGGGGGGTCGGGGGTGAGG - Intergenic
1097864665 12:64550095-64550117 ATGGAGGTGGGAAGGGGGTGGGG - Intergenic
1098241687 12:68473566-68473588 ATTGGGGTGGGAGGGGGGTGAGG + Intergenic
1099614696 12:84919575-84919597 CTTGTGGTGGGGAGGGGGGAAGG - Intergenic
1099744971 12:86690156-86690178 CTGGTGCTTGGTAGGGGGAGGGG - Intronic
1099779671 12:87177399-87177421 CCTGTGGTGGGGTGGGGGAGGGG + Intergenic
1099792747 12:87357877-87357899 CTGTTGCTGGGTTGGGGGTGAGG - Intergenic
1100259962 12:92923607-92923629 TATGTGGTGGAGAGGGGGTGTGG - Intronic
1100359587 12:93863690-93863712 CATGTGATGGGCAGGGGCTGGGG + Intronic
1100815135 12:98379632-98379654 CTGGTGGTGGGGTGGGAGTGGGG - Intergenic
1100827831 12:98491337-98491359 CTTAAGGTGGGGAGGAGGTGAGG - Intronic
1101080018 12:101172606-101172628 TGTGTGGTGGGTAGGGAGCGAGG + Intronic
1101743664 12:107521676-107521698 TCTGGGGAGGGTAGGGGGTGGGG - Intronic
1101846026 12:108363749-108363771 TTTGTGATGTGTGGGGGGTGTGG + Intergenic
1101875214 12:108592966-108592988 AGAGTTGTGGGTAGGGGGTGAGG - Intronic
1102005676 12:109587896-109587918 CATCTAGTGGGTAGGGGCTGGGG - Intronic
1102046402 12:109832789-109832811 CTGGGGGTGGGTAGCGGGGGTGG - Intronic
1102136417 12:110580013-110580035 TTTTTGGTGGGTGGGGGGTGCGG - Intronic
1102579301 12:113876016-113876038 CTTGGGGTGGGTGTGGGGTGGGG + Intronic
1102777299 12:115531686-115531708 GCTGTGGTGGGGATGGGGTGAGG - Intergenic
1102954841 12:117052751-117052773 CTGGGGGTGGGTTGGGTGTGGGG - Intronic
1102965279 12:117120808-117120830 CTAGGGGTGGGTGGGTGGTGAGG - Intergenic
1103039832 12:117685764-117685786 CTGGTGGTGGGTTGGGGGTGGGG - Intronic
1103232159 12:119340523-119340545 GTGGTGGGGGGCAGGGGGTGGGG - Intronic
1103247028 12:119466666-119466688 TTTATGGTGGTTAGGGGGTGAGG - Intronic
1103415559 12:120739871-120739893 CTGGTGTTGGGCAGGTGGTGGGG + Exonic
1104024577 12:125016507-125016529 TTTTTGGGGGGGAGGGGGTGGGG + Intronic
1104057791 12:125243929-125243951 TTAGTGGTGGGCAGGGGCTGGGG - Intronic
1104289313 12:127454344-127454366 CTTGTGGGGGGTTGGGGGGTGGG + Intergenic
1104942781 12:132402676-132402698 CTTGTGGGGGGTGGGCAGTGAGG + Intergenic
1105322664 13:19343888-19343910 CCTGTCGGGGGGAGGGGGTGGGG + Intergenic
1105437399 13:20390618-20390640 CTTGTGCTGAGTGGGGGGTAGGG + Intergenic
1105480394 13:20770281-20770303 ATTGTGGTTGCTAGGGGCTGGGG + Intronic
1106410117 13:29505758-29505780 CATGTGGTGGGCAGGGGCGGCGG - Exonic
1106985452 13:35342826-35342848 ATTGGGGTGGGGAGGGGTTGGGG - Intronic
1107011317 13:35673794-35673816 CTTGGGGTGGGAGGGGGGAGCGG - Intergenic
1107564722 13:41590130-41590152 CTGGTGGAGGTCAGGGGGTGAGG + Intronic
1107772645 13:43805636-43805658 CCGGTGGGGGGTGGGGGGTGGGG - Intergenic
1107789994 13:43992083-43992105 ATGGTGGGGGGTTGGGGGTGGGG + Intergenic
1107974812 13:45679074-45679096 CTTGTGGTGAGAAGGGATTGTGG + Intergenic
1108056906 13:46494204-46494226 CTTATTGTGAGTAGGGGGTTGGG + Intergenic
1108346129 13:49548772-49548794 CTAGTGGTTGCTAGGGGTTGGGG + Intronic
1108494205 13:51008058-51008080 GAGGTGGTGGGAAGGGGGTGAGG - Intergenic
1108561616 13:51649572-51649594 CTATTGTGGGGTAGGGGGTGGGG - Intronic
1108741000 13:53338343-53338365 CTGGTGGTGAGGAGAGGGTGTGG + Intergenic
1108952077 13:56106991-56107013 CTGGGGGTGGGTAGGGGTTGGGG - Intergenic
1109007918 13:56901914-56901936 CTTCTGGTGGGTAGGTGGTCTGG - Intergenic
1109025170 13:57146299-57146321 CTTGGGGTGGGGCGGGGGGGGGG - Intronic
1109268841 13:60231814-60231836 CTTGTCGTGGGTGGGAGGAGCGG + Intergenic
1109629947 13:65033039-65033061 TCTGAGGTGGGCAGGGGGTGGGG + Intergenic
1109633539 13:65084698-65084720 GTTGGGGGGGGGAGGGGGTGGGG - Intergenic
1109867497 13:68284407-68284429 CTTGGGGTGGGGAGGGGGGAGGG + Intergenic
1110273020 13:73612713-73612735 CTTTTGATGGGTAGAGGGTGGGG - Intergenic
1110410106 13:75195600-75195622 ATTGTGGGGGGTAGGGGGAGAGG - Intergenic
1110693285 13:78457173-78457195 CTGTTGGGGGGTAGGGGGTGAGG + Intergenic
1111136159 13:84047024-84047046 CCTGTTGTGGGTGGGGGGAGGGG - Intergenic
1111201869 13:84948835-84948857 ATTGTGGTGGGTGAGGGGTCTGG - Intergenic
1111591196 13:90349615-90349637 CTTCTGGTGGGTTGGTGGTCTGG - Intergenic
1111699858 13:91673074-91673096 CTGTTGGGGGTTAGGGGGTGAGG + Intronic
1111812283 13:93106046-93106068 CTGTTGGAGTGTAGGGGGTGGGG - Intergenic
1111963392 13:94835413-94835435 CTTGTAGTGGGTAGGGATGGGGG - Intergenic
1112069368 13:95831121-95831143 CTTGTTGTGGGGTGGGGGTAGGG + Intronic
1112076648 13:95921186-95921208 TCTGTTGGGGGTAGGGGGTGTGG + Intronic
1112714274 13:102165658-102165680 CCTGTTGTGGGTGGGGGGAGGGG + Intronic
1112972011 13:105273034-105273056 CTTGTGAAGAGTAGTGGGTGGGG + Intergenic
1113042137 13:106115960-106115982 CTTGTCGGGGGTAGGGTGTGGGG - Intergenic
1113126979 13:106990189-106990211 CTGGTGCTGGGCTGGGGGTGAGG + Intergenic
1113722686 13:112572415-112572437 CTGTTGGAGGGTGGGGGGTGAGG - Intronic
1113804694 13:113106325-113106347 CATGTGGGGCGTAGGGGATGGGG + Intronic
1113987134 13:114327003-114327025 CAGGCGGTGGGTGGGGGGTGGGG - Exonic
1114487250 14:23070192-23070214 ATGGTGGGGGGTGGGGGGTGCGG + Intronic
1115043110 14:28955579-28955601 CTTGAGCTTGGTAGGGGGAGGGG + Intergenic
1115859390 14:37667316-37667338 AATGTGCTGGGCAGGGGGTGGGG - Intronic
1116177953 14:41497092-41497114 CAGGTGGTGGGTAGGGGGCAAGG + Intergenic
1116233897 14:42253483-42253505 CTGTTGGGGGGTGGGGGGTGGGG + Intergenic
1116915203 14:50518391-50518413 CTTGTTGGTGGTGGGGGGTGAGG - Intronic
1116966090 14:51016463-51016485 CTGCAGGGGGGTAGGGGGTGGGG - Intronic
1117227705 14:53680214-53680236 CTTTTGTGGGGTAGGGGGAGGGG - Intergenic
1117305952 14:54473247-54473269 AATTTGGTGGGTAGGGGGTTGGG - Intergenic
1117583339 14:57174926-57174948 CTTGGGGTGGGGAGGTGGGGCGG + Intergenic
1117691491 14:58311925-58311947 GTTGGGGTGGGCGGGGGGTGAGG + Intronic
1117760880 14:59027064-59027086 CTTTTGAGGAGTAGGGGGTGAGG + Intergenic
1117902625 14:60550984-60551006 GTTCTTGTGTGTAGGGGGTGGGG + Intergenic
1118749371 14:68795307-68795329 TTTGGGGGGGGTGGGGGGTGGGG - Intronic
1119222599 14:72921082-72921104 TCTGTATTGGGTAGGGGGTGGGG + Intergenic
1119231480 14:72983346-72983368 CCTGTGGTGGGGTGGGGGGGAGG - Intronic
1119377167 14:74204064-74204086 CAGGTGGCGGGGAGGGGGTGGGG + Intergenic
1119773444 14:77235468-77235490 ACTGTGGTGGGTGGGGGGTCTGG + Intronic
1119773501 14:77235644-77235666 ACTGTGGTGGGTGGGGGGTCTGG + Intronic
1119773563 14:77235828-77235850 ACTGTGGTGGGTGGGGGGTATGG + Intronic
1119773646 14:77236058-77236080 ACTGTGGTGGGTGGGGGGTATGG + Intronic
1119773682 14:77236165-77236187 ACTGTGGTGGGTGGGGGGTATGG + Intronic
1119773710 14:77236244-77236266 ACTGTGGTGGGTGGGGGGTATGG + Intronic
1119773748 14:77236348-77236370 ACTGTGGTGGGTGGGGGGTATGG + Intronic
1119786384 14:77317500-77317522 CCTGTGGATGGTAGGGAGTGTGG - Intronic
1120201338 14:81540976-81540998 CTTGAGCTTGGTAGGGGGAGGGG + Intergenic
1120398263 14:83995820-83995842 CATGTGGGGGGCAGGGGGCGGGG - Intergenic
1120876372 14:89379733-89379755 CTGGTGGTGGGGAGGGAGGGCGG - Intronic
1121096510 14:91221238-91221260 CCAGTGGTAGGTAGGGAGTGAGG + Intronic
1121391037 14:93574768-93574790 CTAGTGGTGGGTATGGAGAGTGG + Intronic
1121515633 14:94548119-94548141 TTTATGGTGGTTAGTGGGTGGGG + Intergenic
1121539278 14:94712914-94712936 CTTGTGGAGGGGCGGGGGTGTGG + Intergenic
1121630677 14:95419704-95419726 ATGGTGGTGGGGTGGGGGTGGGG + Intronic
1121732587 14:96196949-96196971 CTGGTGGTGGCCAGGGGCTGGGG + Intergenic
1121967505 14:98324162-98324184 CACATGGTGGGTAGGGGGAGTGG + Intergenic
1122160890 14:99783139-99783161 CCTGTTGTGGGTGGGGGGAGGGG - Intronic
1122269254 14:100561025-100561047 CCTGTGGTAGTTGGGGGGTGGGG + Intronic
1122776529 14:104119321-104119343 GTTGTGGTGAGTGGGGGGAGTGG - Intergenic
1123506013 15:20941705-20941727 CTCGTCGTGGGGAGGGGGTTGGG + Intergenic
1123563243 15:21515412-21515434 CTCGTCGTGGGGAGGGGGTTGGG + Intergenic
1123599494 15:21952695-21952717 CTCGTCGTGGGGAGGGGGTTGGG + Intergenic
1124056344 15:26243941-26243963 TTTGCGGGGGGTGGGGGGTGGGG + Intergenic
1124253137 15:28120664-28120686 CCAGTGGTGGGGAGGGTGTGAGG + Intronic
1124255271 15:28136412-28136434 CTTCTGGCGGGGAGGGTGTGAGG + Intronic
1124569041 15:30843208-30843230 CTTCTGGCGGGGAGGGTGTGAGG - Intergenic
1124612528 15:31217878-31217900 TTTCTGGTGGGGTGGGGGTGGGG - Intergenic
1124666713 15:31598805-31598827 CTTGAGCTTGGTAGGGGGAGGGG + Intronic
1124987395 15:34633991-34634013 CTGTTGGTGGGTGGGGGATGGGG + Intergenic
1125110576 15:36027571-36027593 CATGGGGTGGGTAGGAGGGGAGG + Intergenic
1125155096 15:36576993-36577015 CTACTGGGGGGTTGGGGGTGAGG + Intergenic
