ID: 1079112763

View in Genome Browser
Species Human (GRCh38)
Location 11:17614148-17614170
Sequence GAGGATGCCCATATGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079112763_1079112775 10 Left 1079112763 11:17614148-17614170 CCCACCCCCATATGGGCATCCTC 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1079112775 11:17614181-17614203 CCACCTTTGCTCCTCCCAACAGG 0: 1
1: 0
2: 1
3: 20
4: 199
1079112763_1079112777 13 Left 1079112763 11:17614148-17614170 CCCACCCCCATATGGGCATCCTC 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1079112777 11:17614184-17614206 CCTTTGCTCCTCCCAACAGGTGG 0: 1
1: 0
2: 5
3: 10
4: 163
1079112763_1079112778 14 Left 1079112763 11:17614148-17614170 CCCACCCCCATATGGGCATCCTC 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1079112778 11:17614185-17614207 CTTTGCTCCTCCCAACAGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 163
1079112763_1079112781 21 Left 1079112763 11:17614148-17614170 CCCACCCCCATATGGGCATCCTC 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1079112781 11:17614192-17614214 CCTCCCAACAGGTGGGCAAAGGG 0: 1
1: 0
2: 0
3: 12
4: 162
1079112763_1079112779 20 Left 1079112763 11:17614148-17614170 CCCACCCCCATATGGGCATCCTC 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1079112779 11:17614191-17614213 TCCTCCCAACAGGTGGGCAAAGG 0: 1
1: 0
2: 0
3: 14
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079112763 Original CRISPR GAGGATGCCCATATGGGGGT GGG (reversed) Intronic
900626838 1:3612164-3612186 GGGGATGCCCAGAAGGTGGTTGG - Intergenic
901222143 1:7589265-7589287 GAGGGTGCCCAAGTAGGGGTGGG + Intronic
901659379 1:10789053-10789075 GAGAAGGCCCAGGTGGGGGTAGG - Intronic
902396982 1:16137774-16137796 GAGGACGGCCATCTGGGGCTCGG - Intronic
902583212 1:17422501-17422523 TAGGAGGCCCATCTGGGAGTAGG - Intronic
903769745 1:25756414-25756436 GAGGGTGAGCATGTGGGGGTGGG + Intronic
905396285 1:37668776-37668798 GAGGAAGCCCACATGGGGATGGG + Intergenic
905898668 1:41566307-41566329 GAGGATGCTGGTTTGGGGGTGGG - Intronic
905913693 1:41670970-41670992 GAGGATGCCTGAATGGAGGTGGG + Intronic
915524690 1:156468400-156468422 GAGGATGAGAATATGGGGGATGG + Intronic
916848380 1:168676834-168676856 AAGAATGACCATATGGGAGTTGG + Intergenic
922610627 1:226924453-226924475 GGGGAAGCCCATAGGGGGGTTGG - Intronic
922770995 1:228182815-228182837 TTGGATGCCCAGCTGGGGGTAGG + Intergenic
1064168644 10:13008382-13008404 GAGGATGTCCATGTTGGGGAAGG + Intronic
1065585317 10:27211944-27211966 GAGGATGTACAAGTGGGGGTGGG + Intronic
1070532659 10:77350712-77350734 GACCATCCTCATATGGGGGTGGG + Intronic
1074033367 10:109711988-109712010 GAGGAAGCCTTTATGGGGGATGG - Intergenic
1075311384 10:121416878-121416900 GAGGTTGGCCATCTGGAGGTTGG + Intergenic
1076208360 10:128621586-128621608 GGGGATGACCATATCTGGGTTGG - Intergenic
1076790997 10:132776712-132776734 CAACATGCCCATTTGGGGGTGGG + Intronic
1076812707 10:132897622-132897644 CAGGATGGCCATGTGTGGGTTGG + Intronic
1077295363 11:1823896-1823918 GAGGGTGCCCAGAGGAGGGTGGG + Intergenic
1078350992 11:10593394-10593416 GAGGGTGACCAAATGGGGGCAGG - Intronic
1078877784 11:15415438-15415460 GAAGATGCCAATATGGGAGAAGG - Intergenic
1079112763 11:17614148-17614170 GAGGATGCCCATATGGGGGTGGG - Intronic
1079585991 11:22127524-22127546 GAGAATGCGCACCTGGGGGTAGG + Intergenic
