ID: 1079112347

View in Genome Browser
Species Human (GRCh38)
Location 11:17612011-17612033
Sequence TTGTGGTGGGTAGGGGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1114
Summary {0: 1, 1: 0, 2: 5, 3: 94, 4: 1014}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079112329_1079112347 19 Left 1079112329 11:17611969-17611991 CCCCCGAGCTCACACTAAGTGCA 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1079112347 11:17612011-17612033 TTGTGGTGGGTAGGGGGTGAGGG 0: 1
1: 0
2: 5
3: 94
4: 1014
1079112330_1079112347 18 Left 1079112330 11:17611970-17611992 CCCCGAGCTCACACTAAGTGCAT 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1079112347 11:17612011-17612033 TTGTGGTGGGTAGGGGGTGAGGG 0: 1
1: 0
2: 5
3: 94
4: 1014
1079112332_1079112347 16 Left 1079112332 11:17611972-17611994 CCGAGCTCACACTAAGTGCATCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1079112347 11:17612011-17612033 TTGTGGTGGGTAGGGGGTGAGGG 0: 1
1: 0
2: 5
3: 94
4: 1014
1079112336_1079112347 -7 Left 1079112336 11:17611995-17612017 CCAGGCCCCACATGGCTTGTGGT 0: 1
1: 0
2: 1
3: 23
4: 192
Right 1079112347 11:17612011-17612033 TTGTGGTGGGTAGGGGGTGAGGG 0: 1
1: 0
2: 5
3: 94
4: 1014
1079112331_1079112347 17 Left 1079112331 11:17611971-17611993 CCCGAGCTCACACTAAGTGCATC 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1079112347 11:17612011-17612033 TTGTGGTGGGTAGGGGGTGAGGG 0: 1
1: 0
2: 5
3: 94
4: 1014
1079112328_1079112347 24 Left 1079112328 11:17611964-17611986 CCTGACCCCCGAGCTCACACTAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1079112347 11:17612011-17612033 TTGTGGTGGGTAGGGGGTGAGGG 0: 1
1: 0
2: 5
3: 94
4: 1014
1079112327_1079112347 25 Left 1079112327 11:17611963-17611985 CCCTGACCCCCGAGCTCACACTA 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1079112347 11:17612011-17612033 TTGTGGTGGGTAGGGGGTGAGGG 0: 1
1: 0
2: 5
3: 94
4: 1014

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079112347 Original CRISPR TTGTGGTGGGTAGGGGGTGA GGG Intronic
900859186 1:5214246-5214268 TAAGGGTGGGAAGGGGGTGAGGG - Intergenic
900889000 1:5435712-5435734 TCATGGTGGGGAGGGGGTGGGGG + Intergenic
900923927 1:5691342-5691364 TTGGGGTGGGAGAGGGGTGAGGG + Intergenic
901496328 1:9624471-9624493 GTGTGGTGGGTAGGAGGTGTGGG - Intergenic
902249156 1:15141977-15141999 TGGTGTTGGGTTTGGGGTGAAGG + Intergenic
902372982 1:16017045-16017067 ATGCGGTGAGTAGGGGGTGGGGG + Intronic
902960586 1:19960523-19960545 TTGGGGTGGGGGGGGGGTGGAGG - Intergenic
903025834 1:20429429-20429451 TTGTGGAGGGTTGAGAGTGAAGG - Intergenic
903221332 1:21871137-21871159 TTGTGGGGGGCAGGGGCTCAGGG - Intronic
903385689 1:22924662-22924684 TGGTAGAGGGTAGGGGGTGCTGG - Intergenic
903424890 1:23246195-23246217 TTTGGGTGGGAAGGGGGTGAGGG + Intergenic
904287832 1:29463525-29463547 GTGTGGTGGGCAGGGGGTAGGGG - Intergenic
904454585 1:30639799-30639821 TTGGGGTGTGTTGGGGGTCAGGG + Intergenic
904541715 1:31238299-31238321 CTGTGGTGGGGAGGGCGTGATGG + Intronic
904563050 1:31411600-31411622 AGGTAGTGGGTTGGGGGTGAGGG + Intronic
904636702 1:31887427-31887449 TGGTGGTTGCTAGGGGATGAGGG - Intergenic
904703926 1:32376414-32376436 TTGGAGTGAATAGGGGGTGAGGG + Exonic
904707256 1:32400911-32400933 ATGGGGTGGGTAGGGGGAGTAGG - Intergenic
904831300 1:33307900-33307922 GTGGGGTGAGAAGGGGGTGAAGG - Intronic
905135875 1:35799227-35799249 TTTTGGGGGGTAGGTGGGGATGG - Intergenic
905237794 1:36561936-36561958 ACGTGGTGGGGAGGGGCTGAGGG + Intergenic
905349517 1:37335271-37335293 CTGTTGGGGGTGGGGGGTGAGGG + Intergenic
905732806 1:40307910-40307932 TTGAAGTGGGAAGGGGATGAGGG + Intronic
905998212 1:42400655-42400677 GATTTGTGGGTAGGGGGTGAAGG + Intronic
906014564 1:42563450-42563472 CTGTTGGGGGTAGGGGGTGAGGG + Intronic
906528223 1:46508810-46508832 TGGTGGGGGGTGGGGGGTGGGGG - Intronic
906787281 1:48627034-48627056 TTGTGGAGGGTGAGGGGTAAAGG - Intronic
906882633 1:49608916-49608938 CTGTGGTGGGGGAGGGGTGATGG - Intronic
906919382 1:50048011-50048033 TCGAGGTGGGCAGGGGGTGGCGG + Intronic
906970782 1:50511391-50511413 TTGGGTTGGGTGGGGGGTTAGGG - Intronic
907053033 1:51342592-51342614 GTGTGGTGGGCGAGGGGTGAGGG + Intronic
907468819 1:54658109-54658131 TGGTGGTGGCTAGGGGCTGGGGG - Intronic
907837693 1:58126597-58126619 GGGTGGGGGGTAGGGGGGGAGGG - Intronic
908177850 1:61573528-61573550 TTATGGTGGGTTGGGGGGCAGGG - Intergenic
908260570 1:62336860-62336882 GGGTGGTGGGTAGTGGATGAGGG + Intergenic
908329093 1:63052662-63052684 ATGTGGTGGGGAGGGAGTTAGGG + Intergenic
909053449 1:70795535-70795557 TTGTTGGGGGTAGGGGGCAAGGG - Intergenic
909068720 1:70966595-70966617 TGTTGGGGGGTCGGGGGTGAGGG - Intronic
909991707 1:82231363-82231385 CTGTGGAGGGTAGGGGGGAATGG - Intergenic
910194250 1:84624179-84624201 TTTTGGGGGGTGGGGGGTGGGGG + Intergenic
911103632 1:94113210-94113232 GTATGGTGGGGAGGGGGTAAAGG - Intronic
912108952 1:106316372-106316394 TTTTGGGGGGTGGGGAGTGATGG - Intergenic
912470711 1:109904943-109904965 TTGTGGTGGGGGGTGGGGGACGG - Intergenic
912630884 1:111245856-111245878 TTGTAGTGGGTAGGGGTGTAGGG - Intergenic
913013583 1:114710184-114710206 TTGGGGGGGGTTGGGGGGGATGG - Intronic
913090522 1:115473718-115473740 ATGTGGTGGGTAGGAGGTTGGGG + Intergenic
913259725 1:116987305-116987327 TTGTGGTGAGGAAGGGGTGATGG + Exonic
913278794 1:117165121-117165143 TTGTCATTGGTATGGGGTGATGG + Intronic
915430110 1:155859928-155859950 TGGTGGTGGGTAGTGGGTAGTGG + Intronic
916254284 1:162770522-162770544 ATGTGGTGGGCAGGGTGTCAAGG + Intronic
916276779 1:163002746-163002768 TTGGGGTGAGTATGGGGAGATGG - Intergenic
916296433 1:163225575-163225597 GTGGGGTGGGTAGGGGGTGTGGG - Intronic
916331181 1:163619016-163619038 TTGTGGGGGGAAGGGTGGGAGGG - Intergenic
916425332 1:164674851-164674873 TGGTGGTGGGTGGGGGGGGGGGG - Intronic
916884008 1:169049400-169049422 TGATGGTGGGTGGGGGATGATGG - Intergenic
917736007 1:177921052-177921074 TTGGGTAGGGCAGGGGGTGAGGG - Intergenic
917840244 1:178971589-178971611 TTGTGGTTGGCAGGGACTGAGGG - Intergenic
917876538 1:179291891-179291913 TGGTGGGGGATGGGGGGTGAGGG - Intergenic
918558077 1:185829404-185829426 TGTTGGGGGGTAAGGGGTGAGGG - Intronic
919467985 1:197945404-197945426 TGTTAGGGGGTAGGGGGTGAGGG - Intergenic
919569303 1:199226285-199226307 TTTTGGGGGGTTGGGGGTGTGGG - Intergenic
919586091 1:199442312-199442334 TGTTGGGGGTTAGGGGGTGAGGG - Intergenic
920022982 1:202969411-202969433 GAGTGGTGGGAAGGGGCTGATGG + Intergenic
920047587 1:203143468-203143490 TGGTGGTGGGTGGGGGGAGGGGG - Intronic
920071233 1:203304835-203304857 TTCTGGTGGGTAGGGGTAGGGGG - Intergenic
920123670 1:203676803-203676825 TTGGGGTGGGGGTGGGGTGAGGG + Intronic
920166629 1:204040967-204040989 GTGGGTTGGGTATGGGGTGAGGG - Intergenic
920201903 1:204264794-204264816 TGGTGGTGGGTTGGGGGAGGAGG - Intronic
920379288 1:205526497-205526519 TTGTGGTGGAAACGGGGTGTGGG + Intronic
920713719 1:208319538-208319560 ATGTGTTTGGTAAGGGGTGAAGG + Intergenic
920864498 1:209740592-209740614 ATAGGGTGGGAAGGGGGTGAAGG + Intergenic
921213372 1:212918138-212918160 GTGTGCTGGGGAGGGAGTGACGG + Intergenic
921794439 1:219326292-219326314 TTTTGGTGGGTGGGGGGTTGGGG + Intergenic
922047626 1:221962052-221962074 TTTTGGAGGGGCGGGGGTGAAGG - Intergenic
922129459 1:222762567-222762589 TTGTTGTGGGGTGGGGGGGAGGG + Intergenic
922266278 1:223987067-223987089 TTTTGGTAGGGAGGGGGTGGGGG - Intergenic
922718257 1:227887803-227887825 CTGCGGTGGGGATGGGGTGAGGG - Intergenic
922866597 1:228866023-228866045 TGGTGGGGGGCAGGGGGTGGTGG + Intergenic
922884178 1:229005344-229005366 GTGTGGTGTGAAGGGTGTGATGG + Intergenic
923008814 1:230072351-230072373 GTGTGGTGGGGCGGGGGTGGCGG + Intronic
923079659 1:230641679-230641701 TTGGGGTGGGTGGGGGGAGGAGG + Intergenic
923110269 1:230884691-230884713 ATTTGGTGGGCAGGGGGTGAGGG - Intergenic
923224848 1:231929883-231929905 TTGTAGTAGTTAAGGGGTGAGGG + Intronic
923376229 1:233366178-233366200 TTGGGGTGGGAAGGGCTTGAGGG + Intronic
923796630 1:237163359-237163381 TTGTGGAGGGGTGGGGGTGGGGG - Intronic
1062908978 10:1199920-1199942 TGGTGGTGGGAAGGAGGTGGAGG + Intronic
1063076480 10:2721939-2721961 TGTTGTGGGGTAGGGGGTGAGGG - Intergenic
1063081292 10:2770151-2770173 AAGGGGTGGGAAGGGGGTGAGGG + Intergenic
1063117981 10:3085205-3085227 CTGTGCTGGGGAGGGGGTGAGGG - Intronic
1063117990 10:3085229-3085251 CTGTGCTGGGGAGGGGGTGGGGG - Intronic
1063118001 10:3085253-3085275 CTGTGCTGGGGAGGGGGTGGGGG - Intronic
1063156985 10:3389012-3389034 CTGGGGTGGGTGGGGGATGAGGG + Intergenic
1063239942 10:4158684-4158706 TTGTGGTTGTCAGGGGCTGAAGG - Intergenic
1063368172 10:5504053-5504075 GTGTGGTGTGTAGGGGAGGAAGG - Intergenic
1063463528 10:6229200-6229222 TTTTGGTGGCAAAGGGGTGAAGG + Intronic
1064707593 10:18089164-18089186 GTGTGGTGGGGAGCGGGGGAGGG + Intergenic
1065184443 10:23158211-23158233 TTGTGGGGGGTGGTGGGGGAAGG + Intergenic
1065883004 10:30053212-30053234 TGGTGGGGGGTGGGGGGTGCAGG + Intronic
1066160225 10:32720417-32720439 TGTTGGGGGGTAGGGGGTCAAGG + Intronic
1066346421 10:34591139-34591161 GTGGGATGGGGAGGGGGTGATGG - Intronic
1067074005 10:43162427-43162449 TTGGGGTGGGCAGAGAGTGAGGG + Intronic
1067145280 10:43689569-43689591 GGGGGGTGGTTAGGGGGTGAGGG + Intergenic
1067428430 10:46226498-46226520 TGGTGGTGGGTGTGGGGTGGGGG + Intergenic
1067726155 10:48772693-48772715 CTGTGGTGGGGTGGGGGTAAGGG - Intronic
1068093811 10:52465640-52465662 TTGTGTTGGGTAGGGGTGGCGGG + Intergenic
1068185389 10:53578533-53578555 CTGTTGTGGGTAGAGGGGGAGGG + Intergenic
1068629435 10:59284569-59284591 GTGTGTGGAGTAGGGGGTGAGGG - Intronic
1068673407 10:59745489-59745511 TGGTGGGGGGTGGGGGGTGGGGG - Intergenic
1068734934 10:60402744-60402766 TTGTCTGGGGTGGGGGGTGATGG - Intronic
1068834118 10:61533536-61533558 TGTTGGGGGGTGGGGGGTGAGGG - Intergenic
1068870448 10:61937869-61937891 TTGTGGTGGGAGGGGGGTGTTGG + Intronic
1068895564 10:62195804-62195826 ATTTGGTGGGGAGGGGGTGGTGG + Exonic
1069614447 10:69798073-69798095 TTGTGGTTGGTAGGAAGAGATGG - Intergenic
1070252702 10:74786955-74786977 TTGGGGTGGGTGGTGGGGGAGGG - Intergenic
1070339768 10:75487114-75487136 GTGTGGTTGGTAGGAAGTGAAGG + Intronic