1125476405 15:40050790-40050812 TATGTGGTGTGTGGGGGGTGTGG + Intergenic
1125675658 15:41501361-41501383 CTTCCGGTGGGTCGGGGGCGTGG + Intronic
1125708825 15:41766967-41766989 CATGTGTAGGGTGGGGGGTGAGG - Exonic
1125716083 15:41820809-41820831 CTGGTGGGAGGTAGGGGGTGGGG - Intronic
1125786423 15:42322470-42322492 TTTATGGTGGTTAGCGGGTGGGG + Intronic
1126439728 15:48674385-48674407 GTGGTGGTGGTAAGGGGGTGAGG - Intergenic
1126506946 15:49416140-49416162 TTGGTGGGGGGTGGGGGGTGGGG - Intronic
1126786128 15:52179427-52179449 CATGCGGAGGGCAGGGGGTGGGG - Intronic
1127366392 15:58294589-58294611 TTTGTGGAGGGTAGGTAGTGTGG - Intronic
1127506547 15:59603575-59603597 ATTTTGGTGGGTAGGGGGATAGG - Intronic
1127601575 15:60542984-60543006 CATGTTGGGGGTGGGGGGTGAGG - Intronic
1127710106 15:61588807-61588829 CCTGTTGGGGGTTGGGGGTGAGG + Intergenic
1127793828 15:62421667-62421689 CTATTGGAGGGTAGGGGGTGGGG + Intronic
1128065669 15:64763045-64763067 GCCGTAGTGGGTAGGGGGTGGGG + Intronic
1128263909 15:66252227-66252249 CCGGTGGGGGGTGGGGGGTGGGG - Intronic
1128383532 15:67130881-67130903 CTAGTGGGGGGTATGAGGTGGGG + Intronic
1128494654 15:68188260-68188282 TTTGTTGTGGGGAGGGGGTCGGG + Exonic
1128595033 15:68937612-68937634 CTGTTGGTGGGTGGGGGGTGAGG - Intronic
1128706380 15:69840031-69840053 CTTGGGGAGGGTGGGGGGTGGGG + Intergenic
1128746293 15:70116769-70116791 CATGTGGAGGGTGGGGGCTGTGG + Intergenic
1129596430 15:76967806-76967828 GTGGGGGTGGGGAGGGGGTGAGG - Intergenic
1129882700 15:79017681-79017703 CTGGTGGCAGGTAGGGGGTGGGG - Intronic
1129919049 15:79303073-79303095 CTGTTGGGGGGTAGGGGATGAGG - Intergenic
1130332402 15:82932671-82932693 CTTGTGGAGGCTCAGGGGTGTGG - Intronic
1130569208 15:85025422-85025444 AGGGGGGTGGGTAGGGGGTGTGG + Intronic
1130937794 15:88485042-88485064 CTTGTGTTGGGGAGGGAGTGTGG - Intergenic
1130975825 15:88773393-88773415 CTTGGACTGGGTAGGGGTTGTGG + Intergenic
1131066007 15:89435520-89435542 CTGGTGGGTGGTGGGGGGTGTGG + Intergenic
1131078322 15:89513222-89513244 AGTGTGGTTTGTAGGGGGTGAGG + Intergenic
1131279585 15:91009704-91009726 CTGGTGGTGGGGGTGGGGTGGGG + Intronic
1131430354 15:92383084-92383106 CCTTTGGAGAGTAGGGGGTGGGG + Intergenic
1131435031 15:92415564-92415586 CTTGTTGTGGGGGCGGGGTGGGG - Intronic
1132011320 15:98279051-98279073 CCTGTTGTGGGGTGGGGGTGGGG + Intergenic
1132159929 15:99531237-99531259 CTTGTTGTGGGTGGGGGGAGGGG - Intergenic
1132334066 15:101032426-101032448 CTTGTATCGGGTAGGGGGAGGGG - Intronic
1202971597 15_KI270727v1_random:242546-242568 CTCGTCGTGGGGAGGGGGTTGGG + Intergenic
1132607512 16:799827-799849 CCTGGAGTGGGTAGGGGGAGAGG - Intronic
1132789450 16:1677554-1677576 CTTGGGGTGGGTGAGGTGTGGGG + Exonic
1132988327 16:2779591-2779613 CCTGTGGTGGGAATGGGGTCAGG + Intergenic
1132989202 16:2784492-2784514 GAGGTGGTGGGTGGGGGGTGGGG + Exonic
1133069533 16:3235844-3235866 GGTGGGGAGGGTAGGGGGTGGGG - Intronic
1133207440 16:4241915-4241937 CATGGGTTGGGTAGGGGGTCGGG - Intronic
1133532392 16:6667103-6667125 GTGGTGGTGGGTTGGGGGAGAGG + Intronic
1133944577 16:10337564-10337586 CTTTTGGGTGGTGGGGGGTGTGG + Intronic
1133981300 16:10635172-10635194 TTTGTGGGGGGTGGGGGGTGGGG - Intronic
1134004297 16:10807565-10807587 CATGTAGTGGGTGGGGGCTGGGG + Intronic
1134298662 16:12969744-12969766 TTTTTGGTGGGGAGGGCGTGGGG - Intronic
1134374490 16:13659098-13659120 AATTTGGTTGGTAGGGGGTGGGG + Intergenic
1134873252 16:17671603-17671625 CTGTTGGTGGGTGGGGGGTTAGG - Intergenic
1135005000 16:18812817-18812839 CTTGTTGTGGGTGGGGGGACAGG - Intronic
1135726083 16:24854807-24854829 CTTCAGGAGGGGAGGGGGTGAGG - Intronic
1136133782 16:28241733-28241755 ATTGCGGTGGGTGGGGGGGGGGG - Intergenic
1136141558 16:28292254-28292276 AGTGGGGTGGGTGGGGGGTGGGG + Intergenic
1136388528 16:29946301-29946323 ATGTTGGTGGGCAGGGGGTGGGG - Intronic
1136535903 16:30899395-30899417 CTTCTGGTGGGAAAGGGGGGAGG - Exonic
1136708945 16:32217354-32217376 CCTGTGGGGGGTGGGGGGTGGGG + Intergenic
1136758964 16:32712070-32712092 CCTGTGGGGGGTGGGGGGTGGGG - Intergenic
1136809143 16:33158314-33158336 CCTGTGGGGGGTGGGGGGTGGGG + Intergenic
1136815619 16:33268394-33268416 CCTGTGGGGGGTGGGGGGTGGGG + Intronic
1137272189 16:46909099-46909121 GTTGGGGTGGGTGTGGGGTGGGG + Intronic
1137296326 16:47097321-47097343 CTTGAGCTTGGTAGGGGGAGGGG + Intronic
1137621360 16:49878522-49878544 CCTGTCGTGGGTTGGGGGAGGGG - Intergenic
1137772226 16:51025519-51025541 CTGGTGAGGGGTAAGGGGTGGGG + Intergenic
1138160398 16:54747789-54747811 CTTGTGGCGGGGGGGGGGGGGGG - Intergenic
1138216708 16:55211008-55211030 CTTGTTGTGCCTAGGGGGAGGGG - Intergenic
1138307579 16:55991823-55991845 CTTTTGGTGGGGAGTGGGAGAGG - Intergenic
1138483373 16:57318743-57318765 CCTGGGGTGGGTGGGGGATGGGG + Intergenic
1138837610 16:60457491-60457513 CTGTTGTGGGGTAGGGGGTGGGG + Intergenic
1139015805 16:62687365-62687387 TTTTTGGTGGGTGGGGGGGGGGG + Intergenic
1139169110 16:64609693-64609715 CTGTTGGGGGGTAGGGGTTGAGG - Intergenic
1139273103 16:65701649-65701671 CCTGTGTTGGGTATGGGGAGGGG - Intergenic
1139512694 16:67436400-67436422 CTGGGGGTGGGGTGGGGGTGGGG + Intronic
1139588059 16:67916954-67916976 CCTGTGGTGTGCAGGGAGTGGGG - Intronic
1140224693 16:73067880-73067902 TTGGTGGTGGGTTGGGGGAGGGG - Intergenic
1140466469 16:75187228-75187250 AATTTGGTGGGTAGGGGGTCAGG + Intergenic
1140588815 16:76326792-76326814 CCTGTTGTGGGGTGGGGGTGGGG + Intronic
1140634552 16:76896157-76896179 CCTGTTGTGGGTCGGGGGAGAGG + Intergenic
1141157738 16:81609179-81609201 GCTGTGGTGGGGAGGGGGGGAGG - Intronic
1141624234 16:85253065-85253087 CTGGTGGGGGGGGGGGGGTGGGG - Intergenic
1142185626 16:88693530-88693552 CCGGGGGTGGGGAGGGGGTGGGG - Intergenic
1203061120 16_KI270728v1_random:972395-972417 CCTGTGGGGGGTGGGGGGTGGGG - Intergenic
1142759732 17:2035441-2035463 CCTGTGGTGGGGAGGTAGTGGGG + Intronic
1142759754 17:2035484-2035506 CCTGTGGTGGGGAGGGGGTGGGG + Intronic
1142759767 17:2035513-2035535 CCTGTGGTGGGGAGGGAGTGGGG + Intronic
1142839063 17:2613251-2613273 CCAGGGGTGGGTGGGGGGTGGGG - Intronic
1142954152 17:3509313-3509335 CTGTTGGGGGGTAGGGGGTGAGG - Intronic
1142965749 17:3580034-3580056 GTTGTGGTGGTTGGGGGGCGGGG - Intronic
1143245969 17:5486180-5486202 AATGGGGTGGGTGGGGGGTGGGG - Exonic
1143513070 17:7406365-7406387 CTTGTTGTGGGGAGGGGGAGGGG + Intronic
1143751979 17:9034895-9034917 TGTATGGTGGGTAGGGGGCGTGG - Intronic
1143871084 17:9957717-9957739 GAGCTGGTGGGTAGGGGGTGTGG - Intronic
1143915989 17:10293359-10293381 CTTGTGGTGGTTAGGAAGAGTGG + Intergenic
1143989534 17:10944899-10944921 TTTGGGGTGGGGAGGGGGTGGGG - Intergenic
1144671821 17:17137188-17137210 CTGGTGGTGGGAAGGGGCAGGGG - Intronic
1144791292 17:17860870-17860892 CCTGTGGCGGTGAGGGGGTGCGG - Intronic
1145104120 17:20100812-20100834 CTGTTGGTGGGTAGGGGGCAAGG - Intronic
1145378860 17:22376154-22376176 GTGGTGGAGGGTTGGGGGTGGGG + Intergenic
1145379336 17:22378524-22378546 GTGGTGGAGGGTTGGGGGTGGGG + Intergenic
1145379814 17:22380894-22380916 GTGGTGGAGGGTTGGGGGTGGGG + Intergenic
1145380294 17:22383269-22383291 GTGGTGGAGGGTTGGGGGTGGGG + Intergenic
1145380773 17:22385616-22385638 GTGGTGGAGGGTTGGGGGTGGGG + Intergenic
1145381252 17:22387991-22388013 GTGGTGGAGGGTTGGGGGTGGGG + Intergenic
1145381985 17:22391766-22391788 GTGGTGGAGGGTTGGGGGTGGGG + Intergenic
1145382460 17:22394130-22394152 GTGGTGGAGGGTTGGGGGTGGGG + Intergenic
1145383314 17:22398316-22398338 GTGGTGGAGGGTTGGGGGTGGGG + Intergenic
1145383682 17:22400051-22400073 GTGGTGGAGGGTTGGGGGTGGGG + Intergenic
1145383827 17:22400784-22400806 GTGGTGGAGGGTTGGGGGTGGGG + Intergenic
1145384265 17:22402986-22403008 GTGGTGGAGGGTTGGGGGTGGGG + Intergenic
1145384584 17:22404448-22404470 GTGGTGGAGGGTTGGGGGTGGGG + Intergenic
1145750594 17:27353039-27353061 CTGGTGAGGGGTAGGAGGTGGGG + Intergenic
1145828893 17:27898882-27898904 GTTGAGGTGGGCAGAGGGTGCGG + Intergenic
1145850863 17:28094643-28094665 TTTGAGGTGGGTGGGTGGTGGGG + Intronic
1146147548 17:30434335-30434357 CTTGTGGTGGGGCGAAGGTGGGG - Intronic
1146190296 17:30759709-30759731 TTTTTGGTGGGTGGGTGGTGGGG + Intergenic
1146197192 17:30824148-30824170 CCTGCGGTGGGTAGGCGGGGAGG - Intronic
1146450409 17:32969599-32969621 GTTGTGGGGTGTTGGGGGTGGGG + Intergenic
1146617381 17:34367714-34367736 CTTGCAGTAGGTAGGGGGTCTGG - Intergenic
1146899435 17:36572845-36572867 ATTGTGGTTGCTAGGGGGTGAGG - Intronic
1147334553 17:39719546-39719568 CTTGTGGTGGATAGGAAGCGGGG - Intronic
1147394388 17:40130336-40130358 CTTGGGGAGGGTGTGGGGTGTGG + Intronic
1147457210 17:40545348-40545370 CTTGGTTTGGGTAGGGGGTGGGG + Intergenic