1084344969 11:68540709-68540731 GAGAATGCGCACCTGGGGGTAGG - Intronic
1086506619 11:87511502-87511524 GGTCATACCCATATGGGGGTGGG - Intergenic
1089253997 11:117184233-117184255 GAGGATGCAGATATGCTGGTGGG + Intronic
1092027913 12:5258506-5258528 GAGGATGCCTACATTGGGGAGGG - Intergenic
1094864950 12:34521622-34521644 GAGAATGCACACCTGGGGGTGGG + Intergenic
1094865941 12:34530197-34530219 GAGAATGCACACCTGGGGGTGGG + Intergenic
1096198577 12:49664925-49664947 GTGGAGGCCCAGGTGGGGGTGGG - Intronic
1097941793 12:65316937-65316959 GAGGATGAGAAGATGGGGGTAGG + Intronic
1099672479 12:85712197-85712219 GAGGATGGACATATGGGTGGAGG - Intergenic
1103239249 12:119399284-119399306 GAGGATGCCCATCTGGGTCCTGG - Intronic
1107869772 13:44735745-44735767 GAGGATGCCCCTCCTGGGGTTGG + Intergenic
1107977476 13:45704104-45704126 GAGGATGCCAACCTAGGGGTGGG + Intronic
1109453585 13:62551845-62551867 TAGGATTCCCATAATGGGGTGGG + Intergenic
1109546021 13:63839656-63839678 AAGGCTGCCCATTTTGGGGTGGG + Intergenic
1113131025 13:107037185-107037207 GTGGGTGTCCACATGGGGGTTGG - Intergenic
1114545103 14:23494198-23494220 GAGGATGCGCACATGTGGGGTGG - Intronic
1117382032 14:55174135-55174157 GAGAATGCGCACCTGGGGGTGGG + Intronic
1120915596 14:89707251-89707273 GTGGATCCCCATGTGTGGGTTGG + Intergenic
1124356030 15:28995343-28995365 GAGGGTGTGCATATGGGGGTGGG - Intronic
1126143027 15:45452960-45452982 GAGAATGCGCACCTGGGGGTGGG - Intergenic
1128313929 15:66648180-66648202 GAGAATGCCCATCCTGGGGTGGG - Intronic
1130842637 15:87715833-87715855 GAAGATGCCCATAGCTGGGTAGG - Intergenic
1132166516 15:99597255-99597277 GAGAATGCGCACCTGGGGGTGGG + Intronic
1132988851 16:2782844-2782866 GAGGCTGCCCTTTTGGGGGTGGG + Intergenic
1138560168 16:57796508-57796530 CAGGGTGGCAATATGGGGGTTGG + Intronic
1139506519 16:67400650-67400672 CAGTATTCCCATATAGGGGTGGG - Intronic
1139693604 16:68657046-68657068 GAGGATGCCCAGATTTGGCTGGG - Intronic
1140482014 16:75266943-75266965 GTGGGTGCCCATGTGGGGGGCGG + Intronic
1147228821 17:39002410-39002432 GAGTGTGCCAAGATGGGGGTGGG - Intergenic
1148324393 17:46774727-46774749 AAGAATGACCTTATGGGGGTGGG + Intronic
1149659784 17:58328177-58328199 GAGGGTGTCCCTGTGGGGGTAGG + Intronic
1149990692 17:61381902-61381924 GAGGATGACCAGTTGGGGATAGG - Intronic
1150226898 17:63529291-63529313 GAGGATGGCCCTGTGGGGGCAGG - Intronic
1151544511 17:74784579-74784601 GATGATGCCAAAATAGGGGTGGG + Intronic
1152309007 17:79537874-79537896 GAGGATGAGCTGATGGGGGTGGG + Intergenic
1152413438 17:80143254-80143276 GAGGATACAGATATGGGGGGAGG - Intronic
1155522640 18:26684530-26684552 GGGGAAGCCCATCTGGGGGAAGG + Intergenic
1156190228 18:34710537-34710559 TCGGGTGCCCATGTGGGGGTGGG - Intronic
1158916525 18:62137071-62137093 GATGATGCCCACTTGAGGGTGGG - Intronic
1159923379 18:74246702-74246724 GAGGATGGGGAGATGGGGGTGGG - Intergenic
1165665400 19:37623233-37623255 GAGAATGCACACCTGGGGGTGGG + Intronic
1168311484 19:55463221-55463243 GTGGATGCCCAGATGGGGCTAGG + Intergenic
930161963 2:48167459-48167481 GAGAATGCACACCTGGGGGTGGG - Intergenic
931635469 2:64337448-64337470 GGGGATTCACATATGGGGTTGGG - Intergenic
936650704 2:114422869-114422891 GAAGATGCCTGTAAGGGGGTGGG + Intergenic
937335302 2:121058792-121058814 AAGGCTGCCCATAGGGGTGTCGG - Intergenic