1070356954 10:75649121-75649143 TTGTGGTTGCTAGGGGCTAAGGG - Intronic
1070507458 10:77126720-77126742 TGGTGGTGGGGGGGGGGTGGGGG - Intronic
1070614732 10:77960951-77960973 TTGCTATGGGTAGGGGGTGGGGG - Intergenic
1070680064 10:78442811-78442833 CTGGGGTGGGTAGGGGATGAGGG - Intergenic
1070764473 10:79048529-79048551 CTGGGGTGGGGAGGGGGTGGCGG + Intergenic
1071132446 10:82410525-82410547 TAGTGGTGGCTAAGGGGTGGAGG + Intronic
1071453679 10:85824680-85824702 TGGTGGTGGGGGGGTGGTGAGGG - Intronic
1071852318 10:89586395-89586417 CTGTGGGGGGTAGGGAGTGGAGG + Intronic
1071880164 10:89888638-89888660 TTGTGGGGGGTGGGGGGGTAGGG - Intergenic
1072770376 10:98132889-98132911 TTTTGGTGGGCAGGGGGCTAGGG + Intergenic
1072824622 10:98594295-98594317 TTGTGGTGGGGAAGGGGAGGCGG - Intronic
1073104804 10:101026471-101026493 TTTTGATGGGTGGGGGGTAAGGG + Intronic
1073389917 10:103166281-103166303 TTGGGGTGGGTGGAGGGAGATGG - Intronic
1073585225 10:104703594-104703616 TGCTGGAGGGTGGGGGGTGAGGG + Intronic
1073722486 10:106188979-106189001 TTGTGGTGGGGTGGTGGTGGTGG - Intergenic
1073843808 10:107528970-107528992 CTGTGGTGGGGAGGGGGAGGGGG + Intergenic
1073956328 10:108875600-108875622 TGGTGGTGGGTTGGGGGCGGTGG - Intergenic
1074456260 10:113597943-113597965 TTGTGGTGGGGACAGGTTGATGG + Intronic
1074771831 10:116739945-116739967 TGCTGGTGGGTAGGTGGTGTTGG - Intronic
1074971119 10:118539809-118539831 AGGTGGTGGGTGGGGGGTGGGGG - Intergenic
1075018156 10:118926404-118926426 TTGGGGTGGGAGAGGGGTGAGGG - Intergenic
1075106711 10:119543952-119543974 GTGGGGTGGGTAGAGGGAGAGGG - Intergenic
1075686172 10:124366855-124366877 TGGTGGTGGGAAGGGGGTTTTGG - Intergenic
1075710231 10:124526841-124526863 GTGTGGTGGGGAGGTGGGGAGGG + Intronic
1075979325 10:126723377-126723399 GGGTGGTGGGTGGGGGGAGATGG - Intergenic
1076605706 10:131688890-131688912 ATGTGGTGGGGTGGGGGTGGGGG - Intergenic
1076755780 10:132570954-132570976 TCCTGGTGGGTGGGGGCTGAGGG + Intronic
1076831657 10:132997928-132997950 TTGAGGTGGGGCTGGGGTGAGGG - Intergenic
1076903031 10:133349125-133349147 GTGTGGTGTGTAGAGTGTGAGGG - Intronic
1076949516 10:133670149-133670171 TGGTGGTGGGGGGGGGGTGGTGG - Intronic
1076950500 10:133673448-133673470 TGGTGGTGGGGGGGGGGTGGTGG - Intergenic
1076953463 10:133683367-133683389 TGGTGGTGGGGGGGGGGTGGTGG - Intergenic
1076958398 10:133752947-133752969 TGGTGGTGGGGGGGGGGTGGTGG - Intergenic
1076960371 10:133759556-133759578 TGGTGGTGGGGGGGGGGTGGTGG - Intergenic
1077149520 11:1064076-1064098 TGGTGGGGGGTGGGAGGTGAGGG - Intergenic
1077190771 11:1255218-1255240 CTGTGGTGGGCATGGGGTGGGGG - Exonic
1077409416 11:2396488-2396510 CCGAGGTGGGTAGGGGGTGGGGG + Intronic
1077496641 11:2889890-2889912 TCAAGGTGGGTAGGAGGTGAGGG + Intronic
1077820101 11:5729035-5729057 CTGTTGTGGGGTGGGGGTGAGGG - Intronic
1078187913 11:9068165-9068187 TTATGGTGAGTAGGAGATGAGGG - Intronic
1078203190 11:9203374-9203396 GAGGGGTGGGTAGGAGGTGATGG - Intronic
1078240896 11:9530118-9530140 TGGGGGTGGGTAGGAGGGGAAGG - Intergenic
1078577925 11:12517308-12517330 TGGTGGGGGGTGGGGGGTGGGGG - Intronic
1078581260 11:12541368-12541390 GTGTGGAGGGTAGGGAGAGAGGG - Intergenic
1078590990 11:12640909-12640931 ATGTGGTGGGTATGTGGTGGTGG - Intergenic
1078693975 11:13610680-13610702 TTGTGGTGGGTGGTAGGTGCTGG + Intergenic
1078902321 11:15652938-15652960 TGGTGGTGGGGATGGGGAGATGG - Intergenic
1079112347 11:17612011-17612033 TTGTGGTGGGTAGGGGGTGAGGG + Intronic
1079360956 11:19770013-19770035 TTGTGGTTTGGTGGGGGTGAGGG - Intronic
1079437526 11:20472856-20472878 TTTTGGAGGGTGGGGGGTGGAGG + Intronic
1079448078 11:20574544-20574566 TTTTGGGGGGTGGGGGGTGGGGG - Intergenic
1080244550 11:30164518-30164540 AGGTGGTGGGGTGGGGGTGAGGG + Intergenic
1080272045 11:30460714-30460736 TTGTTGAGAGTAGGGTGTGATGG + Intronic
1080399763 11:31922861-31922883 AGGTGGGGGGTAGGGGGTGCAGG + Intronic
1082081210 11:48013806-48013828 TTGAAGTGGGTAGGGGAGGAGGG - Intronic
1082108741 11:48248753-48248775 TGTTGGGGGGTGGGGGGTGAGGG - Intergenic
1082135267 11:48542133-48542155 CTGTTGTGGGGTGGGGGTGAGGG - Intergenic
1083003123 11:59315617-59315639 TTGTCGTGGGGGGGGGGGGATGG - Intergenic
1083185257 11:61013938-61013960 TGGTGGTGGGTAGGTGCTGGTGG - Exonic
1083497448 11:63069592-63069614 ATAGGGTGGGAAGGGGGTGAGGG - Intergenic
1083620231 11:64045554-64045576 ATTTGGTAGGTAGGGGGTGAGGG + Intronic
1083951692 11:65960059-65960081 TCCTGGTGGGGAGGGGGTGCGGG - Intergenic
1084164293 11:67367714-67367736 TTGGGCTGGGTGGGGGGTGAGGG + Intronic
1084403147 11:68956331-68956353 CTGTGGTGGGGGGGGGGTGTTGG + Intergenic
1084780395 11:71404427-71404449 GTGTGGTGGGTAGGCGGTGGGGG + Intergenic
1084801115 11:71544868-71544890 TGGTGGGGGATGGGGGGTGAGGG - Intronic
1085251240 11:75145273-75145295 TGGTGGAGGGTGGGGGGTGCAGG - Intronic
1085580355 11:77644688-77644710 ATTTGGTGGGTATGGGGTGCCGG + Intergenic
1085689581 11:78654338-78654360 TTGTGGTGGCCATGTGGTGAGGG - Exonic
1085741918 11:79084684-79084706 TGGTGGTAGTTAGGGGGTTAGGG + Intronic
1085763589 11:79262993-79263015 TTGTGCTGGGCAGGTGGTCAGGG - Intronic
1086020373 11:82221452-82221474 TGGTGGTTGGCAGGGGCTGATGG - Intergenic
1086101645 11:83106474-83106496 TTCAGGTGGGTTGGGGGAGAAGG + Intergenic
1086819994 11:91424103-91424125 CTGTGGGGAGTGGGGGGTGAGGG - Intergenic
1088083898 11:105955267-105955289 TGTTGGAGGGTTGGGGGTGAGGG - Intronic
1088146812 11:106690516-106690538 TTTTGGAGGGTGGAGGGTGAAGG + Intronic
1088304296 11:108391721-108391743 TGGTGGTGGCTATGGGGTGCAGG - Intronic
1088960698 11:114662012-114662034 TTGCGGGGGGTAGGTGGAGAGGG - Intergenic
1088990313 11:114948047-114948069 TGGTGGTGGGGAGGGGGTGAAGG - Intergenic
1089495972 11:118908874-118908896 TTGTGGAGGCTAGGGGGTGGAGG - Intronic
1090189896 11:124760800-124760822 TTGTGGGGGGTGGGGGCTGGGGG - Intronic
1090362852 11:126185544-126185566 GTGCGGTGGGCTGGGGGTGAGGG - Intergenic
1090429360 11:126633220-126633242 CTGTTGTGGGGTGGGGGTGAGGG + Intronic
1090473670 11:127001308-127001330 TTGTGGTGGGGGGGGGGGGTAGG + Intronic
1090480142 11:127060907-127060929 TTGAGGTGGGAGGCGGGTGAGGG - Intergenic
1091034713 11:132222752-132222774 GTGGGGTGCGTGGGGGGTGAGGG - Intronic
1091155107 11:133364843-133364865 TTGTGGGGGGTGTGTGGTGAGGG + Intronic
1091194986 11:133723175-133723197 GTGTGGTGGGTAGGGGCTGCTGG - Intergenic
1091211083 11:133861986-133862008 TTGTGGTTGCTAGGGGCCGAGGG - Intergenic
1091933621 12:4417163-4417185 TTTTCGGGGGTTGGGGGTGAGGG + Intergenic
1091971203 12:4788465-4788487 TTGGGGTGGGTGGGAGGGGAAGG + Intronic
1092026480 12:5245010-5245032 TTGGGGTGGGGAGTGGGTCAGGG + Intergenic
1092223121 12:6728992-6729014 CTGTGGTGTGTCAGGGGTGAGGG + Intronic
1092230384 12:6772767-6772789 TGGTGGGGGGTGGGGGGTAAAGG - Exonic
1092623699 12:10302601-10302623 ATTTGGTGGGCAGGGGGTTAGGG + Intergenic
1092654788 12:10673370-10673392 TTGGGGTGGGGAGTGGGGGAGGG - Intronic
1092776477 12:11948709-11948731 TTGTGGTGGGAACGAGATGACGG - Intergenic
1093504989 12:19854765-19854787 CTGTTGTGGGTGGGGGATGAGGG - Intergenic
1093894935 12:24563961-24563983 GCGTGTTGGGAAGGGGGTGATGG + Intergenic
1093920684 12:24856248-24856270 GTGGGGTGTGTAGAGGGTGAAGG - Intronic
1094284946 12:28782488-28782510 CTGTGGAAGGGAGGGGGTGAGGG - Intergenic
1094496598 12:30992875-30992897 TGGTGGTGGCTACGGGGTCAAGG - Exonic
1095218044 12:39573277-39573299 TGGTGGTGGGGAAGGGGGGAGGG - Intronic
1095597087 12:43971518-43971540 GCGTGGAGGGTAGGGGCTGAAGG - Intronic
1095761976 12:45850185-45850207 TGCTGGTGGGTATGAGGTGAAGG - Exonic
1095808395 12:46345953-46345975 TTGTGTGGGGAAGGGGGGGAGGG - Intergenic
1096790328 12:54040380-54040402 CTGTGGTGGGAAGGGAGGGAGGG - Intronic
1097065684 12:56318837-56318859 GGGTGGTGGGTGAGGGGTGAGGG - Intronic
1097759357 12:63444044-63444066 TGTTGGGGGGTCGGGGGTGAGGG - Intergenic
1097848454 12:64389487-64389509 TTTTGCTGGGGAGGGGGTGGAGG + Intronic
1097864664 12:64550094-64550116 TGGAGGTGGGAAGGGGGTGGGGG - Intergenic
1098241688 12:68473567-68473589 TTGGGGTGGGAGGGGGGTGAGGG + Intergenic
1099217185 12:79867313-79867335 CTGTGGGGGGTGGGGGGTCAGGG + Intronic
1099750815 12:86769862-86769884 TTGTGGTGTGGAGTGGGGGAGGG + Intronic
1099792746 12:87357876-87357898 TGTTGCTGGGTTGGGGGTGAGGG - Intergenic
1100686563 12:96992731-96992753 TTGTGGTGGGTGGCGGGGGGTGG - Intergenic
1101284332 12:103294916-103294938 TTTTGGAGGGTGGAGGGTGAAGG - Intronic
1101332987 12:103772047-103772069 TTGCTGTGGGTGGGGGGAGATGG + Intronic
1101579828 12:106032693-106032715 TGGTGGTGGGGTGGGGGTGTTGG - Intergenic
1101587267 12:106095722-106095744 GTGTGATGGGTTGGAGGTGAAGG + Intronic
1101608501 12:106268828-106268850 TTGTGCTGGGTACTGGGTGATGG - Intronic
1101743663 12:107521675-107521697 CTGGGGAGGGTAGGGGGTGGGGG - Intronic
1102136416 12:110580012-110580034 TTTTGGTGGGTGGGGGGTGCGGG - Intronic
1102230031 12:111256147-111256169 GTGCGGTGGGTAGGGGCCGATGG - Intronic
1102371200 12:112383279-112383301 TTTTGGTGGGGAGGGAGGGATGG - Intergenic
1102520795 12:113476583-113476605 GTGGGGTGGGTGGGGGGTGGTGG + Intergenic
1102535464 12:113577444-113577466 TGGTGGGGGGGAGGGGCTGAAGG - Intergenic
1102777298 12:115531685-115531707 CTGTGGTGGGGATGGGGTGAGGG - Intergenic
1102777968 12:115537213-115537235 TGGTGATGGGTGGGGGGGGATGG + Intergenic
1102965278 12:117120807-117120829 TAGGGGTGGGTGGGTGGTGAGGG - Intergenic
1103578264 12:121894874-121894896 TTGTGGTGGGAAGGTGTTAAAGG + Intronic
1103649877 12:122423558-122423580 TTGTGGTGGATAAGGGGGCAGGG + Intergenic
1104033031 12:125078961-125078983 TTGTGATGGGAAAGGGATGATGG + Intronic
1104057790 12:125243928-125243950 TAGTGGTGGGCAGGGGCTGGGGG - Intronic
1104067180 12:125315728-125315750 TGTTGGTGGTTAAGGGGTGATGG + Intronic
1104182891 12:126399476-126399498 GTGTGGTGGGTGAGGGATGAGGG - Intergenic
1104204637 12:126626726-126626748 TTTTGATGGGTATGAGGTGAAGG - Intergenic
1104477219 12:129080903-129080925 TTCTGCTGGGGAGCGGGTGACGG - Intronic
1105480395 13:20770282-20770304 TTGTGGTTGCTAGGGGCTGGGGG + Intronic
1106506653 13:30376348-30376370 ATGTGGAGGGAAGGGGGTTAGGG + Intergenic
1106871356 13:34025588-34025610 TTTTGGTGGGGCGGGGGTGCAGG + Intergenic