1147576131 17:41600083-41600105 GTTGTGCTGGGTTTGGGGTGGGG - Intergenic
1147746362 17:42697252-42697274 CCTGAGGTGGGGAGGGGGAGGGG - Exonic
1147840966 17:43371163-43371185 CTGGAGGTGGGCAGGGGGTGGGG + Intergenic
1147948310 17:44092806-44092828 CCTGGGGTGGGGGGGGGGTGGGG + Exonic
1148080741 17:44966768-44966790 CCTGAGGCGGGGAGGGGGTGGGG - Intronic
1148205573 17:45777704-45777726 CATTTGGTGGGTAGAGGCTGTGG - Intergenic
1148442677 17:47719882-47719904 CTTGGAGTGGGGAGGGGTTGGGG + Intergenic
1148698350 17:49574511-49574533 CTTGGTGTTGGTGGGGGGTGGGG - Intergenic
1148909657 17:50934365-50934387 ATGCAGGTGGGTAGGGGGTGGGG + Intergenic
1149377347 17:56058583-56058605 CTTTTGGGGGGTAGGGGGCAAGG - Intergenic
1149431272 17:56596765-56596787 GTTGGGGGGGGTGGGGGGTGGGG - Intergenic
1149630297 17:58116457-58116479 ATCTTGGTGGGTAGGGGTTGTGG - Intergenic
1149692251 17:58587849-58587871 CTGGTGGTGGAGCGGGGGTGGGG - Intronic
1150343706 17:64388176-64388198 CATGTGGTGTGGAGGGGGAGAGG + Intronic
1150592741 17:66577834-66577856 GTAGTGGGGGGTAGGGAGTGGGG + Intronic
1151130619 17:71893107-71893129 CTGGTGGGGGGTGGGGGGTGGGG + Intergenic
1151263121 17:72932439-72932461 CCTGTGGGGGGTGGGGGGTAGGG - Intronic
1151406065 17:73887148-73887170 TTTGTGGTAGGTTGGGGGGGTGG + Intergenic
1151412850 17:73942676-73942698 CCTGGGGTGGGGAGAGGGTGGGG - Intergenic
1151496430 17:74460796-74460818 CCAGGGATGGGTAGGGGGTGGGG + Intergenic
1151550973 17:74822342-74822364 CTGGGGGTGGGAAGGGGCTGGGG - Intronic
1151751123 17:76038428-76038450 AATTTGGTGGGTAGGGGGTCAGG - Intergenic
1151826939 17:76529051-76529073 CTTTGCGTGGGTGGGGGGTGGGG - Intronic
1152068211 17:78122888-78122910 CTGGTGGTGGGGCAGGGGTGTGG - Intronic
1152133708 17:78492074-78492096 CTTCTGATGGGTAGGGTGCGGGG + Intronic
1152233512 17:79126465-79126487 CCTCTGGCAGGTAGGGGGTGTGG + Intronic
1152464143 17:80456362-80456384 CTAGTGCTGGGTGGGGGGGGGGG - Intergenic
1152502840 17:80724668-80724690 CCTGTGGTGGGTTGGAGTTGGGG + Intronic
1153125953 18:1790469-1790491 CTGTTGAGGGGTAGGGGGTGAGG + Intergenic
1153133534 18:1885739-1885761 CCTGTTGTGGGGTGGGGGTGGGG + Intergenic
1153464366 18:5372641-5372663 CTTGTTGTGGGGTGGGGGAGAGG + Intergenic
1154364623 18:13695707-13695729 CCTGCGGTGGGTGGGGGGAGGGG + Intronic
1155297229 18:24396678-24396700 CTTGGGGTGGGGAGGGAGGGGGG + Intronic
1155492055 18:26408956-26408978 CCTGGGGTGGGTGGCGGGTGTGG + Intergenic
1155510294 18:26569571-26569593 CAGGTGGGGGGTGGGGGGTGCGG + Intronic
1156380445 18:36554479-36554501 CCTGTCGTGGGGTGGGGGTGGGG + Intronic
1156472121 18:37383933-37383955 GTTGTGGCGGTGAGGGGGTGGGG + Intronic
1156778883 18:40826159-40826181 CTGCTGGTGAGTGGGGGGTGAGG + Intergenic
1156810053 18:41237934-41237956 CCTGTTGTGGGTGGGGGATGAGG + Intergenic
1156827089 18:41444007-41444029 CTTGTGGAGGGGAGGTGGTGGGG - Intergenic
1157111040 18:44820492-44820514 ATGGTGGTGGGTGGGGGATGGGG + Intronic
1157216958 18:45792192-45792214 CTTGTGGGGGGTGGAGGGTGGGG + Intergenic
1157450633 18:47784495-47784517 TTTTTGGGGGGTGGGGGGTGGGG + Intergenic
1157516946 18:48317980-48318002 CCTGAGATGGGCAGGGGGTGAGG - Intronic
1157749625 18:50166661-50166683 CTTTTGGTAGGCGGGGGGTGGGG - Intronic
1157837920 18:50924999-50925021 ATGGTGGTTGTTAGGGGGTGGGG - Intronic
1158063887 18:53381556-53381578 GTGGTGGTGGGGGGGGGGTGGGG - Intronic
1158330229 18:56354347-56354369 CTTTTGGAGGGTGGAGGGTGGGG - Intergenic
1158505820 18:58044874-58044896 CTTGCGGAGGGTGGGGGGTGCGG - Intronic
1158640005 18:59195745-59195767 CTCGGGGTGGGTTGGGGGAGTGG - Intergenic
1160240417 18:77118789-77118811 CGTATAGTGTGTAGGGGGTGTGG - Intronic
1160609252 18:80073181-80073203 CTGGTGGGGGGTGGGGGGCGGGG - Intronic
1160989281 19:1853972-1853994 CTTTCGGTGGGGTGGGGGTGGGG + Exonic
1161044035 19:2124985-2125007 CTTGTGGGAGGTGGGGGGTGAGG + Intronic
1161245382 19:3249042-3249064 TGTGTGGTGGGGAGGGGGTAGGG - Intronic
1161401406 19:4067412-4067434 CCGGGGGTGGGTTGGGGGTGAGG + Intergenic
1161579306 19:5071947-5071969 CTTGGGGTGCGTGAGGGGTGAGG + Intronic
1161596255 19:5152465-5152487 CTTCTGGTTGGTAGTGAGTGTGG + Exonic
1161861528 19:6801690-6801712 CTGGTGCTGGGGTGGGGGTGGGG + Intronic
1162473936 19:10888636-10888658 GTTGTGGAGGGTAGGGGGTGGGG - Intronic
1162547045 19:11337136-11337158 CTGGCTGTGGGTTGGGGGTGGGG - Intronic
1163020019 19:14476901-14476923 CTTGCGGTGGTGAAGGGGTGTGG - Intergenic
1163088312 19:14999370-14999392 CTTGAGGTGGGTAGGAGTTGGGG - Intronic
1163491673 19:17620520-17620542 CTCGTGGGGGGTGGTGGGTGGGG - Intronic
1163563145 19:18032880-18032902 CTGGGGGTTGGTGGGGGGTGGGG - Intergenic
1164151469 19:22556591-22556613 TTGGTGGTGGTGAGGGGGTGCGG - Intergenic
1164458205 19:28426732-28426754 GTGGTGGGGGGTGGGGGGTGAGG - Intergenic
1165078235 19:33292525-33292547 TTTGTGGGGGGGAGGGGGTGTGG + Intergenic
1165112577 19:33510961-33510983 CTGGGGGTGGGTAGGGGAGGTGG - Intronic
1165742515 19:38212182-38212204 CTCGGGGTGGGAAGGGGCTGGGG - Intronic
1165769997 19:38374491-38374513 CGTGAGGTGGGTAGGGGGGGTGG + Intergenic
1165830361 19:38727628-38727650 CTGGTGGAGGGTCGGGGGGGGGG - Intronic
1166344003 19:42154100-42154122 CTTGTGGTGGGGGGAGGGCGGGG - Intronic
1166705595 19:44906321-44906343 CCGGCGGTGGGGAGGGGGTGGGG + Intronic
1166733305 19:45070642-45070664 CTGGAGGTGGGTACAGGGTGAGG - Intronic
1167175346 19:47860675-47860697 CATATGGTGGGTGCGGGGTGGGG + Intergenic
1167306937 19:48714871-48714893 CTCCTGGTGGGCAGGGAGTGAGG + Exonic
1167663514 19:50810392-50810414 ATTGTGGTGGGGAAGGGTTGTGG + Intergenic
1168483829 19:56743752-56743774 CTGTTGGTGGGTAGGCGGTGAGG - Intergenic
1168691307 19:58379233-58379255 CTTGTGGGAGGTGGGGGCTGAGG + Intronic
925053889 2:840547-840569 CTGTTGGAGGGTAGGAGGTGAGG + Intergenic
925130042 2:1488342-1488364 CTTGTGGTGGGGAGGAGAAGGGG - Intronic
925139870 2:1542852-1542874 CTGGTGATGGGCAGGGGGTGTGG - Intronic
925156192 2:1650332-1650354 CTTGCTGTGGGGAGGGCGTGTGG - Intronic
925740201 2:6998888-6998910 CTTGTGGGGGGTGGGGGCGGGGG + Intronic
925875761 2:8310067-8310089 CGTGTGGTGGCAATGGGGTGGGG + Intergenic
926289673 2:11518520-11518542 CAGGGGGCGGGTAGGGGGTGGGG + Intergenic
926681162 2:15665173-15665195 CATGAGGTGGGGAGGGGGTTGGG + Intergenic
927086423 2:19677646-19677668 GGTGTGGTGGGTATGGTGTGTGG + Intergenic
927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG + Intergenic
927217481 2:20676165-20676187 ATGGTGGTGAGGAGGGGGTGAGG - Intergenic
927248811 2:20980172-20980194 CCTGTTGTGGGTTGGGGCTGGGG + Intergenic
927348648 2:22078917-22078939 CCTGTGGTGAGTAGGAGATGAGG - Intergenic
927385505 2:22528845-22528867 TTTTTGGTGGGAAGGGGGTTGGG + Intergenic
927686984 2:25178015-25178037 CTGGAGGTGGGGTGGGGGTGGGG - Intergenic
927897187 2:26790671-26790693 CTGGTGGTGGGGAGGGAGGGAGG + Intronic
928091146 2:28375906-28375928 CTTGGGGTTGGGAGGGGGCGGGG - Intergenic
928330849 2:30356808-30356830 CTTGTTGAGGTTAGGGGATGGGG + Intergenic
928331640 2:30361972-30361994 GGTATGGTGGCTAGGGGGTGTGG - Intergenic
929319848 2:40529637-40529659 CTGTTGGGGGGTAGGGGGTAAGG + Intronic
929664514 2:43823277-43823299 CTGGTGGTGGGGGCGGGGTGGGG - Intronic
929833128 2:45366336-45366358 CTTTTGGTGGGTGGGAGGTTGGG - Intergenic
930405570 2:50951316-50951338 CCTTTAGTGGGTAGGGGTTGGGG + Intronic
930857431 2:56033735-56033757 TCTGTTGTGGGTGGGGGGTGGGG + Intergenic
930861795 2:56081933-56081955 CCTGTTGGGGGTGGGGGGTGAGG + Intergenic
931074596 2:58695689-58695711 CTTGTAGTGGGTGGTGGGAGTGG - Intergenic
931076028 2:58713195-58713217 CTTGTGGTGTGTACATGGTGAGG - Intergenic
931394216 2:61871475-61871497 CTTTTGGTTGGTAGGGGATGAGG - Intronic
931558090 2:63527367-63527389 CCTGTCGTTGGTTGGGGGTGGGG - Intronic
931576014 2:63719620-63719642 CGTGTGGTGGGTGGGCTGTGTGG + Intronic
932202709 2:69845967-69845989 TTTTTGGTGGGGAGGAGGTGGGG + Intronic
932414899 2:71567743-71567765 TTGGTGAGGGGTAGGGGGTGGGG + Intronic
932510420 2:72282066-72282088 CTTTTTGTTGGCAGGGGGTGAGG - Intronic
932695037 2:73948840-73948862 CTTGTGGTGGTGATGGGGTGAGG - Intronic
933316912 2:80726753-80726775 CTGCTGCTGGGTGGGGGGTGGGG - Intergenic
933393180 2:81698253-81698275 CTTGTGGATGGTAGAGGGCGAGG + Intergenic
933413529 2:81954748-81954770 TGTGTGGTGGGTGGGGAGTGAGG + Intergenic
934503216 2:94874551-94874573 CCCGGGGTGGGTAGGGTGTGGGG + Intronic
934780380 2:96966129-96966151 CTGGTGGGGGATAGGAGGTGAGG - Intronic
935231502 2:101101889-101101911 CTGTTGGGGGGTAGGGGGTGAGG + Intronic
935356046 2:102200820-102200842 CTTCTGGTTGGTTGGGTGTGAGG + Intronic
935885869 2:107618425-107618447 TTTGTGGGGGGAAGGGGATGGGG - Intergenic