937343230 2:121105102-121105124 GAGGAGGCCCACAGTGGGGTGGG + Intergenic
941111946 2:161425959-161425981 CAGGCTGCCCATATTGGAGTGGG - Intronic
946358716 2:219206304-219206326 CAGTATGCTCATATAGGGGTTGG + Intronic
947589316 2:231376383-231376405 GAGAATGCACACCTGGGGGTGGG + Intergenic
949027600 2:241773797-241773819 GAGGATCCCCCTCTGGGGGTGGG - Intergenic
1169280722 20:4264667-4264689 GAGAATGCACACCTGGGGGTGGG - Intergenic
1172055640 20:32152521-32152543 GAAGATGCAGAGATGGGGGTGGG - Intronic
1173478768 20:43382948-43382970 CAGGATGCTCATTTGGGAGTGGG - Intergenic
1176365379 21:6029706-6029728 GAGGAGGCCCCTCTGGAGGTAGG - Intergenic
1177778315 21:25594772-25594794 GAGGATGTCCAAATGGGTCTTGG - Intronic
1179717792 21:43298718-43298740 GAGGGTGCACATGTGGGTGTAGG - Intergenic
1179758139 21:43508839-43508861 GAGGAGGCCCCTCTGGAGGTAGG + Intergenic
1182067624 22:27441953-27441975 GAAGACGCCCAGGTGGGGGTGGG + Intergenic
1182130288 22:27845438-27845460 CAGAAAGCCCATGTGGGGGTGGG - Intergenic
1184439942 22:44504289-44504311 GAGTATGGCAATATGGGGGTGGG - Intergenic
949360246 3:3224081-3224103 GAGGCTGCCCACATAGGGGAGGG - Intergenic
954980957 3:54744875-54744897 GAGGATCCCCATGTTGGGGGAGG + Intronic
958271206 3:91501889-91501911 GAGAATGCCCGCCTGGGGGTAGG + Intergenic
959086097 3:101852084-101852106 GTTGAGCCCCATATGGGGGTTGG + Exonic
960308472 3:116091113-116091135 GAGAATGCGCACCTGGGGGTAGG - Intronic
962610920 3:137075567-137075589 GAGGATGGTTATTTGGGGGTTGG - Intergenic
967567138 3:190986568-190986590 GAGAATGCGCACCTGGGGGTGGG + Intergenic
967983483 3:195079059-195079081 GAGGCTGACCATCTGGGGGCAGG - Intronic
968807921 4:2787301-2787323 GGGGAAGCCCATGTGGGGCTTGG - Intergenic
969301414 4:6299462-6299484 GAGGGTGCACGTGTGGGGGTGGG + Intronic
969709560 4:8834922-8834944 GAGACTGCCCTGATGGGGGTGGG - Intergenic
971310967 4:25525485-25525507 AGGGATGGCCATATGAGGGTTGG - Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
977250977 4:94688486-94688508 TTGGTTGCCCATATGGGGGGGGG + Intergenic
977698055 4:99989328-99989350 GAAGATGCCCTTATGGAGTTGGG + Intergenic
979195880 4:117919680-117919702 GAGAATGCGCACCTGGGGGTGGG + Intergenic
979450588 4:120865883-120865905 GAGGAAGCTCTGATGGGGGTGGG - Intronic
979612162 4:122700673-122700695 GAGGATGTCCAAATTGGTGTTGG + Intergenic
980313203 4:131162358-131162380 GAGAATGCGCACCTGGGGGTGGG - Intergenic
984661936 4:182383629-182383651 GAGGATTCCAAAATGGGGGGAGG - Intronic
984833993 4:184002101-184002123 CAGGATCTCCATTTGGGGGTGGG - Intronic
988941679 5:36153505-36153527 GGAGAAGCCAATATGGGGGTGGG - Intronic
988962663 5:36385302-36385324 GGAGATGCTCACATGGGGGTGGG + Intergenic
995098914 5:108274304-108274326 GAGAATGCGCACCTGGGGGTAGG - Intronic
995803896 5:116029684-116029706 GAGGATGCCCATATGTTGGAAGG + Intronic
998259844 5:140621756-140621778 GAGAATGCACACCTGGGGGTGGG + Intergenic
999043798 5:148445742-148445764 GAGGAGGCCCATATAAGGGTGGG + Intergenic
999626967 5:153531209-153531231 AAGGAAGCCCACATGGGGGTTGG + Intronic
1000221814 5:159221785-159221807 GAGCATGCCCCTCTGGGAGTGGG - Intergenic
1002788166 6:419423-419445 GGAGATCCCCACATGGGGGTGGG - Intergenic
1002949976 6:1800109-1800131 GATGATGCCCATATGGTGGTTGG + Intronic
1003026303 6:2558535-2558557 GAGGATGCTCACAGGGGTGTGGG - Intergenic