1107564723 13:41590131-41590153 TGGTGGAGGTCAGGGGGTGAGGG + Intronic
1107912358 13:45117456-45117478 TTGTGGTGGGTGTGGTGTTAGGG + Intergenic
1108494204 13:51008057-51008079 AGGTGGTGGGAAGGGGGTGAGGG - Intergenic
1108846034 13:54679282-54679304 GTTTGGTGGGTAGGGGGCCAAGG - Intergenic
1108952076 13:56106990-56107012 TGGGGGTGGGTAGGGGTTGGGGG - Intergenic
1109633538 13:65084697-65084719 TTGGGGGGGGGAGGGGGTGGGGG - Intergenic
1109786932 13:67188926-67188948 GGGTGGTGGGAAGTGGGTGAGGG - Intronic
1110410105 13:75195599-75195621 TTGTGGGGGGTAGGGGGAGAGGG - Intergenic
1110643561 13:77854818-77854840 AGGTGGTGGGTAGGGGAGGAGGG + Intergenic
1110693286 13:78457174-78457196 TGTTGGGGGGTAGGGGGTGAGGG + Intergenic
1110952058 13:81506858-81506880 TTGAGGTGGTTAGGGGCTGCAGG + Intergenic
1111699859 13:91673075-91673097 TGTTGGGGGTTAGGGGGTGAGGG + Intronic
1111962460 13:94826182-94826204 GTTTGGGGGGTGGGGGGTGAGGG - Intergenic
1112076649 13:95921187-95921209 CTGTTGGGGGTAGGGGGTGTGGG + Intronic
1112129666 13:96508340-96508362 TTGTGGAGGATCGGGGGTGTAGG - Intronic
1113203474 13:107891706-107891728 CTGTGGTGGGGTGGGGGGGAGGG + Intergenic
1113722685 13:112572414-112572436 TGTTGGAGGGTGGGGGGTGAGGG - Intronic
1114487251 14:23070193-23070215 TGGTGGGGGGTGGGGGGTGCGGG + Intronic
1114660872 14:24343401-24343423 TGGTGGTTTGTAGGGGCTGAGGG + Intergenic
1115304420 14:31919242-31919264 GAGTGATGGGGAGGGGGTGATGG - Intergenic
1116173241 14:41430040-41430062 TAGAGGGGGTTAGGGGGTGAGGG - Intergenic
1117119564 14:52553043-52553065 CTGGGGTGGGTGGGGGGTAAGGG + Intergenic
1117662336 14:58020588-58020610 CTGTGGTGTGTGTGGGGTGAGGG + Intronic
1117691492 14:58311926-58311948 TTGGGGTGGGCGGGGGGTGAGGG + Intronic
1117760881 14:59027065-59027087 TTTTGAGGAGTAGGGGGTGAGGG + Intergenic
1117772051 14:59143322-59143344 TGGGGGTGGGGAGGAGGTGAGGG - Intergenic
1118057283 14:62092704-62092726 TGGTGGTTGCCAGGGGGTGAAGG + Intronic
1118354090 14:64997412-64997434 GTTTGGTGGGCAGGGGGTTAGGG - Intronic
1118682218 14:68254333-68254355 CTGTGGAGGGTTGGGGGAGAGGG - Intronic
1118749370 14:68795306-68795328 TTGGGGGGGGTGGGGGGTGGGGG - Intronic
1119186382 14:72645787-72645809 TTTTGGGGGGTGGGGGGTGTAGG - Intronic
1119222600 14:72921083-72921105 CTGTATTGGGTAGGGGGTGGGGG + Intergenic
1119231479 14:72983345-72983367 CTGTGGTGGGGTGGGGGGGAGGG - Intronic
1119773445 14:77235469-77235491 CTGTGGTGGGTGGGGGGTCTGGG + Intronic
1119773502 14:77235645-77235667 CTGTGGTGGGTGGGGGGTCTGGG + Intronic
1119773564 14:77235829-77235851 CTGTGGTGGGTGGGGGGTATGGG + Intronic
1119773575 14:77235856-77235878 CTGTGGTGGGTGGGGGGGTATGG + Intronic
1119773647 14:77236059-77236081 CTGTGGTGGGTGGGGGGTATGGG + Intronic
1119773683 14:77236166-77236188 CTGTGGTGGGTGGGGGGTATGGG + Intronic
1119773711 14:77236245-77236267 CTGTGGTGGGTGGGGGGTATGGG + Intronic
1119773749 14:77236349-77236371 CTGTGGTGGGTGGGGGGTATGGG + Intronic
1119825964 14:77657284-77657306 TTTTGGTGGGGAGGGGAGGAAGG - Intergenic
1120880616 14:89413043-89413065 TGGTGGTGGGTCGGGGTGGAGGG - Intronic
1121096511 14:91221239-91221261 CAGTGGTAGGTAGGGAGTGAGGG + Intronic
1121377990 14:93431170-93431192 TTGGGGCGGGTGGGGGGTGGCGG + Intronic
1121539279 14:94712915-94712937 TTGTGGAGGGGCGGGGGTGTGGG + Intergenic
1121989540 14:98542431-98542453 TTGTGTTGGCTCTGGGGTGATGG - Intergenic
1122361927 14:101172691-101172713 TGGGGGTGGGTGGGAGGTGACGG - Intergenic
1122361939 14:101172723-101172745 TGGGGGTGGGTGGGAGGTGACGG - Intergenic
1122361951 14:101172755-101172777 TGGGGGTGGGTGGGAGGTGACGG - Intergenic
1122604314 14:102938248-102938270 AGGTGGGGGGTAGGGGGTGCTGG - Intronic
1122772322 14:104102910-104102932 TGGGTGTGGGGAGGGGGTGATGG + Intronic
1122776528 14:104119320-104119342 TTGTGGTGAGTGGGGGGAGTGGG - Intergenic
1122888488 14:104722119-104722141 CTGTGGGGGGTAAGGGGTGGAGG + Intronic
1123048992 14:105531596-105531618 GAGTGGGGGGTAGTGGGTGAGGG + Intergenic
1124056345 15:26243942-26243964 TTGCGGGGGGTGGGGGGTGGGGG + Intergenic
1124071801 15:26401877-26401899 TTATGGTGGGTGGGGGTTGTAGG + Intergenic
1124612527 15:31217877-31217899 TTCTGGTGGGGTGGGGGTGGGGG - Intergenic
1124616931 15:31248753-31248775 TTGTGGTAGGGTGGTGGTGATGG + Intergenic
1124793819 15:32756192-32756214 AGGAGGTGGGGAGGGGGTGAAGG - Intergenic
1124815667 15:32989549-32989571 TTTTGGTGGGGGGCGGGTGAAGG - Intronic
1125110577 15:36027572-36027594 ATGGGGTGGGTAGGAGGGGAGGG + Intergenic
1125155097 15:36576994-36577016 TACTGGGGGGTTGGGGGTGAGGG + Intergenic
1125301193 15:38254351-38254373 TTGGGGTGGGGAGGGAGTAAGGG - Intronic
1125716082 15:41820808-41820830 TGGTGGGAGGTAGGGGGTGGGGG - Intronic
1125724295 15:41860562-41860584 TAGTGGTGGCTCTGGGGTGAGGG - Intronic
1125805181 15:42487799-42487821 TGGTGGTTGCTAGGGGTTGAGGG - Intronic
1126319613 15:47407925-47407947 TGGTGGTGGGGTGGGGGTGTTGG + Intronic
1126345974 15:47694436-47694458 GTTTGGTGGGTTGGAGGTGAAGG - Intronic
1126816345 15:52459002-52459024 TTTTGGGGGGCAGGGGGAGAAGG + Intronic
1127366391 15:58294588-58294610 TTGTGGAGGGTAGGTAGTGTGGG - Intronic
1127506546 15:59603574-59603596 TTTTGGTGGGTAGGGGGATAGGG - Intronic
1127710107 15:61588808-61588830 CTGTTGGGGGTTGGGGGTGAGGG + Intergenic
1127793829 15:62421668-62421690 TATTGGAGGGTAGGGGGTGGGGG + Intronic
1128065671 15:64763046-64763068 CCGTAGTGGGTAGGGGGTGGGGG + Intronic
1128147444 15:65339879-65339901 GGGTGATGGGAAGGGGGTGATGG + Intronic
1128494655 15:68188261-68188283 TTGTTGTGGGGAGGGGGTCGGGG + Exonic
1128595032 15:68937611-68937633 TGTTGGTGGGTGGGGGGTGAGGG - Intronic
1128666726 15:69543703-69543725 GGGTGGTGGGAAGGAGGTGATGG + Intergenic
1128867535 15:71125885-71125907 TTGTGTTGTTTAGGGGGTGGTGG + Intronic
1129158462 15:73733241-73733263 TGGGGGTGGGCAGGTGGTGATGG + Intergenic
1129511529 15:76126904-76126926 TTGCGGGGGGCAGGTGGTGAGGG + Intronic
1129882699 15:79017680-79017702 TGGTGGCAGGTAGGGGGTGGGGG - Intronic
1129919048 15:79303072-79303094 TGTTGGGGGGTAGGGGATGAGGG - Intergenic
1129926791 15:79371574-79371596 CTTTGGTGGGCAGGGGGTTAGGG + Intronic
1130569209 15:85025423-85025445 GGGGGGTGGGTAGGGGGTGTGGG + Intronic
1131078323 15:89513223-89513245 GTGTGGTTTGTAGGGGGTGAGGG + Intergenic
1131792140 15:95976384-95976406 TTGGGGTGGGTAGGAGGAAATGG - Intergenic
1132119741 15:99166610-99166632 TTGTGGTGGGCAGACGGAGATGG + Intronic
1132159928 15:99531236-99531258 TTGTTGTGGGTGGGGGGAGGGGG - Intergenic
1133069532 16:3235843-3235865 GTGGGGAGGGTAGGGGGTGGGGG - Intronic
1133426352 16:5693593-5693615 CTGTGGAGGGTGGGTGGTGATGG + Intergenic
1133532393 16:6667104-6667126 TGGTGGTGGGTTGGGGGAGAGGG + Intronic
1133561031 16:6950380-6950402 GTGTAGTGGGTAGTGGGTGGTGG - Intronic
1133818722 16:9217574-9217596 TTGTGGGGTGTAGTGGGGGATGG + Intergenic
1134100749 16:11449815-11449837 TAGTGGTGGGGAAGGAGTGAAGG - Intronic
1134428086 16:14172216-14172238 TTGTGGGGGGGAGGCGGGGAAGG - Intronic
1134729604 16:16450089-16450111 TTGTGGTGGGATAGGGATGAGGG + Intergenic
1134873251 16:17671602-17671624 TGTTGGTGGGTGGGGGGTTAGGG - Intergenic
1135142608 16:19934678-19934700 TTGTGGAGGGTTTGGGATGATGG + Intergenic
1135199580 16:20425569-20425591 AAATGGTGGGAAGGGGGTGAGGG - Intronic
1135414235 16:22256913-22256935 CTGTGGTGGGCAGAGGGTGGAGG - Intronic
1135726082 16:24854806-24854828 TTCAGGAGGGGAGGGGGTGAGGG - Intronic
1136133781 16:28241732-28241754 TTGCGGTGGGTGGGGGGGGGGGG - Intergenic
1136141559 16:28292255-28292277 GTGGGGTGGGTGGGGGGTGGGGG + Intergenic
1136388527 16:29946300-29946322 TGTTGGTGGGCAGGGGGTGGGGG - Intronic
1136708946 16:32217355-32217377 CTGTGGGGGGTGGGGGGTGGGGG + Intergenic
1136758963 16:32712069-32712091 CTGTGGGGGGTGGGGGGTGGGGG - Intergenic
1136809144 16:33158315-33158337 CTGTGGGGGGTGGGGGGTGGGGG + Intergenic
1136815620 16:33268395-33268417 CTGTGGGGGGTGGGGGGTGGGGG + Intronic
1137423245 16:48354078-48354100 TTGGGGGGGGTGGGGGGTTAGGG + Exonic
1137796506 16:51224650-51224672 ATGGGGTGGGGTGGGGGTGAGGG - Intergenic
1138091558 16:54178797-54178819 TTGTGTTGGGGAGGGGGTGGAGG + Intergenic
1139139288 16:64241817-64241839 TTGGTGGGGGTAGGGGGTGGTGG - Intergenic
1139332980 16:66208310-66208332 CTGTTGGGGGAAGGGGGTGACGG - Intergenic
1140313636 16:73872797-73872819 TGGTGGTGGGTGGTGGGTGGTGG + Intergenic
1140313667 16:73872876-73872898 TGGTGGTGGGTGGTGGGTGGTGG + Intergenic
1140313680 16:73872916-73872938 TGGTGGTGGGTGGTGGGTGGTGG + Intergenic
1140313762 16:73873146-73873168 TGGTGGTGGGTGGTGGGTGGTGG + Intergenic
1140313769 16:73873163-73873185 TGGTGGTGGGTGGTGGGTGGTGG + Intergenic
1140313807 16:73873268-73873290 TGGTGGTGGGTGGTGGGTGGTGG + Intergenic
1140466470 16:75187229-75187251 ATTTGGTGGGTAGGGGGTCAGGG + Intergenic
1140634553 16:76896158-76896180 CTGTTGTGGGTCGGGGGAGAGGG + Intergenic
1141157737 16:81609178-81609200 CTGTGGTGGGGAGGGGGGGAGGG - Intronic
1141178284 16:81734900-81734922 GTGTGGTGGGGTGGGGGAGAGGG + Intergenic
1141611401 16:85183116-85183138 ATGTGGCGGTGAGGGGGTGAGGG - Intronic
1141620687 16:85235345-85235367 CTGAGGTGGGAGGGGGGTGAGGG - Intergenic
1142021500 16:87785666-87785688 TTTTGGTGGGTGGGGGGGGATGG + Intergenic
1142035903 16:87862034-87862056 CTGTGGGGGGTTGGGGGTGGAGG + Intronic
1142257820 16:89023785-89023807 TGGAGGTGGGGAAGGGGTGAGGG - Intergenic
1203061119 16_KI270728v1_random:972394-972416 CTGTGGGGGGTGGGGGGTGGGGG - Intergenic
1142486777 17:252661-252683 ATGGGGTGGGTGCGGGGTGATGG - Intronic
1142759755 17:2035485-2035507 CTGTGGTGGGGAGGGGGTGGGGG + Intronic
1142759768 17:2035514-2035536 CTGTGGTGGGGAGGGAGTGGGGG + Intronic
1142954151 17:3509312-3509334 TGTTGGGGGGTAGGGGGTGAGGG - Intronic
1142960071 17:3547142-3547164 TGAGGGTGGGTAGGTGGTGACGG - Intronic
1143431484 17:6890605-6890627 TTATGGTGGATAGGGTGTGATGG - Intronic
1143513071 17:7406366-7406388 TTGTTGTGGGGAGGGGGAGGGGG + Intronic
1143828390 17:9631378-9631400 TTGAGGAGGTGAGGGGGTGAGGG - Intronic
1143871083 17:9957716-9957738 AGCTGGTGGGTAGGGGGTGTGGG - Intronic
1143872167 17:9964862-9964884 TTGAGGTAGGTAGGAGGTGGTGG + Intronic
1143989533 17:10944898-10944920 TTGGGGTGGGGAGGGGGTGGGGG - Intergenic