935980539 2:108621844-108621866 TTTGTGGTGGTTTGGGGTTGGGG + Intronic
936463078 2:112725844-112725866 CTTGGGGTGGGTGGGGAGGGTGG - Intronic
936897749 2:117447002-117447024 CTTGTCGGGGGTTGGGGGCGAGG - Intergenic
937148077 2:119664382-119664404 CTTCTGGAAGGTGGGGGGTGGGG - Intergenic
937148438 2:119668298-119668320 CTGTTGGTGGGTGGCGGGTGAGG + Intergenic
937319309 2:120951440-120951462 CTGATGGTGAGTAGGGTGTGGGG + Exonic
937437243 2:121890578-121890600 CTGGGGGTGGGGAGAGGGTGGGG - Intergenic
937576564 2:123429715-123429737 CTGTTGGCGGGTAGGGGGTTAGG - Intergenic
937976931 2:127588208-127588230 TTTGTGCTGGGTAGATGGTGGGG + Intronic
937977258 2:127589472-127589494 TTTGTGCTGGGTAGATGGTGGGG + Intronic
938831306 2:135052547-135052569 CTTGTGGTGTGTCTGGGGTCAGG - Intronic
939190092 2:138907280-138907302 CTGGGGCTGGGTAGGGGATGGGG - Intergenic
939322951 2:140648282-140648304 CATGTGGTGGGGTGGGGGAGTGG + Intronic
939408244 2:141788686-141788708 CCTGTTGTGGGGTGGGGGTGGGG - Intronic
939468458 2:142588262-142588284 AATGTGGTGGGTAGGGGGCTGGG + Intergenic
940312364 2:152292112-152292134 ATGGTGGTGGGGTGGGGGTGAGG - Intergenic
940433438 2:153621709-153621731 GTGGTGGTGGGTACTGGGTGAGG - Intergenic
940886927 2:158998417-158998439 TTTGTTGGGGGTAGGGGCTGGGG - Intronic
940938591 2:159528957-159528979 GTTGTGGGGGGGTGGGGGTGGGG + Intronic
941563749 2:167082093-167082115 ACTGTGGTGGGTAGAGGGAGGGG - Intronic
941668929 2:168270093-168270115 ATAGTGGGGGGTTGGGGGTGAGG + Intergenic
942710174 2:178825613-178825635 TTGGTGGGGGGTGGGGGGTGGGG - Intronic
943001788 2:182336843-182336865 CCTGTTGGGGGTAGGGTGTGAGG + Intronic
943150675 2:184108157-184108179 CCTGTCGTGGGGTGGGGGTGGGG + Intergenic
943291557 2:186078635-186078657 CCTGTTGTGGGTGGGGGGAGTGG + Intergenic
943552479 2:189357557-189357579 CTTGAGCTTGGTAGGGGGAGGGG - Intergenic
943923352 2:193738726-193738748 GTGGTGGTGGATATGGGGTGAGG + Intergenic
944216904 2:197265243-197265265 TTTTTGGTGGGGAGGGGGTGGGG + Intronic
944305946 2:198180235-198180257 CTTGGCTGGGGTAGGGGGTGGGG - Intronic
944894739 2:204152373-204152395 TTCTGGGTGGGTAGGGGGTGGGG - Intergenic
945261526 2:207848227-207848249 TTTTTGGTGGGGAAGGGGTGGGG - Intronic
945398715 2:209353709-209353731 CTGGTGTGGGGTAGGGGGAGGGG + Intergenic
945467598 2:210187306-210187328 CCTGTGGAGGGTAGGGGGGTAGG + Intergenic
945829187 2:214762880-214762902 GTAGTGGTGGGAGGGGGGTGGGG - Intronic
946308928 2:218872164-218872186 CTTGCAGTGGGTAGGAGGTCTGG + Intronic
946705920 2:222458795-222458817 CTTGCGCTGGGCTGGGGGTGAGG - Intronic
946795094 2:223342014-223342036 CGTGTTGCGGGTCGGGGGTGGGG + Intergenic
946848200 2:223879814-223879836 CTTGAGATGGGTCAGGGGTGAGG + Intronic
947180663 2:227408451-227408473 GTGGTGGTGGGTTGGGGGTGGGG + Intergenic
947592446 2:231393409-231393431 CTGATGGTGGGGTGGGGGTGGGG - Intergenic
947994323 2:234514401-234514423 TTTGTGGTAGGTAGAGTGTGTGG + Intergenic
948232863 2:236364986-236365008 TTTGTGGTTAGTAGGGGCTGCGG + Intronic
948563641 2:238870135-238870157 GGTGTGGTGTGTATGGGGTGTGG - Intronic
948563837 2:238871122-238871144 GGTGTGGTGTGTATGGGGTGTGG - Intronic
948776256 2:240290439-240290461 CTTGTGGTGGGGAGGCGGGCAGG - Intergenic
1168778054 20:464569-464591 GTGGTGGTGGGAATGGGGTGGGG - Intergenic
1168923704 20:1562436-1562458 ATCGTGGGGGGTTGGGGGTGGGG - Intronic
1169040772 20:2493615-2493637 ATGGTGGGGGGTGGGGGGTGGGG - Intronic
1169172743 20:3478529-3478551 CTTTCGGTGGGTAGGGGGATAGG + Intronic
1169321591 20:4637302-4637324 CTTGTGGGGGGGTGGGGGGGTGG + Intergenic
1169445258 20:5666177-5666199 CTTTTTATGGGGAGGGGGTGGGG - Intergenic
1169867443 20:10217346-10217368 TGTGTGGTGGGGCGGGGGTGGGG + Intergenic
1170110417 20:12798556-12798578 CCTCTGGTAGGTAGGGGCTGGGG - Intergenic
1170180196 20:13521625-13521647 CTTGTTGTGGGGTGGGGGAGGGG + Intronic
1170237297 20:14120900-14120922 CCTGTTATGGGTGGGGGGTGAGG + Intronic
1171127183 20:22612838-22612860 CTGTTTGTGGGTAGGGAGTGAGG + Intergenic
1171127840 20:22619999-22620021 CCTGGGGTGGGTTGGGGGAGGGG + Intergenic
1171216318 20:23355055-23355077 GTGGTGGTGGGTAGGGGGGTTGG + Intergenic
1171389984 20:24795126-24795148 CTTGGGGTGAGTAGGAGGTTGGG - Intergenic
1171559624 20:26111571-26111593 GTTGTGGTGTGTGGGGAGTGGGG - Intergenic
1171911899 20:30970415-30970437 CTTTTGATGGGTGGGGAGTGGGG + Intergenic
1172232529 20:33346736-33346758 CTTGTGGGGGGGGGGGGGGGGGG + Intergenic
1172448607 20:35006214-35006236 CTGCTTGTGGGTAGGGAGTGAGG - Intronic
1172867691 20:38112653-38112675 GTTGTGGGGGGCGGGGGGTGGGG + Intronic
1173273617 20:41558841-41558863 GTGGTGGTGGGTGGGAGGTGGGG - Intronic
1173307500 20:41863951-41863973 CATGTGGTGGGTCAGAGGTGGGG + Intergenic
1173787984 20:45808873-45808895 TTTGTTGTGAGAAGGGGGTGGGG + Intronic
1173985059 20:47254715-47254737 TTTGTGGTGGGGGTGGGGTGGGG + Intronic
1174588292 20:51625443-51625465 CGTGTGGTGGGGATCGGGTGTGG - Intronic
1174703910 20:52636528-52636550 CTTGTGCTGGGTTGGGGAAGTGG + Intergenic
1175709568 20:61208517-61208539 TTTGCAGTGGGTTGGGGGTGGGG - Intergenic
1175997413 20:62817806-62817828 CTGCTGGTGGGTAGGGGTGGAGG + Intronic
1176043884 20:63082586-63082608 CTTGGGGGCGGTGGGGGGTGGGG + Intergenic
1176736407 21:10551280-10551302 CTGTTGTTGGGTAGGGGGAGGGG + Intronic
1177636569 21:23795093-23795115 CTTGTTGGGGGGTGGGGGTGGGG - Intergenic
1177866631 21:26520226-26520248 CTGTTGGGGGGTAGGGGTTGAGG - Intronic
1177867160 21:26526010-26526032 CTTTTGGAGGGTGGAGGGTGTGG + Intronic
1178259426 21:31085238-31085260 CTTGTGGAGGCGGGGGGGTGGGG - Intergenic
1178690075 21:34743267-34743289 CCTGTTGTGGGTAGGGGATGTGG - Intergenic
1178757901 21:35370252-35370274 TTTGTTGTGGGTGGAGGGTGGGG + Intronic
1178815462 21:35925189-35925211 CTTCTGGTGGTTTGGTGGTGAGG - Intronic
1179061654 21:37984804-37984826 TTTGTGGTGGTTAGTGGATGGGG + Intronic
1179526175 21:41977381-41977403 CTTCTGCTGGGCAGGGAGTGTGG - Intergenic
1179804321 21:43827174-43827196 GGTGTGGGGGGTATGGGGTGGGG + Intergenic
1180016626 21:45090422-45090444 CTTTTGGTGGGAAGGAGGAGTGG + Intronic
1180736665 22:18022759-18022781 CTTGTAGTGAGTGGGTGGTGGGG + Intronic
1181025068 22:20123291-20123313 TTTGTGGTGTCTAAGGGGTGTGG + Intronic
1181107228 22:20582535-20582557 CGTGCGGTGGGCAGGTGGTGTGG + Intronic
1181335491 22:22125165-22125187 CCTGTGGTGGGGACGGGTTGTGG + Intergenic
1181335526 22:22125294-22125316 GTGGTGGAGGGCAGGGGGTGGGG + Intergenic
1181573985 22:23782478-23782500 CTGATGGTGCGTTGGGGGTGAGG + Exonic
1181988638 22:26820084-26820106 CTGGTGGGGGGCGGGGGGTGGGG - Intergenic
1182080248 22:27523733-27523755 CATCTGGTGGGCAGGGGGTGGGG + Intergenic
1182112035 22:27730900-27730922 CTTGTGCTGGGGAGGTGGAGAGG - Intergenic
1183266498 22:36829596-36829618 CTGGTGTGGGGTGGGGGGTGAGG + Intergenic
1183690247 22:39384167-39384189 CTTTTGGTGGACAGTGGGTGAGG - Exonic
1183709372 22:39493432-39493454 CTTGGAGTGGGGATGGGGTGAGG + Intergenic
1183838537 22:40477753-40477775 CTTGGTGGGGGTTGGGGGTGGGG + Intronic
1183874404 22:40766703-40766725 TTTGTGGTGGGTGGGGGGTGCGG + Intergenic
1184097872 22:42326279-42326301 CCTGTGGGGGGCAGAGGGTGAGG - Intronic
1184241362 22:43212715-43212737 CCTGGGGTGGGGACGGGGTGGGG + Intronic
1184280009 22:43432014-43432036 CTGGTGGTGGGTGGGAGCTGAGG + Intronic
1184805412 22:46792298-46792320 CTTGTGTGGGGTGTGGGGTGTGG + Intronic
1185107436 22:48882142-48882164 CGTGTGGTGTGTAGTGTGTGTGG - Intergenic
949580603 3:5384117-5384139 CTTGAGCTCGGTGGGGGGTGGGG - Intergenic
949614569 3:5739377-5739399 TTTGTGGGGGGTGGGGGTTGGGG + Intergenic
949796860 3:7860831-7860853 CTTTTGGGGGGTTGGGGGTGAGG + Intergenic
949929063 3:9064262-9064284 GTGGTGGTGGGTAGGGGGGATGG - Intronic
950043852 3:9937500-9937522 CTTGAGGAGGGTGGTGGGTGGGG + Intronic
950170021 3:10832371-10832393 CTTGTGCTGAGTAGGGGCTTGGG + Intronic
950198954 3:11029162-11029184 CTTTGGGTGGGTTGGGGCTGGGG + Intronic
950230401 3:11271065-11271087 TTTGGGGAGGGTGGGGGGTGGGG + Intergenic
950424541 3:12917981-12918003 TGTGTGTTGGGGAGGGGGTGAGG + Intronic
951025446 3:17823856-17823878 GTTGTTGTGGGATGGGGGTGGGG + Intronic
951187602 3:19732383-19732405 TGTGTGTTGGGTGGGGGGTGGGG - Intergenic
951436984 3:22676463-22676485 CCTGTGGTGGTTATGGGGAGAGG - Intergenic
951498355 3:23355223-23355245 CTGGTGGGGGGTTGGGGGAGGGG + Intronic
951581125 3:24164694-24164716 CTTCTGGCGGGTAGGTGTTGTGG - Intronic
951701192 3:25498261-25498283 TGTGTGGCGGGTAGGGGGTGGGG - Intronic
951879810 3:27469383-27469405 CTTGTGATTAGTAGGGGATGGGG - Intronic
951911349 3:27753756-27753778 ATGGTGGTGAGTGGGGGGTGGGG + Intergenic
