ID: 1079116700

View in Genome Browser
Species Human (GRCh38)
Location 11:17644781-17644803
Sequence CTGTCTTGTCAGAGACACAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 154}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079116700_1079116709 18 Left 1079116700 11:17644781-17644803 CCGATGTGTCTCTGACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1079116709 11:17644822-17644844 ATATAAGCAAGGGAGGGGTCAGG 0: 1
1: 0
2: 0
3: 16
4: 155
1079116700_1079116710 19 Left 1079116700 11:17644781-17644803 CCGATGTGTCTCTGACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1079116710 11:17644823-17644845 TATAAGCAAGGGAGGGGTCAGGG 0: 1
1: 0
2: 0
3: 16
4: 185
1079116700_1079116708 13 Left 1079116700 11:17644781-17644803 CCGATGTGTCTCTGACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1079116708 11:17644817-17644839 GACAAATATAAGCAAGGGAGGGG 0: 1
1: 0
2: 0
3: 24
4: 296
1079116700_1079116712 23 Left 1079116700 11:17644781-17644803 CCGATGTGTCTCTGACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1079116712 11:17644827-17644849 AGCAAGGGAGGGGTCAGGGAGGG 0: 1
1: 0
2: 9
3: 146
4: 1326
1079116700_1079116707 12 Left 1079116700 11:17644781-17644803 CCGATGTGTCTCTGACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1079116707 11:17644816-17644838 CGACAAATATAAGCAAGGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 182
1079116700_1079116713 26 Left 1079116700 11:17644781-17644803 CCGATGTGTCTCTGACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1079116713 11:17644830-17644852 AAGGGAGGGGTCAGGGAGGGAGG 0: 1
1: 1
2: 24
3: 380
4: 3170
1079116700_1079116702 7 Left 1079116700 11:17644781-17644803 CCGATGTGTCTCTGACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1079116702 11:17644811-17644833 CCCCTCGACAAATATAAGCAAGG 0: 1
1: 0
2: 0
3: 1
4: 53
1079116700_1079116706 11 Left 1079116700 11:17644781-17644803 CCGATGTGTCTCTGACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1079116706 11:17644815-17644837 TCGACAAATATAAGCAAGGGAGG 0: 1
1: 0
2: 2
3: 28
4: 131
1079116700_1079116711 22 Left 1079116700 11:17644781-17644803 CCGATGTGTCTCTGACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1079116711 11:17644826-17644848 AAGCAAGGGAGGGGTCAGGGAGG 0: 1
1: 0
2: 3
3: 107
4: 891
1079116700_1079116704 8 Left 1079116700 11:17644781-17644803 CCGATGTGTCTCTGACAAGACAG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1079116704 11:17644812-17644834 CCCTCGACAAATATAAGCAAGGG 0: 1
1: 0
2: 0
3: 8
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079116700 Original CRISPR CTGTCTTGTCAGAGACACAT CGG (reversed) Intronic
902167144 1:14581719-14581741 CTGACTTGTCTGAGAAACAGTGG - Intergenic
902201414 1:14836331-14836353 CTGTCAGGTAAGAGACACAGAGG - Intronic
902810820 1:18886797-18886819 CTTTGTGGTCAGAGAGACATGGG + Intronic