1144458689 17:15439938-15439960 TTGTGGTGGGGAGAGGGGGGAGG + Intronic
1144744366 17:17603891-17603913 GTGTTTTGGGTTGGGGGTGAGGG - Intergenic
1144783851 17:17821268-17821290 CTGTGTGGGGTTGGGGGTGATGG - Intronic
1145104119 17:20100811-20100833 TGTTGGTGGGTAGGGGGCAAGGG - Intronic
1145792673 17:27637715-27637737 TGGTGGTGGGGAGAGGGGGATGG + Intronic
1145807546 17:27745583-27745605 TGGTGGTGGGGAGAGGGGGATGG + Intergenic
1145840481 17:27990109-27990131 ATGTGGTGGGTAGGAGTTGTAGG - Intergenic
1146031109 17:29366808-29366830 TTGGGGTGTGTAGGGGGACAGGG + Intergenic
1146190297 17:30759710-30759732 TTTTGGTGGGTGGGTGGTGGGGG + Intergenic
1146240702 17:31221080-31221102 TTCTGCTGGGTTGGGGGTGGAGG + Intronic
1146375229 17:32289281-32289303 TTGGGGTGGGTGGGGGGTAGTGG - Intronic
1146450410 17:32969600-32969622 TTGTGGGGTGTTGGGGGTGGGGG + Intergenic
1146684356 17:34830819-34830841 GTGTGGTGGATAGGGGTGGAAGG - Intergenic
1146899434 17:36572844-36572866 TTGTGGTTGCTAGGGGGTGAGGG - Intronic
1147273144 17:39291344-39291366 TTTTGGTAGGTAGGGAGGGAGGG + Intronic
1147362288 17:39938618-39938640 TTGAGTTTGGTAGGGGGTCAAGG + Intergenic
1147576130 17:41600082-41600104 TTGTGCTGGGTTTGGGGTGGGGG - Intergenic
1147840967 17:43371164-43371186 TGGAGGTGGGCAGGGGGTGGGGG + Intergenic
1147943368 17:44066123-44066145 TGGTGGTGGGAGGGGGCTGATGG - Intronic
1148021394 17:44556414-44556436 TGGTGGGGGGCGGGGGGTGACGG - Intergenic
1148393426 17:47289972-47289994 TGGTGGAGGGGAGGTGGTGAGGG + Intronic
1149344175 17:55717545-55717567 TGGTGGGGGGGAGCGGGTGATGG + Intergenic
1149345357 17:55728802-55728824 GTGTAGGGGGTAGGGGGTGGTGG + Intronic
1149345835 17:55734440-55734462 TGGTGGGGGGTGGGGGTTGATGG - Intergenic
1149377346 17:56058582-56058604 TTTTGGGGGGTAGGGGGCAAGGG - Intergenic
1149521075 17:57318641-57318663 TTGTGGGGGGTGGGGGCGGAGGG + Intronic
1149588118 17:57807278-57807300 TGGGGGTGGGTAAGGGGAGAGGG - Intergenic
1149737741 17:59012251-59012273 TGGTGGTGGGTGGTGGGTGGTGG - Intronic
1149869354 17:60168429-60168451 TTGTGGGGGGCAGGTGGGGAAGG + Intronic
1150301079 17:64047441-64047463 CTGGGGTGGGGAGAGGGTGAAGG + Intronic
1150343707 17:64388177-64388199 ATGTGGTGTGGAGGGGGAGAGGG + Intronic
1150782790 17:68136368-68136390 TTGTGGGGGGATGGGGGTGGTGG + Intergenic
1150806963 17:68326833-68326855 TTGTGGTGGGTTGGGGTGGGTGG + Intronic
1151130620 17:71893108-71893130 TGGTGGGGGGTGGGGGGTGGGGG + Intergenic
1151516445 17:74599209-74599231 TTGTGGTAGGTAGTTGGGGAAGG - Intergenic
1152026080 17:77810251-77810273 TGGTGGTGGTAACGGGGTGATGG + Intergenic
1152249378 17:79203535-79203557 TGGGGGTGGGTGGAGGGTGAAGG + Intronic
1152249391 17:79203573-79203595 TGGGGGTGGGTGGAGGGTGAAGG + Intronic
1152249404 17:79203611-79203633 TGGGGGTGGGTGGAGGGTGAAGG + Intronic
1152435716 17:80274793-80274815 GTGGGGTGAGTGGGGGGTGAGGG + Intronic
1152450099 17:80373242-80373264 GTGGGGGGGGTAGGGTGTGAGGG - Intronic
1152450115 17:80373273-80373295 ATGTGGTGGGGAAGGTGTGAGGG - Intronic
1153125954 18:1790470-1790492 TGTTGAGGGGTAGGGGGTGAGGG + Intergenic
1153464367 18:5372642-5372664 TTGTTGTGGGGTGGGGGAGAGGG + Intergenic
1153612245 18:6898227-6898249 TAGTGGAAGGTAGGGGGTGGAGG + Intronic
1153837056 18:8972824-8972846 TTGTGGAGGGGAGGTGGGGATGG - Intergenic
1153858827 18:9177718-9177740 GTGTGGAGGGTGGGGGATGAAGG - Intronic
1155002637 18:21702019-21702041 TTGGGGTGGGGATGGGGGGAAGG + Intronic
1155390753 18:25334066-25334088 TGGTGGTGGCAAGGGGGTGCTGG - Intronic
1156472122 18:37383934-37383956 TTGTGGCGGTGAGGGGGTGGGGG + Intronic
1156565594 18:38185490-38185512 GTGTGTTGGGGAGGGGGGGAAGG + Intergenic
1156778884 18:40826160-40826182 TGCTGGTGAGTGGGGGGTGAGGG + Intergenic
1156785705 18:40911701-40911723 CTGTGGTGGGCATGGGGAGAAGG - Intergenic
1156810054 18:41237935-41237957 CTGTTGTGGGTGGGGGATGAGGG + Intergenic
1157216959 18:45792193-45792215 TTGTGGGGGGTGGAGGGTGGGGG + Intergenic
1157450634 18:47784496-47784518 TTTTGGGGGGTGGGGGGTGGGGG + Intergenic
1157760393 18:50259456-50259478 TAGTGGGGGGTTGGGGGTGGAGG + Intronic
1158063886 18:53381555-53381577 TGGTGGTGGGGGGGGGGTGGGGG - Intronic
1158114856 18:53983877-53983899 TGGTGGTGGGTTCGGGGTGCAGG - Intergenic
1159035787 18:63275954-63275976 GTATGGTGGGAAGGGAGTGATGG + Intronic
1159200249 18:65174366-65174388 AAATGGTGGGAAGGGGGTGAGGG + Intergenic
1159813631 18:73046749-73046771 GTGTGTTGGGTAAGGGGTGCAGG - Intergenic
1159983400 18:74813465-74813487 AGGTGGTGGGTGTGGGGTGAAGG - Intronic
1160358262 18:78246939-78246961 TGCTGCTGGGGAGGGGGTGAGGG + Intergenic
1160377669 18:78426133-78426155 CTGTGGGGGGTTGGGGGGGATGG - Intergenic
1160459423 18:79026670-79026692 GTGAAATGGGTAGGGGGTGATGG - Intergenic
1160699343 19:498470-498492 TGATGGAGGGTCGGGGGTGAGGG - Intronic
1161044036 19:2124986-2125008 TTGTGGGAGGTGGGGGGTGAGGG + Intronic
1161250632 19:3278141-3278163 TGGGGGTGGGAAAGGGGTGAGGG + Intronic
1161579307 19:5071948-5071970 TTGGGGTGCGTGAGGGGTGAGGG + Intronic
1161915530 19:7225382-7225404 TGGTGGTGGGGCGGGGGTGGCGG - Intronic
1162032629 19:7924029-7924051 TGGTGGTGGGCAGGGGGAGGAGG + Intergenic
1162473935 19:10888635-10888657 TTGTGGAGGGTAGGGGGTGGGGG - Intronic
1162913175 19:13860903-13860925 CTGTGGTGGGGAGGGGATTAGGG + Intergenic
1163088311 19:14999369-14999391 TTGAGGTGGGTAGGAGTTGGGGG - Intronic
1163112812 19:15171520-15171542 TTGGGGGGGGTTGGGGGTGGAGG + Intronic
1164151468 19:22556590-22556612 TGGTGGTGGTGAGGGGGTGCGGG - Intergenic
1164458204 19:28426731-28426753 TGGTGGGGGGTGGGGGGTGAGGG - Intergenic
1165072840 19:33265470-33265492 GTGTGGGTGGTAGGGGCTGAAGG + Intergenic
1165111743 19:33506561-33506583 GTGTGGTGTGTAGGTTGTGATGG - Intronic
1165235343 19:34416329-34416351 GTGTGGTGGGGAGGTGGTGTAGG + Intronic
1165799976 19:38543505-38543527 TGGGGGCGGGTAGGGTGTGAGGG - Intronic
1165829241 19:38722396-38722418 CTGTGGTGGGGTGGGGGTGTCGG - Intronic
1165950481 19:39471543-39471565 ATTTGGTTGGTTGGGGGTGAGGG + Intronic
1166087779 19:40488246-40488268 TGGGGGTGGGTAGTGGATGAAGG + Intronic
1166111887 19:40627643-40627665 CCGTTGTGGGTAAGGGGTGAAGG + Intronic
1166163923 19:40972954-40972976 CTATGGTGGCTAGGGGCTGAGGG + Intergenic
1166409458 19:42546964-42546986 ATGTGGGGAGTAGTGGGTGAAGG + Intronic
1166428619 19:42702332-42702354 AAATGGTGGGAAGGGGGTGAGGG - Intronic
1166531117 19:43544106-43544128 CTGGGGTGGGGAAGGGGTGATGG - Intronic
1167093427 19:47360081-47360103 GGGTGGTGGGTAGGGGCTCATGG - Intronic
1167104670 19:47423342-47423364 GTGTGCTGGGAATGGGGTGAGGG + Intergenic
1167300095 19:48673099-48673121 TTGGGGTGGGAGGGGGGTGGCGG - Intergenic
1167306938 19:48714872-48714894 TCCTGGTGGGCAGGGAGTGAGGG + Exonic
1167511185 19:49896083-49896105 TTGTGGCAGGTCGGGGGAGAGGG + Intronic
1167566539 19:50261041-50261063 TGGTGATGGGGAGGGGGTGATGG - Intronic
1168302677 19:55415303-55415325 ATGTGGAGGGTAGGAGGGGAAGG - Intergenic
1168483828 19:56743751-56743773 TGTTGGTGGGTAGGCGGTGAGGG - Intergenic
1168509918 19:56966191-56966213 TAGAGGTGGGGAGGGGGTGCAGG + Intergenic
1168511819 19:56979665-56979687 TGGTGGCCGGTAGGGGGTGGTGG + Intergenic
1168590918 19:57633571-57633593 ATGTGGTGGGCAGGGGGACAAGG + Intronic
1168691308 19:58379234-58379256 TTGTGGGAGGTGGGGGCTGAGGG + Intronic
925205964 2:2006515-2006537 TGGTTATGGGTGGGGGGTGATGG - Intronic
925398235 2:3552537-3552559 GTGTGGAGGGGAGGGGGTGGAGG - Intronic
925398246 2:3552562-3552584 GTGTGGAGGGGAGGGGGTGGTGG - Intronic
925398257 2:3552587-3552609 GTGTGGAGGGGAGGGGGTGGTGG - Intronic
925408537 2:3625383-3625405 TTGTGGTGGGTGGGGGGCCATGG + Intronic
925616748 2:5750992-5751014 TAGTGGTTGGTAGGGACTGAGGG - Intergenic
925818370 2:7775405-7775427 TTGTGGGGGGAAGGAGGGGAGGG + Intergenic
925837373 2:7959431-7959453 CTGTGATGGGTGGGGGGAGAAGG - Intergenic
926561606 2:14423815-14423837 ATGTGGTGGGCAGGGGGCTAGGG - Intergenic
926881409 2:17548609-17548631 TTGGGGTGTGCAGGGGGAGAAGG - Intronic
927086424 2:19677647-19677669 GTGTGGTGGGTATGGTGTGTGGG + Intergenic
928331639 2:30361971-30361993 GTATGGTGGCTAGGGGGTGTGGG - Intergenic
928748732 2:34446654-34446676 TTAAGGTGGGTAGTGTGTGATGG - Intergenic
928826433 2:35427014-35427036 TTGTGGGAGGTAGGAGGAGAAGG + Intergenic
928890558 2:36198838-36198860 CTGTTGTGGGGTGGGGGTGACGG - Intergenic
929122910 2:38498176-38498198 TTGTGGTGGAGAGAGGGTGGAGG - Intergenic
929319849 2:40529638-40529660 TGTTGGGGGGTAGGGGGTAAGGG + Intronic
929830904 2:45345517-45345539 TTGGGGTGGGGATGGGGTGGAGG + Intergenic
930170429 2:48246224-48246246 TTGGGGTGGGCGGGGGGTAAGGG + Intergenic
930857432 2:56033736-56033758 CTGTTGTGGGTGGGGGGTGGGGG + Intergenic
930861796 2:56081934-56081956 CTGTTGGGGGTGGGGGGTGAGGG + Intergenic
931076027 2:58713194-58713216 TTGTGGTGTGTACATGGTGAGGG - Intergenic
931115452 2:59162056-59162078 CTGTGGTGGGGTGGGGGGGAGGG - Intergenic
931142984 2:59484339-59484361 TTGTGGTGGGTAGAGGAGGGAGG - Intergenic
931431099 2:62209631-62209653 TTGGTGTGTGTGGGGGGTGACGG - Intronic
931615697 2:64154635-64154657 TTGAGTTGGGGAGTGGGTGAAGG - Intergenic
931635005 2:64332963-64332985 TTGTGATGGGGTGGGGGTGATGG - Intergenic
931897925 2:66754012-66754034 CTGGGGTGGGAAGAGGGTGAGGG - Intergenic
932303049 2:70681331-70681353 GTTTGGTGGGTAGGGGGCTAAGG - Intronic
932374746 2:71226318-71226340 TAGGGGTTGGTAGGGGGTGATGG + Intronic
932400959 2:71481041-71481063 TTGAGGTGGGGAGGGGCTGGTGG + Intronic
932579586 2:72984736-72984758 TCCTGGTGGGAAGGGGCTGAAGG + Intronic
932623662 2:73282394-73282416 TTGTAATGGGAAGGGGGTGATGG - Intronic
932695036 2:73948839-73948861 TTGTGGTGGTGATGGGGTGAGGG - Intronic
933393181 2:81698254-81698276 TTGTGGATGGTAGAGGGCGAGGG + Intergenic
933413530 2:81954749-81954771 GTGTGGTGGGTGGGGAGTGAGGG + Intergenic
934044884 2:88164746-88164768 TAGTAGTGGGTAGGAGGTGGAGG + Intergenic
934061542 2:88298704-88298726 TTGGGGTGGGGAGAAGGTGAGGG + Intergenic
934780379 2:96966128-96966150 TGGTGGGGGATAGGAGGTGAGGG - Intronic
934844634 2:97655005-97655027 TTGGGGTTTGTGGGGGGTGAGGG - Intergenic
935231503 2:101101890-101101912 TGTTGGGGGGTAGGGGGTGAGGG + Intronic
935936837 2:108194697-108194719 GTGTTGTGGGCAGGAGGTGAAGG + Intergenic