1006456915 6:34137175-34137197 GAAGAGGCCCGTCTGGGGGTGGG - Intronic
1007028201 6:38599801-38599823 GAGGGTGGGCATATGGTGGTAGG - Intronic
1007159179 6:39775092-39775114 GGGGATACCCATAAGGGAGTGGG + Intergenic
1008359831 6:50603013-50603035 GAGGATGGTTATTTGGGGGTCGG - Intergenic
1008908179 6:56703643-56703665 GAGGATGAGGATAAGGGGGTAGG - Intronic
1011412327 6:87078773-87078795 GTGGATGTCCATATGGGGCTTGG + Intergenic
1012169587 6:96002137-96002159 GAGGAGGCTCATATGAGGCTAGG - Intergenic
1012803941 6:103870798-103870820 GAGGAGGCTCACATGGGGTTGGG - Intergenic
1020412107 7:7903754-7903776 GATGATGCACATATGAGTGTTGG - Intronic
1021572918 7:22083408-22083430 CAGGATTTCCGTATGGGGGTGGG - Intergenic
1022474801 7:30702743-30702765 AAGGATGCCCTTAGGGGGTTGGG - Intronic
1023016854 7:35976990-35977012 GAGAATGCGCACCTGGGGGTAGG - Intergenic
1024375726 7:48636273-48636295 GGGGATGCCTATATGGGAGGCGG - Intronic
1027744481 7:82056350-82056372 GAGGATGGACCTATGGAGGTAGG + Intronic
1028787062 7:94807426-94807448 GAGAATGCGCACCTGGGGGTGGG - Intergenic
1030489481 7:110213961-110213983 GAGAATGCCCACCTGAGGGTAGG + Intergenic
1035545590 8:479891-479913 GAGGATGGCCACCTGGGGGATGG + Intergenic
1036756616 8:11475410-11475432 GAGAAGGCCCAGCTGGGGGTGGG - Intergenic
1038492764 8:27982282-27982304 GAGGAGGCCGATCTGGGAGTGGG - Intronic
1039277896 8:35953151-35953173 GAGGATGGGCATATGGTGGAAGG + Intergenic
1039744610 8:40413071-40413093 GAGGGTGGCCAGACGGGGGTTGG - Intergenic
1041264748 8:56053245-56053267 AAGGGTGCCTATATGGGGGAAGG + Intergenic
1042930437 8:74008080-74008102 GGGGATGTCAATATGGGTGTTGG - Intronic
1044386945 8:91600294-91600316 GAAGATGCCAATACTGGGGTGGG + Intergenic
1044721956 8:95159707-95159729 GAGGATGTCCATGTGGGAGAGGG - Intergenic
1045902981 8:107307317-107307339 ATGAATGCCCATCTGGGGGTTGG - Intronic
1047297154 8:123581260-123581282 GGGGATTCCCATAGGGTGGTTGG + Intergenic
1048831675 8:138483513-138483535 GAGGCTGCCCAGATGAAGGTGGG + Intronic
1055781512 9:79826278-79826300 GAGGATGCTCATAATGGGGGAGG + Intergenic
1056201621 9:84282522-84282544 TAGGATGCCCAGTTGGAGGTAGG + Intronic
1056470354 9:86899674-86899696 GAGAATGCGCACCTGGGGGTGGG - Intergenic
1057582942 9:96303580-96303602 GAAGATGTCCTTCTGGGGGTGGG + Intergenic
1058002992 9:99885535-99885557 GTGGATGTCTATCTGGGGGTCGG - Intergenic
1058928610 9:109695411-109695433 GAGCATGCTTATATGGTGGTGGG - Intronic
1059455909 9:114400048-114400070 CATGATGCCAATGTGGGGGTTGG - Intergenic
1061366605 9:130175268-130175290 AAGGAAGCCCATCTGGGGGCGGG - Intronic
1062187132 9:135224104-135224126 CAGGGTGCCCATAGGCGGGTGGG - Intergenic
1062612201 9:137380346-137380368 GGGGATGCCCGGACGGGGGTTGG - Intronic
1062612250 9:137380454-137380476 GGGGATGCCCGGAGGGGGGTTGG - Intronic
1062612278 9:137380507-137380529 GGGGACGCCCAGAGGGGGGTTGG - Intronic
1062612345 9:137380654-137380676 GGGGATGCCCAGAGGGGGGTTGG - Intronic
1189223571 X:39393984-39394006 GGGGATGCTTGTATGGGGGTGGG + Intergenic
1191943118 X:66501082-66501104 AAGAATGCCCATATGGAGCTTGG + Intergenic
1192077623 X:68016566-68016588 GAGAATGCACACCTGGGGGTGGG + Intergenic
1196782015 X:119392149-119392171 GTGGTTGCCCAGGTGGGGGTTGG + Intergenic
1196821413 X:119704032-119704054 GATGATGCCCACATTGGGGAAGG + Intergenic
1197019017 X:121663914-121663936 AAGGATGCACATATGGGCTTTGG - Intergenic