952086141 3:29824109-29824131 CGTGGGGTGGGGTGGGGGTGGGG - Intronic
952207178 3:31191727-31191749 AGTGGGGTGGGTGGGGGGTGGGG - Intergenic
952481405 3:33765347-33765369 CTTGAGGTGGGAGGGGGGAGGGG - Intergenic
952670237 3:35958169-35958191 CCTGTTGTGGGGTGGGGGTGGGG - Intergenic
953071223 3:39521950-39521972 CTTGTGGTGGTGAGTGGGTATGG + Intronic
953091414 3:39730121-39730143 CCTGTTGTGGGGTGGGGGTGAGG - Intergenic
953172617 3:40521640-40521662 ATTGTAGTGGCTAGTGGGTGGGG + Intergenic
953453631 3:43024566-43024588 GCTGTGTTGGGTAGTGGGTGGGG + Intronic
954072659 3:48154364-48154386 TTTGTGGTGGGCGGGGGGGGGGG - Intergenic
954405869 3:50344810-50344832 CTGGTGGTGGGGAAGGGGTGGGG - Intronic
954703687 3:52466898-52466920 CAGGTGGTGGGCAGGTGGTGCGG + Intronic
954750347 3:52810056-52810078 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
954777148 3:53029787-53029809 CATGTGGTGGGTGGAGGGTGGGG + Intronic
955005884 3:54968145-54968167 CTTGTGTTGGGGTGGGGGTAGGG + Intronic
955347069 3:58169309-58169331 TCTTTGGTGGGTAGGGGGTGGGG + Intronic
955831586 3:63010198-63010220 CTGTTGGAGGGTAAGGGGTGAGG - Intergenic
956328204 3:68076454-68076476 CTGGTGGGGGGTGGGGGGAGGGG - Intronic
956609928 3:71112106-71112128 CTGGTGGTGGGTGGGGGGGTGGG + Intronic
956625181 3:71259871-71259893 CCTTTGGTGGATAGAGGGTGGGG + Intronic
957080619 3:75633060-75633082 GCTGTTGTGGGTAGGGGCTGTGG + Intergenic
957087222 3:75692335-75692357 CTGCTGCTGGGTGGGGGGTGGGG - Intergenic
957244513 3:77700832-77700854 CCTGTGGTGGGTTGGGGGGATGG + Intergenic
958049177 3:88322350-88322372 GTTGGGGTGGATAGGGAGTGAGG - Intergenic
958061886 3:88494426-88494448 CCTGTTGTGGGTTGGGGGAGTGG - Intergenic
958164674 3:89864531-89864553 CCTGTGGAGGGTTGGGGGTTGGG + Intergenic
959596811 3:108137400-108137422 CTTGGGGTGGGGGGGGGGCGGGG + Intergenic
959724972 3:109532999-109533021 GTGGTGGTGGCTATGGGGTGAGG - Intergenic
960481183 3:118191832-118191854 CTGTTGTGGGGTAGGGGGTGGGG - Intergenic
960565679 3:119129152-119129174 CCTGTTGTGGGGTGGGGGTGAGG + Intronic
960865386 3:122194445-122194467 CAAGTGGTGGGTAGGGGGACAGG - Intronic
961465336 3:127077814-127077836 CTGGCCGTGGGTCGGGGGTGTGG + Intergenic
961520253 3:127463311-127463333 TTGGTGGTGGGTGGGGGCTGGGG - Intergenic
962064389 3:131963539-131963561 CTTGAGCTTGGTAGGGGGAGGGG + Intronic
962120858 3:132558470-132558492 CTTGAGGTGGGGTGGAGGTGGGG - Exonic
962385886 3:134932352-134932374 CTTGAGGTGGGCAGCTGGTGGGG - Intronic
962659219 3:137584658-137584680 GTTTTGGTGGGGAGAGGGTGTGG - Intergenic
962692488 3:137913276-137913298 CTGTTGGTGGGTTGGGGGTGAGG + Intergenic
963340554 3:144027302-144027324 GTCGTGGTGTGTAGGGAGTGGGG + Intronic
963480514 3:145867728-145867750 TTTATGGTGGTTATGGGGTGGGG + Intergenic
963579563 3:147108479-147108501 CTTGTTGTGGGTGGGGGAGGGGG - Intergenic
964376327 3:156052132-156052154 GTTGTGGGGGGCAGGGGGAGGGG - Intronic
964450633 3:156809494-156809516 GGTGTGGTGGGAAGGGGATGAGG + Intergenic
964505155 3:157391127-157391149 CCTGTGGTGGGCATGGGGTCTGG + Intronic
964672753 3:159244887-159244909 CTGGTGGGGGGTAAGTGGTGTGG + Intronic
965177985 3:165361095-165361117 CCTGTTGTGGGTGGGGGGAGGGG - Intergenic
965318536 3:167222416-167222438 GTAGTGGAGGGTAGGAGGTGGGG + Intergenic
965597252 3:170421145-170421167 CTGGGGGTGGGGGGGGGGTGGGG + Intronic
965813584 3:172615067-172615089 CTTGAGGTGGGGTGGGGGTGTGG + Intergenic
966117846 3:176486317-176486339 CCTGTTGGGGGTGGGGGGTGAGG - Intergenic
966560825 3:181318104-181318126 TTTGTGGTGGGGAGGGTGGGTGG - Intergenic
966639607 3:182175080-182175102 TCTGTGGTGGGTGGTGGGTGGGG + Intergenic
967228031 3:187311991-187312013 GTGGGGGTGGGGAGGGGGTGGGG + Intergenic
967309965 3:188096471-188096493 CTCGAGGTGGGAAGGGGGAGCGG - Intergenic
967853595 3:194100167-194100189 CTTGTGGGCGGTGGGTGGTGGGG - Intergenic
967962074 3:194933501-194933523 CTTCTGTTGGGTGGGTGGTGGGG + Intergenic
967991342 3:195133333-195133355 CTTGGGGTGGGGAGTGGGAGAGG + Intronic
968107694 3:196014103-196014125 GTTGTGGTGGGCAGGTGTTGTGG + Intergenic
968107705 3:196014147-196014169 GTTGTGGTGGGCAGGTGTTGTGG + Intergenic
968380330 4:89788-89810 CTTTTTGTGTGTAGGGGGTTGGG + Intergenic
968429095 4:544809-544831 GTGGTGGTGGCTAAGGGGTGAGG - Intergenic
968487126 4:868073-868095 CTTGGGGTGTGTCTGGGGTGAGG + Intronic
968647819 4:1749046-1749068 GGCGTGGTGGGGAGGGGGTGCGG - Intergenic
969162529 4:5273835-5273857 ACTGTGGTGGGTGGGGGGAGGGG + Intronic
969686722 4:8679602-8679624 CCTGTGGTGAGTGAGGGGTGAGG - Intergenic
969865607 4:10075263-10075285 CTTGTGGTGGGGTGGGGGCATGG + Exonic
969935859 4:10680360-10680382 CCTGTGGTGGGTTGGGGGGAGGG + Intronic
970192331 4:13528520-13528542 CTTCAAGTGGGTAGAGGGTGAGG + Intergenic
970665970 4:18337417-18337439 CTGTTGGGGAGTAGGGGGTGAGG - Intergenic
970782909 4:19760094-19760116 CCTGTTGGGGGTTGGGGGTGAGG + Intergenic
970952203 4:21770116-21770138 CTGTTGGGGGTTAGGGGGTGAGG - Intronic
971174486 4:24267588-24267610 CTTGGGGTGAGAAGAGGGTGAGG + Intergenic
971691325 4:29840417-29840439 ATTGGGGTGGGTAGTGGGAGAGG - Intergenic
971920782 4:32936750-32936772 ACTGTGGTGGGGAGGGGGGGAGG - Intergenic
972025546 4:34371832-34371854 TGTGTGGTGTGTTGGGGGTGTGG + Intergenic
972272170 4:37522340-37522362 ATGGTGGTGGCTATGGGGTGAGG - Intronic
972567936 4:40285703-40285725 CTTCTGGTGGGAAGGGGATGGGG + Intergenic
972651896 4:41025848-41025870 ATGGTGGGGGGTAGGGGTTGGGG + Intronic
972852863 4:43072061-43072083 CTGGGGGTGGGTAGGGAGTTAGG + Intergenic
972864227 4:43210462-43210484 CCTGTCGTGGGGTGGGGGTGGGG + Intergenic
972910101 4:43804597-43804619 GTAGTGGGGAGTAGGGGGTGAGG + Intergenic
972957234 4:44407915-44407937 CTTGTGTAGAGTATGGGGTGCGG - Intronic
973599678 4:52529619-52529641 CTGGTGGTGGGTGGGGGTGGGGG - Intergenic
973773493 4:54226696-54226718 CGTGTGGGGGGTGGGGGGAGGGG - Intronic
974016213 4:56651608-56651630 ACTGTGATGGGTAGGGGCTGGGG + Intronic
974346912 4:60693979-60694001 CTGTTGGAGGGTGGGGGGTGAGG + Intergenic
974459363 4:62167235-62167257 CCTGTTGTGGGTGGGGGGAGGGG - Intergenic
974759081 4:66251577-66251599 GTTGTGGGGGGTGGGGGGTAGGG + Intergenic
974767975 4:66372643-66372665 CTGGGGGTGTGTGGGGGGTGGGG - Intergenic
974861916 4:67532741-67532763 CTGCTGGGGGGTAGGGGGAGGGG + Intronic
974959231 4:68677306-68677328 ATTGAGGTGTGTAGGGTGTGTGG - Intergenic
975526099 4:75352309-75352331 CTGTTGGGGGTTAGGGGGTGAGG - Intergenic
975821090 4:78271462-78271484 CCTGTTGTGGGTTGGGGGTAGGG - Intronic
976309514 4:83596613-83596635 TTTTTGGTGGGTGGGGGATGGGG - Intronic
976321746 4:83724688-83724710 CCTGTTGTGAGAAGGGGGTGGGG + Intergenic
976518559 4:86000445-86000467 GTTGGGGGGGGTGGGGGGTGGGG - Intronic
976601994 4:86946449-86946471 GTGGGGGTGGGTGGGGGGTGGGG - Intronic
976798427 4:88959826-88959848 CTTGTGGCGGTAAGGGGGTGAGG + Intronic
977231037 4:94451856-94451878 CGTGTCCTGGGTCGGGGGTGGGG + Exonic
977564623 4:98568528-98568550 TTGGTGGTGGGCTGGGGGTGGGG - Intronic
977609123 4:99014644-99014666 CTTGTAGTGTGTTGGTGGTGGGG + Intronic
978007287 4:103632532-103632554 CTGTTGGTGGGTGGGGGGTGAGG + Intronic
978090296 4:104707151-104707173 CTTGAGCTTGGTAGGGGGAGAGG + Intergenic
978567830 4:110102928-110102950 CGGGGGGCGGGTAGGGGGTGGGG + Intronic
978781008 4:112554200-112554222 CGTGTTGTGGGTGGGGGGAGGGG - Intronic
978798160 4:112729081-112729103 CATGTGGTGCTTAGGGGATGAGG + Intergenic
978960558 4:114672659-114672681 CCTGTTGGGGGTAGAGGGTGAGG + Intronic
979061623 4:116068749-116068771 TTTGTGGAGGGTAGGGGTGGTGG - Intergenic
979288926 4:118958525-118958547 CTTGTGGTGGGTAGGTGTGAGGG + Intronic
979849636 4:125560167-125560189 AATCTGGTGGGTAGGGGGTCAGG - Intergenic
980261714 4:130457908-130457930 CCTGTTGTGGGTGGGGGCTGGGG + Intergenic
980932930 4:139198733-139198755 AATTTGGTGGGTAGGGGGTTAGG - Intergenic
981232875 4:142378963-142378985 CCTGAGTGGGGTAGGGGGTGCGG + Intronic
981357237 4:143803414-143803436 CTGCTGTTGGGTGGGGGGTGTGG + Intergenic
981411258 4:144435227-144435249 CTTGAGCTTGGTAGGGGGAGGGG + Intergenic
981779203 4:148406446-148406468 GTTGTGGTGGTTAGGAGGTATGG + Intronic
981954638 4:150455122-150455144 ACTGTGGTGGGGTGGGGGTGGGG - Intronic
981969881 4:150654690-150654712 CTGTTGTTGGGTAGGGGGAGGGG - Intronic
982064730 4:151644277-151644299 TTTGTGTTGGGTGGGGGGTTTGG - Intronic
982077184 4:151749503-151749525 CCTGTTGTGGGGTGGGGGTGGGG + Intronic
982173325 4:152682451-152682473 GTGGTGGTGGGGAGGGGGCGGGG - Intergenic
983047473 4:163004561-163004583 CTTGAGCTTGGTAGGGGGAGGGG - Intergenic
983410131 4:167385950-167385972 CTTGGGGTGGGGAGGGTGTGGGG - Intergenic
983505222 4:168546298-168546320 CTTTTGGTGGGTGGGGGGTGGGG - Intronic