935957993 2:108397849-108397871 TGGTGGTGGGGAGGAGGGGAGGG - Intergenic
935980540 2:108621845-108621867 TTGTGGTGGTTTGGGGTTGGGGG + Intronic
936133762 2:109871189-109871211 ATGTGGTGGGAAGGGGGACATGG - Intergenic
936210935 2:110500296-110500318 ATGTGGTGGGAAGGGGGACATGG + Intergenic
936435463 2:112501399-112501421 ATGTGGTGGGAAGGGGGACATGG + Intronic
936860474 2:117012241-117012263 CTGTGGTGGGGAGGGGGGAAGGG - Intergenic
937148439 2:119668299-119668321 TGTTGGTGGGTGGCGGGTGAGGG + Intergenic
937211256 2:120273206-120273228 TTTTGGTAGGCAGGGGGTTAGGG + Intronic
937318778 2:120948418-120948440 TTGCGGTGGGAAGGGGGAGGTGG + Intronic
937576563 2:123429714-123429736 TGTTGGCGGGTAGGGGGTTAGGG - Intergenic
937915685 2:127097663-127097685 TTGTCCTGGGTTGCGGGTGAGGG - Intronic
937976932 2:127588209-127588231 TTGTGCTGGGTAGATGGTGGGGG + Intronic
937977259 2:127589473-127589495 TTGTGCTGGGTAGATGGTGGGGG + Intronic
938831305 2:135052546-135052568 TTGTGGTGTGTCTGGGGTCAGGG - Intronic
939468459 2:142588263-142588285 ATGTGGTGGGTAGGGGGCTGGGG + Intergenic
939963393 2:148586140-148586162 TTGAGGTGGGGAGGTGGAGATGG + Intergenic
940938592 2:159528958-159528980 TTGTGGGGGGGTGGGGGTGGGGG + Intronic
941087986 2:161141230-161141252 TTGTGGTTGCCAGGGGCTGAGGG - Intronic
941120470 2:161523843-161523865 GATTGGAGGGTAGGGGGTGATGG + Intronic
941156389 2:161983076-161983098 TTGTGGTGCTTTGGGGTTGACGG + Intronic
941299127 2:163779137-163779159 TGGTGGTGGCCAGGGGCTGAAGG + Intergenic
941563748 2:167082092-167082114 CTGTGGTGGGTAGAGGGAGGGGG - Intronic
941668930 2:168270094-168270116 TAGTGGGGGGTTGGGGGTGAGGG + Intergenic
941840992 2:170084350-170084372 GTGTGTTTGGTAGGGGGAGAAGG + Intergenic
942039014 2:172039627-172039649 TTTTTGTGGGGTGGGGGTGATGG + Intronic
942352310 2:175065493-175065515 CTGTGGTGGCTATGGGGTTATGG + Intergenic
942461404 2:176171220-176171242 TTTGGGTGGGTATGGGATGATGG + Intronic
942684231 2:178513945-178513967 TTGTGGTCGCTAGGGGTTGCTGG + Exonic
942710173 2:178825612-178825634 TGGTGGGGGGTGGGGGGTGGGGG - Intronic
943001789 2:182336844-182336866 CTGTTGGGGGTAGGGTGTGAGGG + Intronic
943166044 2:184327764-184327786 GGGTAGGGGGTAGGGGGTGAGGG + Intergenic
943389045 2:187239540-187239562 TTATGGAGAGTAGGGGGTCAAGG + Intergenic
944894738 2:204152372-204152394 TCTGGGTGGGTAGGGGGTGGGGG - Intergenic
945467599 2:210187307-210187329 CTGTGGAGGGTAGGGGGGTAGGG + Intergenic
945498093 2:210534295-210534317 TTGTGCTGGGAAAGGGATGAAGG + Intronic
945951328 2:216041700-216041722 GTGGGGTGGGTATGGGCTGAAGG - Intronic
946072636 2:217047649-217047671 TTGCGGTGGGTGGGAGGGGAAGG - Intergenic
946527338 2:220534970-220534992 ATTTGGTGGGTAGGGGGCTAGGG - Intergenic
946626218 2:221614446-221614468 TTGAGGTGGGAATGGGGGGAGGG + Intergenic
947119868 2:226802015-226802037 TTTTGGGGGGTGGGGGGTGGAGG - Intergenic
947180664 2:227408452-227408474 TGGTGGTGGGTTGGGGGTGGGGG + Intergenic
947236379 2:227945560-227945582 TTTTGGTGGGTAAGGGGCTAGGG + Intergenic
947662787 2:231882442-231882464 TTGTGATGGGATGGGGGTGGTGG - Intergenic
947995280 2:234522382-234522404 ACGAGGTGGGTAGTGGGTGAAGG + Intergenic
948004441 2:234595720-234595742 ATTTGGTGGGTAGGGGGCCAGGG + Intergenic
948487609 2:238290827-238290849 TTGTGGTGTGTAGGTCCTGAGGG + Intergenic
948509215 2:238452088-238452110 TTCCGTGGGGTAGGGGGTGATGG + Exonic
948760845 2:240190050-240190072 GTGTGCTGGGTTGGGGGTGGAGG + Intergenic
1168778053 20:464568-464590 TGGTGGTGGGAATGGGGTGGGGG - Intergenic
1168832420 20:853902-853924 TTGTGGTGGGTTGGTAGGGAAGG - Intronic
1168923703 20:1562435-1562457 TCGTGGGGGGTTGGGGGTGGGGG - Intronic
1169040771 20:2493614-2493636 TGGTGGGGGGTGGGGGGTGGGGG - Intronic
1169114218 20:3052541-3052563 TGGTGGGGGGGTGGGGGTGATGG - Intergenic
1169172744 20:3478530-3478552 TTTCGGTGGGTAGGGGGATAGGG + Intronic
1169385056 20:5141618-5141640 TTGTATTGGGTGGGGGGTGATGG + Intronic
1169824687 20:9754331-9754353 ATTTGGTGGGTAGGGGGCCAGGG + Intronic
1169867444 20:10217347-10217369 GTGTGGTGGGGCGGGGGTGGGGG + Intergenic
1170230398 20:14040549-14040571 TTTGGGTGGGATGGGGGTGAGGG - Intronic
1170237298 20:14120901-14120923 CTGTTATGGGTGGGGGGTGAGGG + Intronic
1170685762 20:18568075-18568097 GTGTGGTTGCTAGGGGCTGAGGG + Intronic
1171127184 20:22612839-22612861 TGTTTGTGGGTAGGGAGTGAGGG + Intergenic
1171170368 20:23010509-23010531 TAGTTGTGGGGAGGGGGTTATGG + Intergenic
1171516980 20:25745945-25745967 CTGTGGTGGGGAGGGGCTGCAGG + Intergenic
1171884510 20:30642346-30642368 TGGTGGTGGATATGGGGTGGTGG - Intergenic
1172319353 20:33984229-33984251 TAGTGGAGAGTCGGGGGTGAAGG + Intergenic
1172448606 20:35006213-35006235 TGCTTGTGGGTAGGGAGTGAGGG - Intronic
1172867692 20:38112654-38112676 TTGTGGGGGGCGGGGGGTGGGGG + Intronic
1173133562 20:40417993-40418015 TTTTGGGGGGTCTGGGGTGATGG + Intergenic
1173186852 20:40846884-40846906 TTGTAGTAAGAAGGGGGTGAAGG - Intergenic
1173273616 20:41558840-41558862 TGGTGGTGGGTGGGAGGTGGGGG - Intronic
1174110861 20:48196937-48196959 TTGTGGGGGCGGGGGGGTGAGGG - Intergenic
1175018108 20:55813637-55813659 ATGGGGTGGGTTGGGGGGGAAGG - Intergenic
1175263507 20:57689229-57689251 AGGGGGTGGGTAGTGGGTGAGGG - Intronic
1175374571 20:58515354-58515376 GTGTGGTGGGGAGCGGGTGACGG - Intergenic
1175709567 20:61208516-61208538 TTGCAGTGGGTTGGGGGTGGGGG - Intergenic
1175893216 20:62324423-62324445 GTGTGGTGAGTAGGGGCTGGTGG - Exonic
1175904412 20:62372427-62372449 GTGGGGCGGGTGGGGGGTGAGGG + Intergenic
1175924084 20:62463401-62463423 GGGTGATGGGTAGGGGGAGATGG + Intergenic
1175997414 20:62817807-62817829 TGCTGGTGGGTAGGGGTGGAGGG + Intronic
1176523544 21:7846881-7846903 TTGTGGGGTGGAGGGGGGGAGGG + Intergenic
1177469827 21:21546479-21546501 TGGTGGGGGGCAGTGGGTGATGG - Intergenic
1177866630 21:26520225-26520247 TGTTGGGGGGTAGGGGTTGAGGG - Intronic
1178657564 21:34476893-34476915 TTGTGGGGTGGAGGGGGGGAGGG + Intergenic
1178690074 21:34743266-34743288 CTGTTGTGGGTAGGGGATGTGGG - Intergenic
1179299940 21:40098868-40098890 TTGTAGTGGGAGGGGGGTGGAGG - Intronic
1180112153 21:45664764-45664786 CTGTGGTGGGGTGGGGGGGAGGG - Intronic
1180853751 22:19033988-19034010 TTGGGGTGGGGGGGGGGTCAGGG + Intergenic
1181483316 22:23215000-23215022 TGGTGGTGGCCAGGGGCTGAGGG - Intronic
1182029273 22:27144739-27144761 TTGGGGTGGGGGGGGGGTGCAGG + Intergenic
1182032878 22:27173976-27173998 TTGTGGGGGAGAGGGGGAGATGG - Intergenic
1182080249 22:27523734-27523756 ATCTGGTGGGCAGGGGGTGGGGG + Intergenic
1182156583 22:28079136-28079158 TTGTGGTGGGTAGGAGGGCAAGG + Intronic
1182772116 22:32803320-32803342 TTGTGGTGAGGAGGGGGAGGAGG + Intronic
1182834322 22:33329434-33329456 TTGTGGGGGGAAGGGGGCGTTGG + Intronic
1183076045 22:35427692-35427714 TTGTGGGGGGTGGGGGGCTAGGG - Intergenic
1183414639 22:37675380-37675402 TTTTGGTGGGGAGGTGGAGAGGG + Intergenic
1183690246 22:39384166-39384188 TTTTGGTGGACAGTGGGTGAGGG - Exonic
1183709373 22:39493433-39493455 TTGGAGTGGGGATGGGGTGAGGG + Intergenic
1183874405 22:40766704-40766726 TTGTGGTGGGTGGGGGGTGCGGG + Intergenic
1183993764 22:41617872-41617894 TTGTGGAGTGTAGTGGGTGAAGG - Intronic
1184286644 22:43475653-43475675 TTGTGGTGGTGATGTGGTGATGG + Intronic
1184321235 22:43743734-43743756 CTGTGGAGGGTGAGGGGTGAAGG - Intronic
1184639994 22:45865674-45865696 CGGTGGTGGGTAGGGGGCGGTGG - Intergenic
1184661546 22:45967701-45967723 ATGTGGTGGGTGGGAGGGGAAGG + Intronic
1184799020 22:46748860-46748882 TTGGGGAGGGAAGGGGGTGAAGG - Intergenic
1184801665 22:46764306-46764328 TGGTGGTGGGTAGGAGGTCCTGG + Intronic
1185286945 22:50005796-50005818 TTCTGGGGGGTAGGGGGACAAGG - Intronic
1185369960 22:50456460-50456482 GTGCGGGGGGTGGGGGGTGAGGG - Intronic
1185371507 22:50463007-50463029 CTGTGGTGGTTATGGGGTGGTGG - Intronic
1185420076 22:50730313-50730335 GTGTGGGGGGTGGGCGGTGAAGG + Intergenic
949796861 3:7860832-7860854 TTTTGGGGGGTTGGGGGTGAGGG + Intergenic
949929062 3:9064261-9064283 TGGTGGTGGGTAGGGGGGATGGG - Intronic
949977269 3:9472410-9472432 TTATGGTGGGCAGGGTGGGATGG + Intronic
950230402 3:11271066-11271088 TTGGGGAGGGTGGGGGGTGGGGG + Intergenic
950482233 3:13251235-13251257 CTGGGGTGGGTAGGTGGTGTTGG - Intergenic
950937401 3:16853737-16853759 CTGTGGTGGGGAGGGGGAGTAGG - Intronic
951025447 3:17823857-17823879 TTGTTGTGGGATGGGGGTGGGGG + Intronic
951483487 3:23186506-23186528 TTTTGGGGGGTGGGGGGTCAGGG - Intergenic
951701191 3:25498260-25498282 GTGTGGCGGGTAGGGGGTGGGGG - Intronic
952207177 3:31191726-31191748 GTGGGGTGGGTGGGGGGTGGGGG - Intergenic
952241082 3:31532398-31532420 TGGTGGGGGGGAGGGGGAGACGG + Intergenic
952507484 3:34020530-34020552 TGTTCCTGGGTAGGGGGTGATGG - Intergenic
952832458 3:37576524-37576546 TTGAGGTGGGAAGAGAGTGAGGG + Intronic
952999756 3:38921695-38921717 TTGTGGGGTATAGGGGATGAAGG + Intronic
953073609 3:39547582-39547604 TTATGGTGGGTAAGGAGTCAGGG - Intergenic
953091413 3:39730120-39730142 CTGTTGTGGGGTGGGGGTGAGGG - Intergenic
953453632 3:43024567-43024589 CTGTGTTGGGTAGTGGGTGGGGG + Intronic
953500066 3:43424668-43424690 GTTTGGTGGGTAGGGGGCCAGGG - Intronic
953504610 3:43472419-43472441 ATATGGTGGGTAGGGGGAAAGGG + Intronic
953556444 3:43950121-43950143 TGGTGGGGGGTAGGGGGTGGTGG - Intergenic
954072658 3:48154363-48154385 TTGTGGTGGGCGGGGGGGGGGGG - Intergenic
954135606 3:48580795-48580817 CTGAGGGGGGTAAGGGGTGATGG - Intronic
954414093 3:50384545-50384567 GTGGGGTGGGCAGGGGGAGATGG - Intronic
954750348 3:52810057-52810079 TGGGGGTGGGGAGGGGGTAAGGG + Intergenic
954838185 3:53489638-53489660 TTCTGGTGGTTAGTGGGTCAGGG + Intergenic
954843542 3:53534218-53534240 GCGTGGTGGGTAGAGTGTGAGGG + Intronic
955095737 3:55796067-55796089 TTGTGGTGGTTGAGGGGGGAGGG + Intronic
955347070 3:58169310-58169332 CTTTGGTGGGTAGGGGGTGGGGG + Intronic
955782713 3:62503045-62503067 TGGTGGTGGGTGGGGGTTGCTGG - Intronic
955831585 3:63010197-63010219 TGTTGGAGGGTAAGGGGTGAGGG - Intergenic
955903289 3:63780132-63780154 TTGGGGTGGGTGGAGGGTGGAGG - Intergenic
956446812 3:69333838-69333860 TTTTGTTGGGGAGAGGGTGAGGG + Intronic
957118479 3:76058249-76058271 TGTTGGAGGGTAGGGGGTTATGG - Intronic