904345720 1:29867587-29867609 CTGTCTTCTGAGACACAGATGGG + Intergenic
905413757 1:37790858-37790880 CGGTCTTGTCAGAGATTGATAGG + Intergenic
905693469 1:39958898-39958920 CTGTCTTGTCACAGGCAGAAGGG + Intronic
906309925 1:44746515-44746537 CTGTCTGGTGAGAGTCAAATGGG - Intronic
907017419 1:51030645-51030667 CAGTCTTGTCAGAGATAAAATGG + Intergenic
913082439 1:115401086-115401108 CTGTTTTGTCAGAGTGCCATAGG + Intergenic
915006369 1:152640964-152640986 CAGACTAGACAGAGACACATAGG + Intergenic
916276111 1:162995098-162995120 CTGAGTTATCAGAGACACACAGG - Intergenic
916606895 1:166351884-166351906 CTTTCTTGGCAGAGACAGAGGGG - Intergenic
919682591 1:200450960-200450982 CTGTCTTTTCAAATATACATTGG - Intergenic
919894818 1:202002983-202003005 CTGTGTTGTCAGAGCCAAGTTGG - Intronic
920246606 1:204592454-204592476 CTGTCTTGTCAGCAACAGAGCGG + Intergenic
920853632 1:209646323-209646345 CTTGCTTCTCAGAGACAGATGGG - Intronic
921835055 1:219769964-219769986 CTGTCATCCCAGAGACTCATTGG - Intronic
922572289 1:226641277-226641299 CTTTCCTGCCAGATACACATAGG + Intronic
922829433 1:228544140-228544162 CTGTAATGACAAAGACACATGGG - Intergenic
924570023 1:245229284-245229306 ATATCCTGTCAGAGACACATGGG - Intronic
1068241538 10:54307862-54307884 GTGTTTACTCAGAGACACATGGG - Intronic
1068564282 10:58554350-58554372 CTGTCTTGTAAGACAAAAATGGG + Intronic
1070553518 10:77510598-77510620 GGGTCTTGCCAGAGAAACATAGG - Intronic
1074501092 10:114025426-114025448 CTGTCTTGTCAAAGAGAATTAGG - Intergenic
1075743968 10:124713340-124713362 CTGTGGTGTCAGAGACAGAGTGG - Intronic
1077980604 11:7296191-7296213 TTGTCTTGTCAAAGTAACATTGG - Intronic
1079116700 11:17644781-17644803 CTGTCTTGTCAGAGACACATCGG - Intronic
1079202462 11:18387306-18387328 CTGTCATCTGAGAGACAGATGGG + Intergenic
1079347189 11:19663127-19663149 CTGTCTTGTGTGAGAGATATTGG - Intronic
1080986172 11:37468889-37468911 CTGGCTTATCAGACACATATGGG + Intergenic
1082233001 11:49792071-49792093 CTTTCTTGTGAGAGACACAACGG + Intergenic
1083371868 11:62188884-62188906 CTGTGTCATCAGAGACACCTTGG - Intergenic
1085556467 11:77427185-77427207 CTGTCTCTGCAGAGACACTTAGG - Intronic
1085791691 11:79502208-79502230 CTGTCAAGTCAGAGAAACCTGGG + Intergenic
1088625876 11:111730146-111730168 CTGTCTTTTCAGAGGCAAAGTGG + Exonic
1090465823 11:126932179-126932201 CTTTCTTGTCGGAGACAAACAGG - Intronic
1090475880 11:127019451-127019473 CTATGTTGTCAGACACACAAAGG + Intergenic
1096024450 12:48349532-48349554 CTCTTTTGTCAAAGACAAATAGG - Intronic
1096458784 12:51810157-51810179 CTGTCTCCTCAGTAACACATGGG + Exonic
1098219450 12:68253112-68253134 CTGTTTTTTCAGAGACTCTTTGG - Intronic
1101328127 12:103734904-103734926 CTGTGATGGCAGAGACAGATTGG - Intronic
1103904316 12:124319784-124319806 CTGTGTTATCAGAGACCCAGAGG + Intergenic
1104908547 12:132228452-132228474 CTGTCTTGCCAGAGGCAAAGAGG - Intronic