983865497 4:172760761-172760783 ATTGTGGGGGGTAGTCGGTGGGG - Intronic
984039027 4:174705829-174705851 CATGTAGTGGGGTGGGGGTGGGG + Intronic
984144378 4:176043715-176043737 ATTGTGCTGGGTGGGAGGTGAGG + Intergenic
984157670 4:176211235-176211257 GTTGGGGGGGGTGGGGGGTGGGG + Intergenic
985062098 4:186090101-186090123 AGTTTGGTGGGTAGGGGCTGGGG - Intergenic
985379763 4:189380918-189380940 ACAGGGGTGGGTAGGGGGTGGGG + Intergenic
987858025 5:23446933-23446955 CTTGTAGTGGGTAAGGTGTTAGG - Intergenic
987921339 5:24285245-24285267 CGTGGGGTGGGGAGGGGGGGAGG - Intergenic
987973113 5:24976853-24976875 CCTGTCGTGGGTTGGGGGAGTGG - Intergenic
988048355 5:25990065-25990087 CCTGTGGTGGGGTGGGGATGTGG - Intergenic
988060027 5:26154506-26154528 CTTGTTGGGGGTAGGGAGTGAGG + Intergenic
988066805 5:26235360-26235382 GTTGTGGTGGGTGGGTGTTGTGG + Intergenic
988066817 5:26235404-26235426 ATTGTGGTGGGTGGGTGTTGTGG + Intergenic
988066887 5:26235665-26235687 GTTGTGGTGGGCAGGTGTTGTGG + Intergenic
988066912 5:26235754-26235776 GTTGTGGTGGGTGGGTGTTGTGG + Intergenic
988066924 5:26235798-26235820 ATTGTGGTGGGTGGGTGTTGTGG + Intergenic
988066971 5:26235983-26236005 GTTGTGGTGGGCAGGTGTTGTGG + Intergenic
988066995 5:26236075-26236097 GTTGTGGTGGGTGGGTGTTGTGG + Intergenic
988067007 5:26236119-26236141 GTTGTGGTGGGTGGGTGTTGTGG + Intergenic
988067014 5:26236148-26236170 GTTGTGGTGGGCAGGTGTTGTGG + Intergenic
988067128 5:26236556-26236578 GTTGTGGTGGGTGGGTGTTGTGG + Intergenic
988067138 5:26236600-26236622 GTTGTGGTGGGTAGGTGTTGTGG + Intergenic
988067143 5:26236616-26236638 GTTGTGGTGGGTGGGTGTTGTGG + Intergenic
988067147 5:26236632-26236654 GTTGTGGTGGGCAGGTGTTGTGG + Intergenic
988067151 5:26236648-26236670 GTTGTGGTGGGCAGGTGTTGTGG + Intergenic
988796585 5:34657234-34657256 CTGGTGGGGGGTGGGGGGTGGGG + Intronic
988805263 5:34734214-34734236 CAGTTGGTGGGCAGGGGGTGGGG + Intronic
988945913 5:36199045-36199067 CTGTTGTGGGGTAGGGGGTGGGG + Intronic
989951123 5:50298457-50298479 CTTTTGTTGGGTGGGGGGAGTGG + Intergenic
989989032 5:50739385-50739407 TTTGTGGGGGGATGGGGGTGGGG + Intronic
990138517 5:52676785-52676807 CTGTTGGTGGGTGGGGGTTGAGG - Intergenic
990151267 5:52820366-52820388 CCTGTTGTGGGTGGGGGGAGGGG + Intronic
990277641 5:54215079-54215101 CTTGAGGGGGCTTGGGGGTGGGG + Intronic
990289180 5:54331319-54331341 TTGGTGGTGGGCGGGGGGTGGGG - Intergenic
990555892 5:56935217-56935239 CTTGGGCAGGGTTGGGGGTGGGG + Intronic
990637343 5:57743648-57743670 CTGGTGGTAAGTAGGGGGTAAGG + Intergenic
990859830 5:60314634-60314656 CCTGTTGTGGGGTGGGGGTGTGG - Intronic
991018611 5:61957856-61957878 GTGGTGGTGGCTATGGGGTGAGG - Intergenic
991161380 5:63507560-63507582 CTTGAGTTTGGTAGGGGGAGGGG + Intergenic
991180546 5:63746536-63746558 GTGGTGGTGGCTATGGGGTGAGG - Intergenic
991584512 5:68188138-68188160 CTTGGGGTTGGGTGGGGGTGGGG + Intergenic
992079635 5:73222917-73222939 CTTGTGGTGGGTCAGGGAGGAGG + Intergenic
992652408 5:78872659-78872681 ACTGTGGTGGGGAGGGGGAGGGG + Intronic
993117112 5:83732732-83732754 CCTGTTGGGGGTAGGGGGTGAGG - Intergenic
993937324 5:94020270-94020292 CTGTTGGTGGGTAGGGGGCTGGG + Intronic
994241349 5:97424983-97425005 TTTGTGGTGGTCAGAGGGTGGGG + Intergenic
994288403 5:97997290-97997312 GTTGTGGGGTGTGGGGGGTGGGG + Intergenic
994861719 5:105203793-105203815 CCTGTCGTGGGTTGGGGGAGGGG + Intergenic
994952254 5:106479347-106479369 CTGTTGGGGGGTAGGGGGAGAGG + Intergenic
995110486 5:108423001-108423023 CTGTTGGAGGGTCGGGGGTGAGG - Intergenic
995475592 5:112544939-112544961 CTGCTGGGGGGTAGGGGGTAAGG + Intergenic
995524495 5:113039713-113039735 CCTGGGGTGGGTTGGGGGGGGGG - Intronic
995543572 5:113207448-113207470 ATCGTGGAGGGTGGGGGGTGGGG + Intronic
995614963 5:113951569-113951591 CGTGTGGTGTGGATGGGGTGGGG + Intergenic
995684812 5:114760766-114760788 CCTGTTGTGGGGTGGGGGTGAGG - Intergenic
996006176 5:118423076-118423098 CTACTGGGGGGTAGGGGGAGTGG + Intergenic
996097215 5:119411629-119411651 CGGGCGGGGGGTAGGGGGTGGGG - Intergenic
996123277 5:119695144-119695166 TTTATGGTGGTTAGGGGCTGAGG - Intergenic
996175657 5:120353047-120353069 CCTGTTGTGGGGTGGGGGTGGGG + Intergenic
996407927 5:123125141-123125163 CGGGTGGGGGGGAGGGGGTGCGG - Intronic
996594683 5:125186667-125186689 CTTGAGATGTGTATGGGGTGGGG - Intergenic
997385014 5:133465588-133465610 CTTGCTCTGGGCAGGGGGTGGGG + Intronic
997438208 5:133890307-133890329 CTTGGGGTGGGTAGAGGGCCAGG - Intergenic
997450618 5:133979866-133979888 CTAGTGGTTGGCAGGGGGCGGGG - Intronic
997582266 5:135025362-135025384 CCTGGGGTGGGGTGGGGGTGTGG + Intergenic
997917135 5:137938642-137938664 TTTCTGGGGGGTGGGGGGTGAGG - Exonic
998138851 5:139688755-139688777 GTTGTGATGGGCTGGGGGTGGGG - Intergenic
998696317 5:144643928-144643950 CTGGTGAGGGGTGGGGGGTGAGG - Intergenic
999310135 5:150546547-150546569 TTGGTGTTGGGGAGGGGGTGGGG + Intronic
999873516 5:155776636-155776658 CTGGAGGTGGGGCGGGGGTGGGG - Intergenic
999918177 5:156286667-156286689 CCTGTTGTGGGTTGGGGGAGTGG + Intronic
1000194761 5:158947028-158947050 CTTGAGGTTGGTGGGGGGAGGGG - Intronic
1000662232 5:163950933-163950955 CTTGTGGTGAGAAAGAGGTGAGG - Intergenic
1000986670 5:167868190-167868212 CTTCTGGTGGGTAGGGACAGGGG - Intronic
1001285888 5:170423788-170423810 CCTGTGGAGGGGAGGGGGTGAGG - Intronic
1001430297 5:171655611-171655633 CCTGTTGTGGGGTGGGGGTGGGG + Intergenic
1001606116 5:172960904-172960926 GTTGTGGGGGGTGGGGGGTGGGG + Intronic
1001816439 5:174673203-174673225 CAAATGGTGGGAAGGGGGTGAGG - Intergenic
1002320879 5:178375240-178375262 CTCGTGGTTGGCAGGGGCTGGGG + Intronic
1002639357 5:180623433-180623455 CTGGGGGTGGGGTGGGGGTGGGG - Intronic
1002893784 6:1362101-1362123 CCTGTCGTGGGTGGGGGGAGGGG + Intergenic
1003165053 6:3670314-3670336 GTTGGGGTGGGGAGGGGGTGGGG + Intergenic
1003596862 6:7481737-7481759 CGGGTGGTGGGGAGGGGGTGGGG + Intergenic
1003873540 6:10419094-10419116 CTTGAGGTGGGAGGGGGGTGGGG + Intronic
1004308586 6:14523581-14523603 CCTGTGGAGGGCAGGGGCTGGGG - Intergenic
1004836635 6:19538752-19538774 CTTCTGGTGGCGACGGGGTGGGG - Intergenic
1005347819 6:24907968-24907990 ATTGGGGTGGGGTGGGGGTGGGG - Intronic
1005420090 6:25640130-25640152 CTTTTTGGGGGTTGGGGGTGGGG - Intergenic
1006136424 6:31898864-31898886 CTGGTGGAGGGCTGGGGGTGGGG + Intronic
1006392115 6:33764541-33764563 CCTGAGGTGGGGAGTGGGTGGGG - Intergenic
1006434396 6:34018797-34018819 TTAGTGCTGGGTTGGGGGTGGGG + Intronic
1006925082 6:37649524-37649546 CTTGGGGTGGGCGTGGGGTGAGG - Intronic
1007255340 6:40524382-40524404 GGTGTGGCGGGTCGGGGGTGGGG - Intronic
1007431764 6:41780751-41780773 CTTGGGGTGGGGACCGGGTGAGG + Exonic
1007491219 6:42223596-42223618 CTTTTGGAGGGTGGGGGGGGTGG - Intergenic
1007508638 6:42358074-42358096 TATGTGGGGGGTTGGGGGTGGGG + Intronic
1007570142 6:42884042-42884064 CATGGGGTGGGCAGGGGGTTGGG - Intronic
1007655451 6:43448727-43448749 CATTTGGTGGGGATGGGGTGGGG + Intronic
1007790317 6:44304840-44304862 TTAGTGGTGGGCAGGGGCTGGGG + Intronic
1008170922 6:48204350-48204372 CATGTTGTGGGTGGGGGGGGGGG + Intergenic
1008378177 6:50814789-50814811 CTTCTGATGGGTAAGAGGTGGGG + Intergenic
1009886632 6:69631339-69631361 AAAGTGGTGGGTAGGGAGTGGGG - Intergenic
1010134919 6:72540422-72540444 CTTGTGGGGGTGGGGGGGTGGGG - Intergenic
1010170755 6:72972490-72972512 TTGTTGGGGGGTAGGGGGTGAGG - Intronic
1010646086 6:78389244-78389266 GGGGTGGGGGGTAGGGGGTGTGG - Intergenic
1011242410 6:85286942-85286964 CCTGTCGTGGGGTGGGGGTGGGG - Intergenic
1012009887 6:93770259-93770281 CTTGTGGTGGGGTGGGGGGAGGG - Intergenic
1012063594 6:94517546-94517568 CTGTTGGGGGGTAAGGGGTGAGG + Intergenic
1012117550 6:95322407-95322429 CCTGTCGTGGGGTGGGGGTGTGG - Intergenic
1012358979 6:98352494-98352516 AGTGTGGTGGGGTGGGGGTGGGG + Intergenic
1012712189 6:102621058-102621080 CAAAGGGTGGGTAGGGGGTGAGG - Intergenic
1013082381 6:106823894-106823916 CATGTAGTGGGTAGGGGCAGCGG - Intergenic
1013092397 6:106912003-106912025 CTTGGGGGGGGGTGGGGGTGGGG + Intergenic
1014149792 6:118041515-118041537 ATAGTGGTGGGATGGGGGTGGGG + Intronic
1014159724 6:118154110-118154132 ATGGTAGTGGGAAGGGGGTGGGG - Intronic
1014317581 6:119886668-119886690 ACTGTGGGGGGTAGGGGGTTAGG - Intergenic
1014338889 6:120176760-120176782 CTGTTGGGGGGTGGGGGGTGAGG + Intergenic
1014621901 6:123677603-123677625 CTGGAGGTGGGTAGAGAGTGTGG + Intergenic
1014802840 6:125796329-125796351 ATTGAGGTGGGTGGGGGGTGGGG - Intronic
1015129301 6:129792132-129792154 CCTGTGCTGGGGCGGGGGTGGGG - Intergenic
1015136428 6:129877437-129877459 CTGTTGGGGGTTAGGGGGTGAGG - Intergenic