957548243 3:81668208-81668230 CTGTTGTGGGGTGGGGGTGAAGG + Intronic
957880178 3:86201569-86201591 GTCTGGTGGGTGGGGGGTTAGGG + Intergenic
958198098 3:90268215-90268237 GTGTGGTGGGTGGAGGGGGAAGG + Intergenic
958733914 3:97988597-97988619 TGGTGGTGGGTGGTGGGTGGTGG + Intronic
958734112 3:97989437-97989459 TGGTGGTGGGTGGTGGGTGGTGG + Intronic
960565680 3:119129153-119129175 CTGTTGTGGGGTGGGGGTGAGGG + Intronic
960640227 3:119816390-119816412 TTGTGGAGGTTAGGGGCTGCAGG - Intronic
961032051 3:123614811-123614833 TTTTGGGGGGTAGGGGGGCAGGG + Intronic
962297676 3:134206732-134206754 TTGTGGTTGGTTAGGGGTGGAGG - Intronic
962375775 3:134857583-134857605 CTGTGGTTGATTGGGGGTGAAGG + Intronic
962497476 3:135956482-135956504 GTGGTGGGGGTAGGGGGTGAGGG - Intergenic
962692489 3:137913277-137913299 TGTTGGTGGGTTGGGGGTGAGGG + Intergenic
963507833 3:146209265-146209287 TAATGATGGGAAGGGGGTGAGGG + Intronic
963693656 3:148536905-148536927 GTTTGGTGGGCAGGGGGTGCAGG + Intergenic
963748870 3:149153373-149153395 TGGTGGTGGGTATGGGATGGTGG + Intronic
963772526 3:149403037-149403059 GGGTGGAGGGTGGGGGGTGAAGG - Intergenic
964266575 3:154903627-154903649 TTGGGGGGGGTAGGGGGCTAAGG + Intergenic
964376326 3:156052131-156052153 TTGTGGGGGGCAGGGGGAGGGGG - Intronic
964645821 3:158957440-158957462 CTGTGGTGGGGTGGGGGGGAGGG - Intergenic
964877461 3:161384484-161384506 CTGTGGGGGATAGGGGCTGATGG - Intergenic
966062901 3:175781852-175781874 CTGTGGTGGGGTGGGGGGGAGGG - Intronic
966117845 3:176486316-176486338 CTGTTGGGGGTGGGGGGTGAGGG - Intergenic
966318431 3:178674763-178674785 TTGTGGTGGCCAGATGGTGATGG - Intronic
966365795 3:179185992-179186014 AGGAGGTGGGTAGGGGGTGGAGG + Intronic
966560824 3:181318103-181318125 TTGTGGTGGGGAGGGTGGGTGGG - Intergenic
967158822 3:186717840-186717862 TGGTGGTGGGTGGTGGGTGGTGG - Intronic
967158849 3:186717920-186717942 TGGTGGTGGGTGGTGGGTGGTGG - Intronic
967158861 3:186717950-186717972 GGGTGGTGGGTGGTGGGTGATGG - Intronic
967158863 3:186717957-186717979 TGGTGGTGGGTGGTGGGTGGTGG - Intronic
967158882 3:186718010-186718032 TGGTGGTGGGTGGTGGGTGATGG - Intronic
967158895 3:186718053-186718075 GGGTGGTGGGTGGTGGGTGATGG - Intronic
967158897 3:186718060-186718082 TGGTGGTGGGTGGTGGGTGGTGG - Intronic
967158929 3:186718152-186718174 TGGTGGTGGGTGGTGGGTGGCGG - Intronic
967158951 3:186718215-186718237 TGGTGGTGGGTGGTGGGTGGTGG - Intronic
967158959 3:186718235-186718257 TGGTGGTGGGTGGTGGGTGATGG - Intronic
967158968 3:186718259-186718281 TGGTGGTGGGTGGTGGGTGGTGG - Intronic
967158993 3:186718326-186718348 TGGTGGTGGGTGGTGGGTGGTGG - Intronic
967159021 3:186718401-186718423 TGGTGGTGGGTGGTGGGTGGCGG - Intronic
967748703 3:193088731-193088753 TCCTAGGGGGTAGGGGGTGAGGG - Intergenic
967919055 3:194601001-194601023 CTGTGGTGGGAGGTGGGTGAGGG + Intronic
967991343 3:195133334-195133356 TTGGGGTGGGGAGTGGGAGAGGG + Intronic
968095451 3:195926984-195927006 TTGTGGATGGTATGGGGTAAGGG + Intergenic
968120325 3:196121443-196121465 GTCTGGTGGGTAGGGGGACATGG - Intergenic
968478620 4:824455-824477 GTGGGGTGGGGAGGGGCTGAGGG - Intronic
968518242 4:1023717-1023739 GTGGGGTGAGCAGGGGGTGACGG + Exonic
969162530 4:5273836-5273858 CTGTGGTGGGTGGGGGGAGGGGG + Intronic
969632783 4:8348028-8348050 TTGTGATGGGCATGAGGTGATGG + Intergenic
969686721 4:8679601-8679623 CTGTGGTGAGTGAGGGGTGAGGG - Intergenic
969867889 4:10087199-10087221 ATGTGGTGGGCAGGGTGTGAAGG - Intronic
970494903 4:16615600-16615622 TGTTGGGGGGTGGGGGGTGAAGG + Intronic
970590567 4:17556629-17556651 TGGGGGTGGGGAGGGGGTGAAGG - Intergenic
970665969 4:18337416-18337438 TGTTGGGGAGTAGGGGGTGAGGG - Intergenic
970672083 4:18408196-18408218 ATGTGGAGGGTAAGGGATGAAGG + Intergenic
970782910 4:19760095-19760117 CTGTTGGGGGTTGGGGGTGAGGG + Intergenic
970952202 4:21770115-21770137 TGTTGGGGGTTAGGGGGTGAGGG - Intronic
971176176 4:24284642-24284664 TTGTAGAGGGTCTGGGGTGAGGG - Intergenic
971218433 4:24683180-24683202 GTTTGGTGGGCAGGGGGCGAGGG + Intergenic
971846211 4:31922148-31922170 TTGTGGTGGGGAGCAGGGGATGG - Intergenic
971920781 4:32936749-32936771 CTGTGGTGGGGAGGGGGGGAGGG - Intergenic
972385213 4:38559532-38559554 TGGTGGTGGGTGGTGGGGGAGGG - Intergenic
972651897 4:41025849-41025871 TGGTGGGGGGTAGGGGTTGGGGG + Intronic
972852864 4:43072062-43072084 TGGGGGTGGGTAGGGAGTTAGGG + Intergenic
972910102 4:43804598-43804620 TAGTGGGGAGTAGGGGGTGAGGG + Intergenic
973638226 4:52879241-52879263 TTCTGGTGGGTAGATGGTGCAGG - Intronic
973934679 4:55831773-55831795 TTGTGGTGGGGAGAAAGTGATGG - Intergenic
973941757 4:55918033-55918055 TTGTGGTTGCTAGGGGTTGGAGG - Intergenic
973948704 4:55988219-55988241 GTGTGGGGGGCGGGGGGTGAGGG + Intronic
974189080 4:58480144-58480166 GTGTGGTGGATGGGCGGTGAGGG - Intergenic
974366164 4:60952321-60952343 TTTTGGTGGCTAGGGGAAGAGGG - Intergenic
974759082 4:66251578-66251600 TTGTGGGGGGTGGGGGGTAGGGG + Intergenic
975197906 4:71547115-71547137 TTGGGGTGGGGAGGGGGTGTAGG + Intronic
975526005 4:75351257-75351279 GCCTGTTGGGTAGGGGGTGAGGG - Intergenic
975526098 4:75352308-75352330 TGTTGGGGGTTAGGGGGTGAGGG - Intergenic
976601993 4:86946448-86946470 TGGGGGTGGGTGGGGGGTGGGGG - Intronic
976798428 4:88959827-88959849 TTGTGGCGGTAAGGGGGTGAGGG + Intronic
977564622 4:98568527-98568549 TGGTGGTGGGCTGGGGGTGGGGG - Intronic
978007288 4:103632533-103632555 TGTTGGTGGGTGGGGGGTGAGGG + Intronic
978431690 4:108639717-108639739 CTTGGGTGGGTTGGGGGTGATGG + Intergenic
978701314 4:111649901-111649923 GTGTTGAGGGTAGGAGGTGAAGG + Intergenic
978955515 4:114607904-114607926 TTGTGGGCAGTAGGAGGTGATGG - Intronic
978960559 4:114672660-114672682 CTGTTGGGGGTAGAGGGTGAGGG + Intronic
978989494 4:115061610-115061632 TTGGGGTCTGTCGGGGGTGAGGG + Intronic
979061622 4:116068748-116068770 TTGTGGAGGGTAGGGGTGGTGGG - Intergenic
979282357 4:118881737-118881759 TTGTTTTGGGTAGGGCCTGAGGG + Intronic
979603064 4:122607456-122607478 TGTTGGTGGGTGGGGGGTAAAGG - Intergenic
980530137 4:134042295-134042317 TGGGGGTGGGCAGGGAGTGAAGG + Intergenic
980810299 4:137868822-137868844 AAATGGTGGGAAGGGGGTGAGGG - Intergenic
980932929 4:139198732-139198754 ATTTGGTGGGTAGGGGGTTAGGG - Intergenic
981559455 4:146031067-146031089 TTCTGGTGGGTTGGTGATGATGG - Intergenic
981954637 4:150455121-150455143 CTGTGGTGGGGTGGGGGTGGGGG - Intronic
982032707 4:151316720-151316742 TTGTGGTGGGGATGGGCTCATGG - Intronic
982064729 4:151644276-151644298 TTGTGTTGGGTGGGGGGTTTGGG - Intronic
982133323 4:152249189-152249211 TGGTAGTGGTAAGGGGGTGATGG + Intergenic
982173324 4:152682450-152682472 TGGTGGTGGGGAGGGGGCGGGGG - Intergenic
982546113 4:156735402-156735424 TTGGGGTGGGGAGGGGACGAGGG - Intergenic
982561295 4:156931036-156931058 TTGTTGGAGGTAGGGGCTGAGGG + Intronic
983205716 4:164908638-164908660 TGTTGGGGGGCAGGGGGTGATGG + Intergenic
983205896 4:164909889-164909911 TGTTGGGGGGCAGGGGGTGATGG - Intergenic
983410130 4:167385949-167385971 TTGGGGTGGGGAGGGTGTGGGGG - Intergenic
983505221 4:168546297-168546319 TTTTGGTGGGTGGGGGGTGGGGG - Intronic
983535203 4:168850277-168850299 TGGTGGGGAGTAGGGGCTGAAGG - Intronic
983593843 4:169443349-169443371 TTGTGGTGGGTGGGGGGGTTTGG - Intronic
983595054 4:169457069-169457091 TGGTGGTGGGTGGTGGGGGATGG + Intronic
984142102 4:176016053-176016075 ATGTGTTGGGTAGGGGGATATGG - Intergenic
984422374 4:179540743-179540765 TGGTGGTTGGGTGGGGGTGATGG - Intergenic
984748645 4:183250168-183250190 TTTTGGTGGTTGGGGGGTGGAGG - Intronic
985281082 4:188285895-188285917 GTGTGGTGTGTAGGGGGCAATGG + Intergenic
985379764 4:189380919-189380941 CAGGGGTGGGTAGGGGGTGGGGG + Intergenic
985813744 5:2111219-2111241 TGATGGTGGGTAGAGGGTGGCGG - Intergenic
986913180 5:12583326-12583348 GGGTGGTGGGAAGGTGGTGATGG - Intergenic
987228284 5:15866658-15866680 TGTTGGGGGGTGGGGGGTGAGGG - Intronic
987486364 5:18532409-18532431 ATTTGGTGGGTAGGGGGACAGGG + Intergenic
987858024 5:23446932-23446954 TTGTAGTGGGTAAGGTGTTAGGG - Intergenic
987921338 5:24285244-24285266 GTGGGGTGGGGAGGGGGGGAGGG - Intergenic
988005780 5:25408362-25408384 CTGTGGGGGGTAGGGGGTTAAGG - Intergenic
988060028 5:26154507-26154529 TTGTTGGGGGTAGGGAGTGAGGG + Intergenic
988067008 5:26236120-26236142 TTGTGGTGGGTGGGTGTTGTGGG + Intergenic
988647612 5:33111538-33111560 TCTTGCTGGGTAGGGAGTGATGG + Intergenic
988797676 5:34666971-34666993 TAGTGGTGGGAATGGGGTGGCGG + Intronic
989099761 5:37812912-37812934 TTGTGGTGTGTAGGTGATGCCGG + Intronic
989796930 5:45485790-45485812 ATGTGGTGTGCAGGGGGTGAAGG + Intronic
990138516 5:52676784-52676806 TGTTGGTGGGTGGGGGTTGAGGG - Intergenic
990289179 5:54331318-54331340 TGGTGGTGGGCGGGGGGTGGGGG - Intergenic
990574508 5:57111525-57111547 TTGTTGTCGGTTGTGGGTGATGG - Intergenic
990637344 5:57743649-57743671 TGGTGGTAAGTAGGGGGTAAGGG + Intergenic
990915431 5:60898087-60898109 ATGTGGTAGGTAGTGGGTAAGGG + Intronic
991016721 5:61940994-61941016 GTGTGGTAGGTAGGGGTAGAAGG - Intergenic
991078183 5:62565774-62565796 GTTGGGGGGGTAGGGGGTGAGGG - Intronic
991113777 5:62930397-62930419 TTTTGGGGGGTAGGGTGTAATGG + Intergenic
991657487 5:68918581-68918603 TTCTGGGGGGCAGGGGGTGGTGG + Intergenic
992383290 5:76259595-76259617 TTGTTGGGGGTGGGGAGTGAGGG - Intronic
992464953 5:76994741-76994763 TTGTGGAGGGTTGGGCGTGGTGG + Intergenic
992652409 5:78872660-78872682 CTGTGGTGGGGAGGGGGAGGGGG + Intronic
993117111 5:83732731-83732753 CTGTTGGGGGTAGGGGGTGAGGG - Intergenic
993622046 5:90179891-90179913 TTGGGGGGTGTGGGGGGTGAAGG + Intergenic
993906487 5:93629664-93629686 TTGTGGGGGGCAGGGTGAGAGGG - Intronic
994019828 5:95010071-95010093 TTTTGCTGGGTAGTAGGTGAGGG + Intronic
994038145 5:95226126-95226148 AAATGGTGGGAAGGGGGTGAGGG - Intronic
994190998 5:96869317-96869339 CAGTGGAGGGTAGAGGGTGATGG - Intronic
994204493 5:97018853-97018875 TTGTGATGGGTAGGGTCTGGAGG + Intronic
994340056 5:98616650-98616672 TTGTGGTTGTTAAGGGCTGAGGG - Intergenic
994616486 5:102110978-102111000 TTGTGGTGGGGGGTGGGGGAAGG - Intergenic
994757018 5:103806280-103806302 TTGTTGTTGTTATGGGGTGATGG + Intergenic
994952255 5:106479348-106479370 TGTTGGGGGGTAGGGGGAGAGGG + Intergenic
995102773 5:108334548-108334570 TTCTGGTAGGTAGAGGGTTAGGG + Intronic