1106854420 13:33833453-33833475 CTCTTCTGTCAGAGAAACATGGG - Intronic
1108502595 13:51081742-51081764 GTGTCCTGTTAGAGACACTTTGG + Intergenic
1112418747 13:99228192-99228214 CAGTCCTGTCAGAGTCACAAAGG + Intronic
1118998636 14:70860748-70860770 CTGTCTTGTGATATACTCATTGG + Intergenic
1120222126 14:81746603-81746625 CTTTCTTCTCAGAGAGACTTGGG - Intergenic
1124553747 15:30707275-30707297 CAGGCTTGTCAGTGCCACATGGG + Intronic
1124677501 15:31698399-31698421 CAGGCTTGTCAGTGCCACATGGG - Intronic
1128458290 15:67845672-67845694 CAGTATTGTCAGACACCCATTGG + Intergenic
1130077874 15:80705248-80705270 CTCTTATGTCAGAGTCACATGGG + Intronic
1130161964 15:81410512-81410534 CTCTCTTGTCAGCAACACAAAGG - Intergenic
1131467158 15:92664764-92664786 CTGGCTGCTCAGAGACACAGAGG - Intronic
1131870419 15:96758004-96758026 CTTGCTTGACAGAGACTCATTGG - Intergenic
1134426622 16:14154839-14154861 CTGTCATGTCAGAGAGACCCAGG - Intronic
1136866046 16:33755469-33755491 CTGTCTTGTCAGACTCATATTGG + Intergenic
1137605243 16:49782788-49782810 TTGTCTAGTCAGAGTCTCATTGG - Intronic
1139101508 16:63772768-63772790 CAGTCTTGTCCTTGACACATAGG - Intergenic
1203106108 16_KI270728v1_random:1360634-1360656 CTGTCTTGTCAGACTCATATTGG - Intergenic
1203127406 16_KI270728v1_random:1601734-1601756 CTGTCTTGTCAGACTCATATTGG + Intergenic
1147502688 17:40980740-40980762 CTGACTTATCAGTGACACAACGG + Intronic
1148138810 17:45313536-45313558 CTGTCAGGTCAGAGAGACCTGGG - Intronic
1149505273 17:57189044-57189066 CTGCCTTGTGAGGGCCACATGGG + Intergenic
1154077015 18:11213272-11213294 CTGTCTTCTCAGCCACAAATGGG - Intergenic
1155805346 18:30163851-30163873 CTCTCTTGTTATAGACATATAGG + Intergenic
1160277454 18:77451062-77451084 CTATATGGTCAGAGACACATGGG + Intergenic
1162840022 19:13349467-13349489 CTGGCTTTTCTGAGCCACATGGG + Intronic
1163148818 19:15399436-15399458 CTGTCCTGGCAGAGCCAAATTGG - Intronic
1163629832 19:18412638-18412660 GTGTCGTGTGAGAGACCCATAGG - Intergenic
1165279872 19:34786691-34786713 CTGCCTTGTCAGTAAGACATTGG - Intergenic
1165888984 19:39099269-39099291 CTGTCCCTTCAGAGACACACTGG - Intronic
1166691245 19:44822352-44822374 CTGTCTTGCCAGAGCCCCAGAGG + Intergenic
1168721997 19:58559268-58559290 CTGCCTTGTCTGTGACCCATAGG - Intergenic
925000090 2:398373-398395 CTGACGTGTCGGAGACACAAAGG + Intergenic
927968960 2:27292003-27292025 CTGTCTTGGGAGAGAGAAATCGG - Intronic
930467783 2:51776104-51776126 CTGTCTTTTCAGGGTCAAATTGG - Intergenic
934952638 2:98588521-98588543 CTGTCTTTTCAAAGATAAATTGG - Exonic
935815273 2:106841660-106841682 CTGTCTTGCCAGAGATACCCAGG - Intronic
935821041 2:106892934-106892956 CTGTGTTGGCAGAGACTCAAAGG - Intergenic
936101999 2:109590318-109590340 ATCTCTTCTCAGAGACACCTAGG - Intronic
938041277 2:128078181-128078203 CTGTCTTGGGAGAGATACTTGGG + Intergenic