1015508168 6:134010613-134010635 CTTGTGGGGGGGCGGAGGTGTGG + Intronic
1015763314 6:136688263-136688285 CTGTTGGTGGGTAGGGGGCTAGG + Intronic
1015999352 6:139028026-139028048 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
1016112023 6:140236080-140236102 CTGTTGGTGGGTGGGGGGTTAGG + Intergenic
1016289015 6:142507127-142507149 CTGGTGAGGAGTAGGGGGTGAGG + Intergenic
1016332948 6:142972971-142972993 CTTGTGGTGGGGAGGTTGGGAGG + Intergenic
1016589804 6:145731619-145731641 CTGTTGGTGGGTGGGGGTTGAGG + Intronic
1017656928 6:156638680-156638702 ATGGTGGTGGCTAGGGGCTGGGG + Intergenic
1017750188 6:157484136-157484158 CTTCTTGAGGGTAGGGGGTGCGG + Intronic
1017898691 6:158702707-158702729 CTTAGGGTGGGGAGCGGGTGGGG - Intronic
1018125619 6:160679452-160679474 GTAGTAGTGGGTGGGGGGTGAGG - Intergenic
1018513177 6:164549081-164549103 CTATTGGGGGGTGGGGGGTGAGG - Intergenic
1018676074 6:166223344-166223366 CTGGGGGTGGGGTGGGGGTGGGG - Intergenic
1018677564 6:166236119-166236141 CGGCTGGTGGGCAGGGGGTGGGG - Intergenic
1019484425 7:1282716-1282738 CTTGTGGTTGCCAGGGGCTGGGG - Intergenic
1019545939 7:1576170-1576192 CCTGTGGAAGGTAGGGAGTGTGG + Intergenic
1020013061 7:4816824-4816846 CTTGGGGTGCATCGGGGGTGCGG - Intronic
1020278087 7:6636909-6636931 CCTGTGGTGGGGAGGGGGCCAGG - Intergenic
1020592915 7:10166400-10166422 ACTGTGGTGGGGAGGGGGTAGGG - Intergenic
1020809216 7:12830753-12830775 TTTGTGGTGGGGAGGGGTGGGGG + Intergenic
1021427353 7:20516752-20516774 CCTGTTGTGGGTGGGGGTTGGGG + Intergenic
1021583035 7:22177283-22177305 CATATGCTGGGTAGGGGTTGGGG - Intronic
1021624107 7:22575914-22575936 GATGGGGTGGGGAGGGGGTGGGG - Intronic
1021710142 7:23407935-23407957 TTTGTGGGGGGCAGGGGGCGGGG + Intronic
1021975364 7:26006935-26006957 CATCTGGTGGGTAGGGGGCAGGG - Intergenic
1022080254 7:27012933-27012955 GTGGTGGTGGCTATGGGGTGAGG + Intergenic
1022388908 7:29926729-29926751 CTTATGGTGGGTGGTGGGTGTGG + Intronic
1022492256 7:30830064-30830086 CTTGTGGGGGCCAGGGGGTTGGG + Intronic
1022529878 7:31060107-31060129 CTGGGGGTGGGTCGGGGCTGGGG + Intronic
1022573137 7:31472655-31472677 CTTGGGAGGGTTAGGGGGTGGGG + Intergenic
1022594844 7:31703436-31703458 GTTGGGGTGGGAAGGGGGAGAGG + Intronic
1022603227 7:31781687-31781709 TGTGTGGGGGGTGGGGGGTGGGG - Intronic
1022977851 7:35575187-35575209 CTCGTGGTGGGTGTTGGGTGAGG + Intergenic
1023110676 7:36807851-36807873 CTTGAGGTGGGTAGGGGTACAGG + Intergenic
1023218874 7:37897662-37897684 CTGTTGGGGGGTGGGGGGTGAGG - Intronic
1024002827 7:45202306-45202328 CTTATGGTGGGTCAGGGGAGTGG + Intergenic
1024273655 7:47660254-47660276 CATGGGTTGGGGAGGGGGTGTGG + Exonic
1024452204 7:49560241-49560263 CCTGTTGTGGGTTGGGGGGGAGG + Intergenic
1024543648 7:50499689-50499711 CTGGTGGTGGGGATGGAGTGGGG - Intronic
1024570555 7:50719517-50719539 CCTGTCGGGGGTAGGGGGCGAGG + Intronic
1024578223 7:50782062-50782084 CAGGTGGTGGGCAGCGGGTGTGG - Intronic
1024624000 7:51188576-51188598 CTCGTGGTGCCTTGGGGGTGGGG + Intronic
1024709432 7:51998992-51999014 CTTGTGGTGGAGAGAGGATGCGG - Intergenic
1024732159 7:52264757-52264779 CTAGTGGTGGGAAGGGGGTTGGG - Intergenic
1024997164 7:55280524-55280546 CCTGTGGGGGATAAGGGGTGGGG - Intergenic
1025088585 7:56043642-56043664 GTTGGGGTGGGTGGGGGGAGGGG - Intronic
1025159236 7:56639203-56639225 CTTGTGGTTAGTAAGGGTTGAGG + Intergenic
1025241965 7:57284197-57284219 GATGTGGAGGTTAGGGGGTGGGG - Intergenic
1025870539 7:65428315-65428337 CTAGTCGGGGGTTGGGGGTGAGG + Intergenic
1026618174 7:71926174-71926196 GCTGTGGTGGTTAGGGGGTTGGG - Intronic
1026874889 7:73873551-73873573 GTTGGGGTGAGTGGGGGGTGAGG + Intergenic
1027308631 7:76929451-76929473 TTTGTGGGTGGTAGGTGGTGGGG - Intergenic
1027318317 7:76997689-76997711 CGTGGGGTGTGTGGGGGGTGTGG + Intergenic
1027496517 7:78893721-78893743 CCTGTTGTGGGTTGGGGGCGGGG + Intronic
1027584512 7:80041492-80041514 GTTGTGCTGGGTAGGGGCTCTGG - Intergenic
1027633469 7:80638585-80638607 TTTGGGGGGGGGAGGGGGTGTGG + Intronic
1028056926 7:86256623-86256645 CTGTTGTGGGGTAGGGGGTGTGG + Intergenic
1028451475 7:90989726-90989748 CTTGCTGGGGGTAGTGGGTGAGG - Intronic
1028821323 7:95215118-95215140 CCTGTTGTGGGTGGGGGGAGGGG - Intronic
1028832363 7:95341931-95341953 CTGGTGGTGGGCAGTGGGAGGGG - Intergenic
1028898649 7:96070632-96070654 CTTTGGGTGGGTAGGTGGTAGGG - Intronic
1029061381 7:97801405-97801427 TTTGTGGTGGTTAGTGGGTGGGG - Intergenic
1029440623 7:100584999-100585021 TCTGTGGATGGTAGGGGGTGGGG - Intronic
1029816986 7:103106549-103106571 CTTGAGCTTGGTAGGGGGAGGGG + Intronic
1030058325 7:105602529-105602551 CTCCTGGTGTGTGGGGGGTGAGG - Intergenic
1030131599 7:106206344-106206366 TTTGTGGAGGGTGGGGGCTGAGG + Intergenic
1031165646 7:118224430-118224452 CTTGTGATGGGGATGGGGAGGGG - Intronic
1031319887 7:120311717-120311739 CTTTTGGAGGGTAGAGGGTGGGG - Intronic
1031692912 7:124812941-124812963 CTTGGAGCGGGTGGGGGGTGGGG - Intergenic
1031905623 7:127457416-127457438 CTTGAGGTGGAGAAGGGGTGGGG - Intergenic
1032443150 7:131957762-131957784 CTTGAGGTGGGGAGGCAGTGGGG + Intergenic
1032648058 7:133847705-133847727 TTTGTGGTGGGGAGAGGGTGGGG + Intronic
1032652871 7:133897994-133898016 ATTGGGGTGGGTGTGGGGTGAGG - Intronic
1032735881 7:134692271-134692293 CCTGTGGTGGGTGAGGGGTGGGG - Intergenic
1032871628 7:135991966-135991988 CTAGTGGTGGGGTGGGGGTGGGG + Intergenic
1033024902 7:137762702-137762724 CTTGAGGTGGGTAAGGGCTTGGG - Intronic
1033476601 7:141698950-141698972 GTTGAGGTGGGTGTGGGGTGGGG + Intronic
1033691377 7:143740660-143740682 GTGGTGGTGGCTATGGGGTGAGG + Intergenic
1034046705 7:147937034-147937056 GTGGTGGTGGTGAGGGGGTGAGG - Intronic
1035600216 8:892904-892926 ATGGGGGTGGGTTGGGGGTGGGG - Intergenic
1035967235 8:4206342-4206364 CCTGTGGTGGGTTGGGGGGAGGG - Intronic
1036602947 8:10279499-10279521 CGTGTGGGGGGTAGGGTGGGAGG - Intronic
1037235742 8:16717555-16717577 CGTCAGGTGGGCAGGGGGTGTGG - Intergenic
1037479583 8:19292121-19292143 CAGGCGGTGGGTGGGGGGTGGGG - Intergenic
1037637684 8:20714967-20714989 ATTTTGGTGGGTGGGGTGTGGGG + Intergenic
1037769762 8:21791455-21791477 GTTGGGGTGGGCAGAGGGTGGGG - Intronic
1038095331 8:24302917-24302939 CTTGTTGTGGGGAGGGGGGAGGG - Intronic
1038103016 8:24400784-24400806 CCTGTTGTGGGTGGGGGGAGGGG - Intronic
1038485061 8:27929241-27929263 CTTGGGGTGGGCTGTGGGTGGGG - Intronic
1038502085 8:28053360-28053382 CTGGTGGTGGTCAGGGGGTGCGG + Intronic
1038708141 8:29915336-29915358 CCTGTTGGGGGTAGGGGGTGAGG + Intergenic
1038786480 8:30622120-30622142 CCTGTTGTGGGTGGGGGGAGGGG - Intronic
1039261726 8:35779214-35779236 CATGTAGCGGGTAGGTGGTGGGG + Intronic
1039273949 8:35914279-35914301 CTGTCGGTGGGTAGGGGGTAAGG + Intergenic
1039531557 8:38267841-38267863 GTTCTGGTGGGTAAGGGCTGAGG + Intronic
1039554476 8:38466891-38466913 GTGGTGGTGGGGGGGGGGTGGGG - Intronic
1039926030 8:41933123-41933145 CTGCTGCTGGGGAGGGGGTGGGG + Exonic
1040903212 8:52438701-52438723 CACGTGGTGTGTGGGGGGTGTGG + Intronic
1042848708 8:73194046-73194068 GTGGTGGTGGGCAGGGGGAGAGG - Intergenic
1042910467 8:73820946-73820968 TTTTTGGTGGGGTGGGGGTGCGG - Intronic
1043202072 8:77382852-77382874 CCTGTCGTGGGTGGGGGGAGGGG - Intergenic
1043240828 8:77933019-77933041 CTTGTGGGTTGAAGGGGGTGTGG + Intergenic
1043760526 8:84062723-84062745 GTGGTGGTGGTTAGGGAGTGAGG - Intergenic
1043929055 8:86069612-86069634 CGTGTTGCGGGTATGGGGTGCGG - Exonic
1044249694 8:89991182-89991204 CTTGGGGTGGGTGGGGTGGGGGG + Intronic
1044273128 8:90270084-90270106 CCTGTTGTGGGTGGGGGGAGTGG + Intergenic
1044344487 8:91089487-91089509 GTAGGGGTGGGTGGGGGGTGGGG - Intergenic
1044352854 8:91186755-91186777 GGTGGGGTGGGTAGTGGGTGTGG + Intronic
1044529149 8:93288612-93288634 TTTGTGGTTGCCAGGGGGTGAGG + Intergenic
1044856981 8:96486246-96486268 CCTGTGGTGAGTAGGGGTTGGGG + Intergenic
1044945133 8:97382348-97382370 CTAGAGGTGAGTAGGGGGTGGGG - Intergenic
1045198861 8:99958071-99958093 GATGTGGTGGGTAGGGCGGGAGG - Intergenic
1045544028 8:103112170-103112192 CTTGTTGTGGGGTGGTGGTGGGG - Intergenic
1045829753 8:106444680-106444702 ATTGTTGGGGGTGGGGGGTGAGG + Intronic
1045978789 8:108159800-108159822 CTATTGTTGGGTAGGGGGAGGGG + Intergenic
1046081020 8:109370656-109370678 CCTGTTGTGGGTTGGGGGTAGGG - Intronic
1046098161 8:109584595-109584617 GTGGTGGTGGGTGGGGGCTGGGG + Intronic
1046277818 8:111985876-111985898 CTTGTGCTTGGTAGGGGAAGGGG + Intergenic
1047219876 8:122910731-122910753 CTGCTGGGGGGTGGGGGGTGGGG + Intronic
1048043862 8:130755205-130755227 CTGTTGGAGGGTAGGAGGTGAGG + Intergenic
1048467600 8:134679931-134679953 CCTGTGGGGGGTTGGGGGTTGGG + Intronic