995110485 5:108423000-108423022 TGTTGGAGGGTCGGGGGTGAGGG - Intergenic
995133793 5:108659039-108659061 GTGTTGTGGGTGGGGGGTCATGG - Intergenic
995254625 5:110032339-110032361 TTTTGGTGGGGTGGGGTTGAAGG + Intergenic
995475593 5:112544940-112544962 TGCTGGGGGGTAGGGGGTAAGGG + Intergenic
995508370 5:112883769-112883791 TTGTGGTGGGTGGGAGGATATGG - Intronic
995684811 5:114760765-114760787 CTGTTGTGGGGTGGGGGTGAGGG - Intergenic
995702459 5:114951686-114951708 TTGTGGTTGGTAGGTGCAGAGGG - Intergenic
995945860 5:117645007-117645029 ATGAGGTGGGTGGGGGGGGATGG - Intergenic
996399618 5:123047145-123047167 GGGAGGTGGGTAGGGGGAGATGG + Intergenic
996609178 5:125359148-125359170 CTGTGGTGGGGAGGGGGGAAGGG - Intergenic
996789426 5:127276868-127276890 GTGTGTTGGGGAAGGGGTGATGG + Intergenic
996907929 5:128622819-128622841 TTGGGGTGGGTGGGAGGAGAAGG + Intronic
997917134 5:137938641-137938663 TTCTGGGGGGTGGGGGGTGAGGG - Exonic
997975899 5:138441102-138441124 GTGGGTTGGGTAGGGGGTGAAGG - Intronic
998138850 5:139688754-139688776 TTGTGATGGGCTGGGGGTGGGGG - Intergenic
998141428 5:139701650-139701672 AGCTGGTGGGTAGGAGGTGAGGG - Intergenic
998150226 5:139752932-139752954 TTATGGGGGGTAGGGGGCGGAGG - Intergenic
998293607 5:140942536-140942558 TGGTGGGGGGTAGGGGGTTGAGG + Intronic
998550113 5:143069157-143069179 TTCTAGTAGGTAGGGAGTGAAGG - Intronic
998603620 5:143610744-143610766 GAGAGGTGGGAAGGGGGTGAGGG + Intergenic
998696316 5:144643927-144643949 TGGTGAGGGGTGGGGGGTGAGGG - Intergenic
999970037 5:156850267-156850289 GAGTGGTGGGTGGGGGGTGGTGG - Intergenic
1000112725 5:158124473-158124495 TTCTGGGGAGTAGGGGGAGAAGG + Intergenic
1000948294 5:167449342-167449364 TTATGGTGAGCAGGAGGTGAAGG + Intronic
1001172412 5:169433055-169433077 AGGGGGTGGGTAGGGGGTTAGGG - Intergenic
1001428636 5:171642254-171642276 ATGGGGTGGGTAGGAGGTCATGG + Intergenic
1001474275 5:172038861-172038883 TTGGGGTGGGGAGGGGGGAACGG + Intergenic
1001606117 5:172960905-172960927 TTGTGGGGGGTGGGGGGTGGGGG + Intronic
1001629925 5:173167561-173167583 TTCTGGTGTGTAGGGGATGTTGG + Intergenic
1001816438 5:174673202-174673224 AAATGGTGGGAAGGGGGTGAGGG - Intergenic
1002911602 6:1495119-1495141 CTGTTGGGGGTGGGGGGTGACGG - Intergenic
1003081806 6:3027377-3027399 TGGTGGTGGTTGTGGGGTGAGGG - Intergenic
1003101621 6:3180308-3180330 TTGCAGTAGGGAGGGGGTGAGGG + Intergenic
1003165054 6:3670315-3670337 TTGGGGTGGGGAGGGGGTGGGGG + Intergenic
1003556771 6:7146775-7146797 TTTTGGTGGGGAGGAGGTGGTGG + Intronic
1003596863 6:7481738-7481760 GGGTGGTGGGGAGGGGGTGGGGG + Intergenic
1003873541 6:10419095-10419117 TTGAGGTGGGAGGGGGGTGGGGG + Intronic
1005621584 6:27625416-27625438 CTGTGTAGGGCAGGGGGTGAGGG - Intergenic
1005825149 6:29627901-29627923 TTGTGGGGAGGAGGGGGCGAGGG + Intronic
1006338633 6:33433657-33433679 TTGGGGCCGGCAGGGGGTGAGGG + Intronic
1006408833 6:33860293-33860315 GTGTGGTGGGTATGGTGTGCTGG + Intergenic
1006434397 6:34018798-34018820 TAGTGCTGGGTTGGGGGTGGGGG + Intronic
1006925081 6:37649523-37649545 TTGGGGTGGGCGTGGGGTGAGGG - Intronic
1007128726 6:39449528-39449550 TTGTGGTGGGTTGGGGACAAGGG - Intronic
1007205954 6:40151206-40151228 TAGTTGTGGGTAGGGAGTGGTGG - Intergenic
1007375453 6:41453157-41453179 TTGTGGCGGGTGGTGGGTGGTGG - Intergenic
1007395492 6:41575531-41575553 GGGTTGTGGGTAGGGGGTGTAGG + Intronic
1007431765 6:41780752-41780774 TTGGGGTGGGGACCGGGTGAGGG + Exonic
1007776940 6:44229177-44229199 TTGGGGTGGGGATGGGGTCAGGG - Intronic
1007909605 6:45500588-45500610 TTTAGGTGGGGAGTGGGTGAAGG + Intronic
1008456480 6:51716815-51716837 ATGTGGTTGGAGGGGGGTGATGG - Intronic
1008648185 6:53537272-53537294 TGGGGGTGGGTAGGGGTTAACGG + Intronic
1008706943 6:54173857-54173879 TTGGGGTGGGGAGGTGGGGATGG - Intronic
1008821952 6:55643593-55643615 ATGTGGTGGGGAGTGGGGGAAGG - Intergenic
1010096422 6:72051308-72051330 TTGTGAAGGGTAGGGAGAGAAGG + Intronic
1010170754 6:72972489-72972511 TGTTGGGGGGTAGGGGGTGAGGG - Intronic
1010467088 6:76180744-76180766 TTTTGGAGGGTGGAGGGTGAAGG - Intergenic
1011575668 6:88795529-88795551 TTGTGGGGGGTTGGGGGCTAGGG + Intronic
1011653278 6:89526575-89526597 TCCTGATGGGTATGGGGTGAGGG + Intronic
1012063595 6:94517547-94517569 TGTTGGGGGGTAAGGGGTGAGGG + Intergenic
1012212584 6:96540115-96540137 TTGTGTGGGGTAGGGGATGGAGG + Intronic
1012358980 6:98352495-98352517 GTGTGGTGGGGTGGGGGTGGGGG + Intergenic
1012627730 6:101424713-101424735 CTGTTGTGGGTGGGGGGAGAGGG - Intronic
1012712188 6:102621057-102621079 AAAGGGTGGGTAGGGGGTGAGGG - Intergenic
1013345121 6:109252801-109252823 TTGTGGGGAGTTGGGGGTGGAGG - Intergenic
1013393157 6:109706930-109706952 CAGTGGTGGGTAGGGTGTCAGGG + Intronic
1013482874 6:110567226-110567248 TTTTGGTGGGTAGGGGGCTGAGG - Intergenic
1014065380 6:117118498-117118520 TTGTGGTGGTAAGGGGGAAATGG + Intergenic
1014308632 6:119771375-119771397 TTATGGTGGCCCGGGGGTGAGGG - Intergenic
1014317580 6:119886667-119886689 CTGTGGGGGGTAGGGGGTTAGGG - Intergenic
1014673359 6:124334468-124334490 ATTTGGTGGGTAGGGGGCCAGGG + Intronic
1015018409 6:128442403-128442425 TTGAGGTGGGTATGGGGTCTAGG - Intronic
1015136427 6:129877436-129877458 TGTTGGGGGTTAGGGGGTGAGGG - Intergenic
1015763315 6:136688264-136688286 TGTTGGTGGGTAGGGGGCTAGGG + Intronic
1015917606 6:138233379-138233401 TTTTGGGGGGTGGGGGGAGATGG + Intronic
1016112024 6:140236081-140236103 TGTTGGTGGGTGGGGGGTTAGGG + Intergenic
1016589715 6:145730919-145730941 TGGTGATGGGAAGGGGTTGAAGG - Intronic
1016589805 6:145731620-145731642 TGTTGGTGGGTGGGGGTTGAGGG + Intronic
1017478742 6:154827919-154827941 GTGTGGTGGGTGGGGGCTTATGG - Intronic
1017750189 6:157484137-157484159 TTCTTGAGGGTAGGGGGTGCGGG + Intronic
1017768504 6:157626571-157626593 ATGTGGAGGGGAGGGGGAGATGG - Intronic
1017837139 6:158188945-158188967 TTGCGGTGGGTAGGTGGGGGAGG - Intronic
1018513176 6:164549080-164549102 TATTGGGGGGTGGGGGGTGAGGG - Intergenic
1018647400 6:165961104-165961126 TTGTGGTGGGAGGGTGGGGATGG + Intronic
1018810455 6:167294707-167294729 GTGGGGTGGGCAGGGGGTGGTGG - Intronic
1018871964 6:167790376-167790398 TGGTGGGGGGTAGGGGAGGATGG - Intronic
1018871974 6:167790396-167790418 TTATGGGGGGTAGGGGAGGATGG - Intronic
1018871989 6:167790436-167790458 TGGTGGGGGGTAGGGGCAGATGG - Intronic
1020592914 7:10166399-10166421 CTGTGGTGGGGAGGGGGTAGGGG - Intergenic
1020938022 7:14492328-14492350 TTGTCTAGGGTGGGGGGTGATGG + Intronic
1020991214 7:15198648-15198670 ATTTGGTGGGTAGGGGGCCAGGG + Intergenic
1021000882 7:15328849-15328871 TTGTGGTTGGAAAGGGATGATGG - Intronic
1021497058 7:21287157-21287179 TTGTTGGGGGTGGGAGGTGAAGG + Intergenic
1021710143 7:23407936-23407958 TTGTGGGGGGCAGGGGGCGGGGG + Intronic
1022388909 7:29926730-29926752 TTATGGTGGGTGGTGGGTGTGGG + Intronic
1023218873 7:37897661-37897683 TGTTGGGGGGTGGGGGGTGAGGG - Intronic
1023707279 7:42954264-42954286 ATGTGGTGGGTGGGGGGTGGTGG + Intergenic
1023737551 7:43248286-43248308 TTGTGTAGAGTATGGGGTGAAGG - Intronic
1024041537 7:45559818-45559840 ATTTGGTGGGCAGGGGGTTAGGG - Intergenic
1024277925 7:47693983-47694005 TTTCGATGGGTTGGGGGTGATGG + Intergenic
1024452205 7:49560242-49560264 CTGTTGTGGGTTGGGGGGGAGGG + Intergenic
1024549944 7:50554305-50554327 CTGTGGGGGGCAGGGGGAGAGGG + Intronic
1024570556 7:50719518-50719540 CTGTCGGGGGTAGGGGGCGAGGG + Intronic
1024977526 7:55127457-55127479 GTGTGGGTGGTGGGGGGTGAGGG - Intronic
1025241964 7:57284196-57284218 ATGTGGAGGTTAGGGGGTGGGGG - Intergenic
1025521240 7:61732218-61732240 GTGGGGTGGGTGGGGGGGGAGGG + Intergenic
1025851697 7:65249784-65249806 TTCTTGTGAGTAAGGGGTGAAGG + Intergenic
1025870540 7:65428316-65428338 TAGTCGGGGGTTGGGGGTGAGGG + Intergenic
1026590762 7:71693641-71693663 TATTGGAGGGTAGGGGGTGGAGG + Intronic
1026618173 7:71926173-71926195 CTGTGGTGGTTAGGGGGTTGGGG - Intronic
1026730868 7:72910790-72910812 TTGCGGGGGTTAGGGGATGAAGG + Intronic
1027113220 7:75457379-75457401 TTGTGGGGGTTGGGGGATGAAGG - Intronic
1027219884 7:76206995-76207017 TGGTGGTGGGGAGGGAGTGCTGG - Intronic
1027285470 7:76641974-76641996 TTGTGGGGGTTGGGGGATGAAGG - Intergenic
1027689986 7:81332591-81332613 TTAAGGTGGGCAGGGGATGAGGG + Intergenic
1028421833 7:90641626-90641648 TAGTGGTGGGGAGGAGATGATGG + Intronic
1028451474 7:90989725-90989747 TTGCTGGGGGTAGTGGGTGAGGG - Intronic
1029440622 7:100584998-100585020 CTGTGGATGGTAGGGGGTGGGGG - Intronic
1030058324 7:105602528-105602550 TCCTGGTGTGTGGGGGGTGAGGG - Intergenic
1030517539 7:110557073-110557095 TTGTTGTGGGTAGGTGCAGAAGG + Intergenic
1030701033 7:112641248-112641270 TGTTGGGGGGTGGGGGGTGAAGG - Intergenic
1030816758 7:114048703-114048725 TTGTGGTGGGTGGGTGGGGGAGG - Intronic
1031180395 7:118407385-118407407 TTGTGGTTGTCAGGGGCTGAGGG + Intergenic
1031268180 7:119609387-119609409 TTGTGAGGGGTAGGGGGTAATGG + Intergenic
1031319886 7:120311716-120311738 TTTTGGAGGGTAGAGGGTGGGGG - Intronic
1032158737 7:129493227-129493249 TGGTGGTGGGGATGGGGTTAAGG + Intergenic
1032518543 7:132525074-132525096 TTGTCAGGGGCAGGGGGTGAGGG - Intronic
1032648059 7:133847706-133847728 TTGTGGTGGGGAGAGGGTGGGGG + Intronic
1032681120 7:134184632-134184654 TTGTGGTGGGTGGGGGAAGCAGG - Intronic
1032856845 7:135842125-135842147 TTCTGGTGGGTAGAGCTTGAGGG - Intergenic
1032871629 7:135991967-135991989 TAGTGGTGGGGTGGGGGTGGGGG + Intergenic
1033277912 7:139986505-139986527 GAGAGGTGGGAAGGGGGTGAGGG - Intronic
1033438372 7:141355090-141355112 CTGTGATGGGGTGGGGGTGATGG + Intronic
1033476602 7:141698951-141698973 TTGAGGTGGGTGTGGGGTGGGGG + Intronic
1034046704 7:147937033-147937055 TGGTGGTGGTGAGGGGGTGAGGG - Intronic
1034114647 7:148573584-148573606 CTGTTGGGGGTGGGGGGTGATGG - Intergenic
1034539451 7:151747018-151747040 TTGTGATGGGGCGGGGGAGAGGG + Intronic
1034720198 7:153285229-153285251 TTGGGGTGGGTTGGGGGAGGTGG + Intergenic
1035035450 7:155891426-155891448 TTGTGGTGGTGAGGTGGTGATGG + Intergenic
1035035537 7:155891795-155891817 CTGTTGTGGGGATGGGGTGATGG + Intergenic
1035785625 8:2258215-2258237 TGGTGGGGGGTGGGGGGTGGAGG - Intergenic
1035807182 8:2463501-2463523 TGGTGGGGGGTGGGGGGTGGAGG + Intergenic