1049128210 8:140811181-140811203 CTTGTGGAGTGTTGGGGGTAGGG - Intronic
1049215920 8:141408188-141408210 CTTGTGGTTGCCAGGGGCTGGGG + Intronic
1050041568 9:1500517-1500539 CTTGTTGTGGGGAGGGGGGAGGG - Intergenic
1050637414 9:7626803-7626825 CTTGAGCTTGGTAGGGGGAGGGG + Intergenic
1051124820 9:13791949-13791971 CTTGAGCTTGGTAGGGGGAGGGG + Intergenic
1051839020 9:21373524-21373546 CTGTTGGTGGGTGGGGGGAGGGG - Intergenic
1052446522 9:28568318-28568340 CTACTTGTGGGTAGAGGGTGGGG + Intronic
1052494205 9:29206391-29206413 CTTGTGTTGGCAAGGGAGTGGGG - Intergenic
1052642130 9:31181909-31181931 CCTGTCGTGGGGTGGGGGTGGGG + Intergenic
1052835488 9:33246924-33246946 CTGGTGGTGGATAGGGAGTAGGG + Intronic
1053160022 9:35807473-35807495 CATGGGGTGGGTAAGGTGTGTGG - Intronic
1053607958 9:39679738-39679760 CTGGTGGTGAGCAGGGGGTGGGG - Intergenic
1053865802 9:42436098-42436120 CTGGTGGTGAGCAGGGGGTGGGG - Intergenic
1054245575 9:62662671-62662693 CTGGTGGTGAGCAGGGGGTGGGG + Intergenic
1054559701 9:66697202-66697224 CTGGTGGTGAGCAGGGGGTGGGG + Intergenic
1054928260 9:70610211-70610233 CTTTTGGTGGGTAAGGAGTGAGG - Intronic
1055003625 9:71481717-71481739 CTAGAGGTGGGTGGGAGGTGGGG + Intergenic
1055139032 9:72854498-72854520 ATTGTGGTGGCTAAGTGGTGGGG + Intergenic
1055827013 9:80339238-80339260 GCTATGGTGGGGAGGGGGTGGGG + Intergenic
1056590721 9:87964036-87964058 CCTCTGGAGGGGAGGGGGTGTGG - Intergenic
1056614675 9:88153670-88153692 CCTGTTGTGGGTTGGGGGTAGGG + Intergenic
1056767029 9:89450788-89450810 GGTGTGGTGGGAAGGGGATGAGG - Intronic
1057290863 9:93806634-93806656 CTGTTGGGGAGTAGGGGGTGAGG + Intergenic
1058132460 9:101268097-101268119 CCTGTTGTGGGTAGGGGAGGGGG + Intronic
1058258624 9:102802225-102802247 CTGTTGGTGGGTAGGGGTTAGGG + Intergenic
1058324350 9:103677151-103677173 GTTGTGGTGGGGTGGGGGCGAGG - Intergenic
1058395240 9:104544791-104544813 CATGTGGTGGGTGGGGGGTAAGG + Intergenic
1058434649 9:104951304-104951326 CTTGTCCTGGGTGGGGGGTTGGG - Intergenic
1058674978 9:107392694-107392716 CTTGGGGTGGGTATGGGGAGGGG - Intergenic
1058732362 9:107862390-107862412 ATTGTGGTGTGTATGGTGTGGGG - Intergenic
1058791272 9:108448170-108448192 CCTGTTGTGGGGTGGGGGTGGGG + Intergenic
1059148885 9:111929045-111929067 TTTTTGGGGGGTGGGGGGTGGGG - Intronic
1059161286 9:112037735-112037757 TGTGTGGTGGGTGGGGGGTGGGG - Intergenic
1059677705 9:116555531-116555553 CCTGGGGTGGGGACGGGGTGGGG - Intronic
1059745648 9:117198176-117198198 CTGTTGGAGGGTTGGGGGTGAGG - Intronic
1059745825 9:117200228-117200250 CTGTTGTTGGGTAGGGGGAGGGG - Intronic
1059985182 9:119814233-119814255 CTGATGGTAGGTATGGGGTGGGG + Intergenic
1060190249 9:121588214-121588236 CTTGGGGTGGGGAGGAGGTCAGG - Intronic
1060404318 9:123365772-123365794 GTGGTGGTGGTTGGGGGGTGGGG - Intronic
1060554115 9:124499619-124499641 CTAGTGTTGGGAAGGGGGTCCGG - Intronic
1061147054 9:128806168-128806190 CTTGAGGTGGGTAGGGAGGGAGG + Intronic
1061330042 9:129886449-129886471 CTTGCGGAGGGCAGGAGGTGAGG - Intergenic
1061397432 9:130351045-130351067 CTTGTGGTTGCCAGGGGCTGGGG - Intronic
1061441418 9:130606494-130606516 CTTGTGCTGGGGTGGGAGTGGGG + Intronic
1061604032 9:131694945-131694967 CCTGTTGTGGGTGGGGGGAGGGG - Intronic
1061630733 9:131870639-131870661 CTTGGGGTGGACAGGGGTTGTGG + Intronic
1061656764 9:132097949-132097971 TTTTTGGTGGGGAGAGGGTGGGG - Intergenic
1061739222 9:132687435-132687457 GTTGTCGGGGGTGGGGGGTGGGG + Intronic
1061861862 9:133472439-133472461 CCAGCGCTGGGTAGGGGGTGTGG - Intronic
1062117857 9:134818758-134818780 CCTGTGGTGAGTAGGCTGTGAGG + Exonic
1062166323 9:135109421-135109443 CTGATGGTGGGTAGAGTGTGGGG + Intronic
1062215084 9:135384690-135384712 CTTCAGGTGGGGAGGGGCTGGGG - Intergenic
1062523992 9:136970929-136970951 GTTGTGGTGGGGAGAGGCTGGGG - Intronic
1203359327 Un_KI270442v1:198298-198320 CTTGTCGTGGGTGGGGGGAAGGG + Intergenic
1185736434 X:2500311-2500333 CCTGGGGTGGGTAGGGGTCGAGG + Intronic
1186135959 X:6521113-6521135 CTTTTGGGGGGTAGGGGGCTAGG - Intergenic
1186502193 X:10060417-10060439 TGTGTGTTGGGGAGGGGGTGGGG + Intronic
1186638666 X:11431990-11432012 CATGTAGTGGGTAGAGGCTGGGG - Intronic
1187002988 X:15201121-15201143 CTTATGTTGGGGAGGAGGTGAGG + Intergenic
1187167679 X:16819955-16819977 TTTGGGGTGGGTATGGGGAGGGG + Intronic
1187286788 X:17912942-17912964 CTTGTGATAGGCAGGGAGTGAGG + Intergenic
1187784324 X:22866979-22867001 CTTGAGGTTGGTAGGGGGAGGGG + Intergenic
1187861872 X:23690735-23690757 GATGTGGTGGGGAGGGCGTGAGG - Intergenic
1188052295 X:25502616-25502638 CTTGTCGTGGGGTGGGGGTATGG + Intergenic
1188118976 X:26281455-26281477 CCTGTGGTGGGGTGGGGGCGGGG - Intergenic
1188323142 X:28765146-28765168 CCTGTTGTGGGGTGGGGGTGGGG + Intronic
1188465656 X:30477130-30477152 ATTCTAGTGGGTAGGGGATGAGG - Intergenic
1188902608 X:35752729-35752751 ATTGTGTTGGCTTGGGGGTGGGG - Intergenic
1189168903 X:38890000-38890022 CTGTTGGGGGGTGGGGGGTGAGG + Intergenic
1189364975 X:40381135-40381157 CCTGAGGTGGGGAGGGGTTGGGG + Intergenic
1189382289 X:40510636-40510658 CTTGGGGTGGGTGGGTGATGAGG - Intergenic
1190595468 X:52049152-52049174 CCTGTTGTGGGTAGGGGGAGGGG + Intergenic
1190613356 X:52204921-52204943 CCTGTTGTGGGTAGGGGGAGGGG - Intergenic
1191019197 X:55841937-55841959 CTGGTGGAGAGTGGGGGGTGTGG + Intergenic
1191094840 X:56663050-56663072 CCTGTTGTGGGTTGGGGGTGGGG - Intergenic
1191207382 X:57849330-57849352 ATGGTGGTGGCTATGGGGTGAGG - Intergenic
1192272524 X:69595552-69595574 CTGGTGGTGGGAGGGGGATGGGG + Intergenic
1192635421 X:72811693-72811715 CTGTTGGGGGGTAGGGGATGAGG - Intronic
1192646293 X:72909110-72909132 CTGTTGGGGGGTAGGGGATGAGG + Intronic
1192836171 X:74801944-74801966 GTTGTGGTGGCCATGGGGTGAGG + Intronic
1193089260 X:77476607-77476629 CTGTTGTTGGGTAGGGGGAGGGG + Intergenic
1193210593 X:78802522-78802544 CTGTTGTTGGGTAGGGGGAGGGG - Intergenic
1193547957 X:82852628-82852650 CTTGAGCTTGGTAGGGGGAGGGG - Intergenic
1193597661 X:83466724-83466746 CTGTTGGGGGGTGGGGGGTGAGG - Intergenic
1193624551 X:83801496-83801518 ATGGTGGTTGGTAGGGGCTGAGG - Intergenic
1193665915 X:84316344-84316366 GTAGTGGTGGGTGGGGGGCGGGG + Intergenic
1193760476 X:85459932-85459954 GTGGTGGGGGTTAGGGGGTGGGG + Intergenic
1193773851 X:85619953-85619975 CTGTTGATGTGTAGGGGGTGGGG - Intergenic
1195075842 X:101326514-101326536 CTGTTGGTGGGGTGGGGGTGGGG + Intergenic
1195079280 X:101355802-101355824 CTTGTGGGTGGTAGGGGGTTGGG + Intronic
1195101268 X:101556367-101556389 CTGTTGGGGGGTAGGGGGCGAGG - Intergenic
1195102311 X:101567160-101567182 CTTGAGCTCGGTAGGGGGAGGGG + Intergenic
1195132875 X:101871866-101871888 CTTTTGGGGGGTGGGGGGTGGGG - Intergenic
1195781921 X:108476557-108476579 GTTGTGGTAGGGAGGAGGTGGGG - Intronic
1195787392 X:108542255-108542277 CCTGTTGTGGGGTGGGGGTGGGG - Intronic
1195858683 X:109358013-109358035 GTAGTGGTGGGTAGAGGCTGAGG - Intergenic
1196465817 X:115970467-115970489 CTTGGGGTGGGGTGGGGATGGGG - Intergenic
1196499672 X:116365009-116365031 CCTGTTGGGGGTAGGGGGTGGGG + Intergenic
1196541626 X:116917288-116917310 CCTGTTGTGGGTGGGGGGAGCGG - Intergenic
1196785546 X:119418744-119418766 CTTCTGGTGGGAAGGGGGGTGGG + Intronic
1196830787 X:119773889-119773911 TTTTTGGTGGGTAGGGGAAGGGG + Intergenic
1196916194 X:120537408-120537430 CTTGGGCTGGCTGGGGGGTGAGG - Intronic
1196950120 X:120868549-120868571 GGTGTGGTGGGAAGGGGATGAGG + Intergenic
1197024153 X:121727345-121727367 ATTGTGGTGGGTGGGGGTGGAGG - Intergenic
1197356212 X:125439505-125439527 TTTGTGGTGGGGGTGGGGTGGGG + Intergenic
1197657572 X:129133774-129133796 CTTGGGGTTGGGATGGGGTGGGG - Intergenic
1197715858 X:129705629-129705651 TATGTGGTGGGGAAGGGGTGGGG - Intergenic
1197757413 X:130005450-130005472 CCTGTGGTGGGATGGGGATGGGG + Intronic
1197990337 X:132310755-132310777 CTTGGGGTATGTAGGGGGTGAGG - Intergenic
1198322159 X:135528868-135528890 ATTGCGGTGGGTCGGGGGGGGGG - Intronic
1198379810 X:136073443-136073465 TTGGTGGTGGCTAGGGGGTGGGG - Intergenic
1198594531 X:138222201-138222223 CTTGTGGGGGCTGGGGGTTGAGG - Intergenic
1198669986 X:139069457-139069479 CTGGTGGGGGGTGGGGGGAGGGG + Intronic
1198745949 X:139890745-139890767 CTTGTGGTGGGCAGGAGTGGGGG + Intronic
1198788234 X:140314115-140314137 CCTGTGGTGGCTATGGGGTGAGG + Intergenic
1199645526 X:149906579-149906601 CTTTTGGGGGGTAGGGGGCTGGG + Intergenic
1199771054 X:150975656-150975678 CTTGGTGTGGGTGGAGGGTGGGG + Intergenic
1199771186 X:150976248-150976270 GGTCTGGTGGGGAGGGGGTGAGG + Intergenic
1199850768 X:151723704-151723726 TGTGTGGTGGGTAGGGTGAGGGG - Intergenic
1200760936 Y:7038534-7038556 CTTGTGGTGGGTAGAGGCCAGGG + Intronic