1036060216 8:5308834-5308856 TAGTGGTGGCTAGGGGCTGGTGG - Intergenic
1037315498 8:17595708-17595730 CTGTGGTGGGGCGGGGGTGCTGG + Intronic
1037420228 8:18694187-18694209 GTGTGGTGGGCAGGTGTTGAAGG - Intronic
1037594053 8:20339375-20339397 TTGTGGTGGTGATGGTGTGAAGG + Intergenic
1037622504 8:20577173-20577195 TTTTCCTAGGTAGGGGGTGACGG + Intergenic
1037892292 8:22629719-22629741 GTGGGGTGGGAAGGGGGTGGTGG + Intronic
1038322366 8:26539275-26539297 TGGTGCTGGGCAGGGGGAGAGGG - Intronic
1038417494 8:27407801-27407823 TTGTGATGGGTAAGGGGGGAAGG - Intronic
1038508648 8:28109028-28109050 TTGTGCAGTGCAGGGGGTGAGGG + Intronic
1038675874 8:29622515-29622537 ATGTGGTAGGTATGGGGAGAGGG + Intergenic
1038708142 8:29915337-29915359 CTGTTGGGGGTAGGGGGTGAGGG + Intergenic
1038964942 8:32561848-32561870 TTTTGGGGGGTGGGGGGTGGAGG + Intronic
1039058677 8:33556467-33556489 GTGTGGTGGGCAGGGGGAGCAGG + Intronic
1039273950 8:35914280-35914302 TGTCGGTGGGTAGGGGGTAAGGG + Intergenic
1039446348 8:37636189-37636211 TTGGGGTGGGGTGGGAGTGAAGG + Intergenic
1039642360 8:39237692-39237714 TTGTGGTGGATTGGGGGAGGTGG - Intronic
1040484389 8:47856215-47856237 TTGTGGTGGGGGGGTGGTGGTGG + Intronic
1040553285 8:48455928-48455950 TTGTGATGGGTGGGGGGCAAGGG + Intergenic
1040628205 8:49175998-49176020 TGGTGGTGGCCATGGGGTGAGGG + Intergenic
1041723622 8:60998432-60998454 TGGTGAGGGGTAAGGGGTGAGGG + Intergenic
1042317353 8:67437918-67437940 TTCTGGGGGGTGGGGGGTGATGG + Intronic
1044344486 8:91089486-91089508 TAGGGGTGGGTGGGGGGTGGGGG - Intergenic
1044529150 8:93288613-93288635 TTGTGGTTGCCAGGGGGTGAGGG + Intergenic
1044608390 8:94067937-94067959 TTGTGGTTGCCAGGGGTTGAGGG - Intergenic
1044666612 8:94639842-94639864 ATCTGGTGGCTGGGGGGTGATGG + Intergenic
1044856982 8:96486247-96486269 CTGTGGTGAGTAGGGGTTGGGGG + Intergenic
1044945132 8:97382347-97382369 TAGAGGTGAGTAGGGGGTGGGGG - Intergenic
1045829754 8:106444681-106444703 TTGTTGGGGGTGGGGGGTGAGGG + Intronic
1045937528 8:107698041-107698063 TTTTGGTGGGAAGGGGTTCATGG + Intergenic
1046932354 8:119854586-119854608 TTTTGGGGTGTAGGGAGTGATGG - Intronic
1047049999 8:121100198-121100220 TAGTGTTGAGTATGGGGTGAGGG + Intergenic
1047105326 8:121725008-121725030 TGGTGGGAGGTGGGGGGTGAGGG - Intergenic
1047220901 8:122917359-122917381 TTGTGGTGGGTCAGGGGTTCTGG - Intronic
1047609083 8:126503530-126503552 TTGCAGTGGGTAGGAGGAGATGG - Intergenic
1048043863 8:130755206-130755228 TGTTGGAGGGTAGGAGGTGAGGG + Intergenic
1048590759 8:135818553-135818575 TGGTGGTGGGTGAGGGGTTATGG + Intergenic
1049355338 8:142184968-142184990 TTGCTGTGGGCAGAGGGTGAGGG - Intergenic
1050015592 9:1229732-1229754 CTGTGGTGGGGTGGGGGGGATGG + Intergenic
1050479981 9:6079302-6079324 TTATGGTGGCCAGAGGGTGAGGG + Intergenic
1050954970 9:11644799-11644821 GTGGGGTGGGGAGGGGGGGAGGG - Intergenic
1050982836 9:12041818-12041840 TGTTGGGGGGTTGGGGGTGAAGG + Intergenic
1051016585 9:12483372-12483394 GTGTGGTGGGTGAGGAGTGAGGG - Intergenic
1051726183 9:20089686-20089708 CAGTGGTGGGCAGGGGGTGGCGG - Intergenic
1051787958 9:20766971-20766993 CTGTGGTGGGGTGGGGGAGAGGG - Intronic
1051847983 9:21474370-21474392 GTGTGGTGGGGAGGGAGGGAAGG - Intergenic
1052295796 9:26895033-26895055 TTTTGGTGGGTAGGGGGCTGAGG - Intergenic
1053063000 9:35045836-35045858 ATTTGGTGGGTAGGGGTCGATGG - Exonic
1053607957 9:39679737-39679759 TGGTGGTGAGCAGGGGGTGGGGG - Intergenic
1053865801 9:42436097-42436119 TGGTGGTGAGCAGGGGGTGGGGG - Intergenic
1054245576 9:62662672-62662694 TGGTGGTGAGCAGGGGGTGGGGG + Intergenic
1054559702 9:66697203-66697225 TGGTGGTGAGCAGGGGGTGGGGG + Intergenic
1055139033 9:72854499-72854521 TTGTGGTGGCTAAGTGGTGGGGG + Intergenic
1055992234 9:82119325-82119347 TTGAGGTGGGGAGTGGGTCAAGG + Intergenic
1056328247 9:85500188-85500210 TTGGGGTGGGCAAGGAGTGAAGG + Intergenic
1056742260 9:89267622-89267644 TTGTGGGGGGTGGGGGGGGTTGG + Intergenic
1058148635 9:101439890-101439912 TGGTGGTTGCTAGGGGGTGGTGG - Intergenic
1058299267 9:103349730-103349752 GTGTGGTGGGGTGGGGTTGAGGG - Intergenic
1058324349 9:103677150-103677172 TTGTGGTGGGGTGGGGGCGAGGG - Intergenic
1058732361 9:107862389-107862411 TTGTGGTGTGTATGGTGTGGGGG - Intergenic
1059087880 9:111323910-111323932 TAGTGGTGGTTAGGTGGTGGTGG - Intergenic
1059245287 9:112844475-112844497 TTGAGGTGCGTAGAGTGTGAAGG + Intronic
1059282457 9:113146682-113146704 TTGTCGGGGGCAGGGGGAGAAGG + Intergenic
1059406364 9:114100117-114100139 TGGGGGTGGGGAGGAGGTGAGGG + Intergenic
1059408592 9:114117893-114117915 TGGTGGTGGCAGGGGGGTGATGG + Intergenic
1059437816 9:114287137-114287159 TTCTGGTGGGTGGAGGCTGAAGG - Intronic
1059490045 9:114659392-114659414 GTGTGGCGGGAAAGGGGTGAAGG - Intergenic
1059504521 9:114786021-114786043 ATGTGGTTGTTAGAGGGTGACGG + Exonic
1059745647 9:117198175-117198197 TGTTGGAGGGTTGGGGGTGAGGG - Intronic
1059815960 9:117915404-117915426 GTGTGGTAGGTAGAGGGAGACGG + Intergenic
1059965152 9:119606467-119606489 TGTTGTGGGGTAGGGGGTGAGGG - Intergenic
1060087558 9:120715365-120715387 GTGAGGGGGGTGGGGGGTGAGGG - Intergenic
1060099039 9:120821676-120821698 TAGTGGTTGGCAGGGGATGAGGG - Intronic
1060404317 9:123365771-123365793 TGGTGGTGGTTGGGGGGTGGGGG - Intronic
1060444794 9:123678043-123678065 TGGGGATGGGGAGGGGGTGAGGG - Intronic
1061035086 9:128108961-128108983 TTGTGGTGGGCGGGGGCTGGAGG + Exonic
1061238182 9:129353993-129354015 TTGTGGTGGGGAGGGGTTGTCGG + Intergenic
1061330041 9:129886448-129886470 TTGCGGAGGGCAGGAGGTGAGGG - Intergenic
1061682550 9:132250143-132250165 GTTTGGGGGGTAGGGGATGAGGG + Intergenic
1062106103 9:134755890-134755912 TGGTGGTGGGTTGGGGGCAAGGG + Intronic
1062117858 9:134818759-134818781 CTGTGGTGAGTAGGCTGTGAGGG + Exonic
1062543117 9:137050266-137050288 TTGTGGTGAGTAGGGGCAGGCGG - Exonic
1203406188 Un_KI270538v1:15766-15788 TTGTGGGGGGGGAGGGGTGAGGG + Intergenic
1185499363 X:585216-585238 TTACGGTGGGATGGGGGTGAGGG - Intergenic
1186135958 X:6521112-6521134 TTTTGGGGGGTAGGGGGCTAGGG - Intergenic
1186264196 X:7813963-7813985 TTTTGGTGGGTAGGGGGCTGAGG + Intergenic
1186303380 X:8226682-8226704 AAATGGTGGGAAGGGGGTGAGGG - Intergenic
1186502194 X:10060418-10060440 GTGTGTTGGGGAGGGGGTGGGGG + Intronic
1186833209 X:13411795-13411817 ATTTGGTGGGTAGGGGGCCAGGG - Intergenic
1187002989 X:15201122-15201144 TTATGTTGGGGAGGAGGTGAGGG + Intergenic
1187737143 X:22316644-22316666 TTGTGGTGAGGAGGGCGAGATGG - Intergenic
1187916968 X:24162860-24162882 TAGTGGTTGCTAGGGGATGAAGG - Intronic
1188465655 X:30477129-30477151 TTCTAGTGGGTAGGGGATGAGGG - Intergenic
1188576332 X:31655299-31655321 CTGGGAAGGGTAGGGGGTGAGGG + Intronic
1188632487 X:32382675-32382697 TAGGGGTGTGTGGGGGGTGAGGG + Intronic
1188747312 X:33862152-33862174 ATTTGGTGGGTAGGGGATTAGGG + Intergenic
1188760238 X:34018885-34018907 TTGTGGTGGATGGTGGGTAATGG + Intergenic
1189096699 X:38148146-38148168 TAGGGGTGGGAAGAGGGTGAAGG - Intronic
1189168904 X:38890001-38890023 TGTTGGGGGGTGGGGGGTGAGGG + Intergenic
1189382288 X:40510635-40510657 TTGGGGTGGGTGGGTGATGAGGG - Intergenic
1190026020 X:46923868-46923890 TTGTGGTTAGTAGGGGAGGAGGG + Intronic
1190048540 X:47132068-47132090 AGGGGGTGGGAAGGGGGTGAGGG - Intergenic
1190054103 X:47171891-47171913 TTCATGGGGGTAGGGGGTGAGGG - Intronic
1190580957 X:51893071-51893093 TGGGGGCGGGCAGGGGGTGAGGG + Intronic
1190595469 X:52049153-52049175 CTGTTGTGGGTAGGGGGAGGGGG + Intergenic
1190613355 X:52204920-52204942 CTGTTGTGGGTAGGGGGAGGGGG - Intergenic
1190942649 X:55057141-55057163 CTGTGGTGGGAAAGGGGAGAGGG + Intergenic
1191670125 X:63741014-63741036 TTGTGGGTGTTAGGGTGTGAGGG - Intronic
1191735921 X:64387664-64387686 GTGTGTGGGGTTGGGGGTGAGGG + Intronic
1192149222 X:68701632-68701654 TTGGGGTGGGGAGGGAGTGCAGG + Intronic
1192635420 X:72811692-72811714 TGTTGGGGGGTAGGGGATGAGGG - Intronic
1192646294 X:72909111-72909133 TGTTGGGGGGTAGGGGATGAGGG + Intronic
1193550463 X:82886395-82886417 GTGTGGTGGGGAGGTGGGGATGG - Intergenic
1193597660 X:83466723-83466745 TGTTGGGGGGTGGGGGGTGAGGG - Intergenic
1193624550 X:83801495-83801517 TGGTGGTTGGTAGGGGCTGAGGG - Intergenic
1193654367 X:84181862-84181884 GGGTGGAGGGTAGGGGATGAAGG - Intronic
1194556838 X:95370069-95370091 TTGTGGGGTGGGGGGGGTGAGGG - Intergenic
1194638362 X:96373210-96373232 TAGTGGTGGGGAGAGGGGGAAGG + Intergenic
1195093448 X:101485351-101485373 TGGTGGGTGGTAGGGGGTGCTGG + Intronic
1195132871 X:101871858-101871880 GGGTGGGGGGTGGGGGGTGAGGG - Intergenic
1195132874 X:101871865-101871887 TTTTGGGGGGTGGGGGGTGGGGG - Intergenic
1195174900 X:102305831-102305853 GTGGGGTGGGTGGGGGGTGCCGG + Intergenic
1195183965 X:102381262-102381284 GTGGGGTGGGTGGGGGGTGCCGG - Intronic
1195298793 X:103507033-103507055 TGTTGGGGGGTGGGGGGTGAGGG - Intronic
1195582183 X:106517706-106517728 TTGTAGGGTGTAGGGGGTGGAGG - Intergenic
1195582525 X:106523643-106523665 TTTTGGGGGGGCGGGGGTGAAGG + Intergenic
1196090251 X:111733278-111733300 AAATGGTGGGAAGGGGGTGAGGG - Intronic
1196374347 X:115016123-115016145 TCGTGGTTGGTAGGGGCTGGAGG + Intronic
1196724062 X:118880104-118880126 TAGTGGTTGGTAAGGGTTGAAGG - Intergenic
1197234301 X:124041900-124041922 TTCTGGTGGGTATGGAGTGGAGG + Intronic
1197356213 X:125439506-125439528 TTGTGGTGGGGGTGGGGTGGGGG + Intergenic
1197537088 X:127703864-127703886 TTGTGGGGGGGAGGTGGGGATGG - Intergenic
1197990336 X:132310754-132310776 TTGGGGTATGTAGGGGGTGAGGG - Intergenic
1198322158 X:135528867-135528889 TTGCGGTGGGTCGGGGGGGGGGG - Intronic
1198759640 X:140018063-140018085 CTGTAGTGGGGAGGGGGTTAAGG + Intergenic
1198779146 X:140215987-140216009 CTGTAGTGGGGAGGGGGTTAAGG - Intergenic
1199751790 X:150826564-150826586 TAGTGGTTGCTTGGGGGTGAGGG + Intronic
1199771187 X:150976249-150976271 GTCTGGTGGGGAGGGGGTGAGGG + Intergenic
1199807401 X:151314052-151314074 TGGTGGTGGGGAGGAGGTGCTGG - Intergenic
1201596083 Y:15670979-15671001 TGTTGGGGGGTAGGGGGTTAAGG - Intergenic
1202101234 Y:21310112-21310134 AAGAGGTGGGTAGGGGGAGAAGG + Intergenic
1202187111 Y:22197270-22197292 AAGAGGTGGGTAGGGGGAGAAGG + Intergenic
1202204249 Y:22389126-22389148 AAGAGGTGGGTAGGGGGAGAAGG - Intronic