938649685 2:133369913-133369935 CTGCCCTGTCAGAGACACCTTGG + Intronic
938883924 2:135623977-135623999 CTGTCTATACAGAGAGACATGGG + Intronic
948170026 2:235893730-235893752 CTGTCATGTGAGTGGCACATAGG + Intronic
948605665 2:239133166-239133188 CTGTCTAAACAGAGACACATGGG + Intronic
948816092 2:240511061-240511083 CTGTCTGGTCAGAGCCTCCTTGG - Intronic
1169180109 20:3556884-3556906 AGAGCTTGTCAGAGACACATAGG - Intronic
1171522696 20:25787655-25787677 CTGTCTGGTCAGAGGAACTTGGG + Intronic
1171530441 20:25849624-25849646 CTGTCTGGTCAGAGGAACTTGGG + Intronic
1171554131 20:26068228-26068250 CTGTCTGGTCAGAGGAACTTGGG - Intergenic
1172202687 20:33138066-33138088 CTGTTGGGACAGAGACACATAGG - Intergenic
1172232366 20:33345550-33345572 CTGACTTTTCAGACAGACATTGG + Intergenic
1172792798 20:37517811-37517833 CTGTCTTGTCTGAACCACCTCGG + Exonic
1175193413 20:57226152-57226174 CTGTCTTGCCTGAGATCCATGGG - Intronic
1175492569 20:59389151-59389173 CTGTCTTGTGGGAGACTCCTGGG - Intergenic
1178306318 21:31493685-31493707 CTGGCTTGGCAGTGACACGTCGG + Intronic
1183230560 22:36579439-36579461 CTGTCTTGTCAAATACATATAGG + Intronic
1184746444 22:46458790-46458812 CTGGGTTGTCACAGATACATGGG + Intronic
1185236018 22:49713509-49713531 CTGTGTTATCAAAGACACCTTGG + Intergenic
952653253 3:35751738-35751760 CTCTCTTGTCAGAGCCAGAGAGG + Intronic
953572763 3:44084734-44084756 ATGTTTTGTCAGAGACACCTTGG + Intergenic
954907794 3:54077491-54077513 CTGTTTCCTCAGGGACACATTGG + Intergenic
955531850 3:59881367-59881389 ATGTCTTTTAAGAGACACAAAGG + Intronic
956857343 3:73288128-73288150 CTGTTTTGGCAAAGTCACATGGG + Intergenic
956921797 3:73937792-73937814 CCGTCTTCTCTGAGACACAAGGG - Intergenic
957289240 3:78256983-78257005 TTGTGTTGTCAGACACACCTAGG + Intergenic
957333425 3:78795567-78795589 CTTTCTTGTGAGAGGCACAACGG + Intronic
958762746 3:98328475-98328497 TAATCTTGTCTGAGACACATTGG + Intergenic
959470435 3:106743508-106743530 CTGTCTAGGAAGAGACAAATTGG + Intergenic
962654673 3:137531219-137531241 CTGTCTTGGCAGACAACCATGGG + Intergenic
965151931 3:164988790-164988812 CTGTCTTCTCAGACTGACATAGG - Intronic
966789605 3:183655137-183655159 CTGTCATTTAAGAGACACGTGGG - Intronic
967315184 3:188145389-188145411 CTGTCTTATTACAGACACATAGG + Intergenic
968007225 3:195251325-195251347 CTTCCCTGTCAGAAACACATGGG - Intronic
970179969 4:13381499-13381521 CTGTCTTGGCTGAGACAAAGTGG + Exonic
970408928 4:15789095-15789117 ATGTCTTTTCAGAGTCACACTGG - Intronic
970413510 4:15834099-15834121 CCGTCTTGGCAGTGACACATTGG + Intronic
972901364 4:43688102-43688124 CTGTCATGCCAGAGCTACATTGG + Intergenic
973218675 4:47700647-47700669 CTGGCTTGGCACAGACACAATGG - Intronic
975143547 4:70941706-70941728 CTTTCTTTTCAGAGAAACTTTGG + Intronic
977037252 4:91970253-91970275 CTATGTTGTCATAGACTCATTGG + Intergenic
977377275 4:96221548-96221570 CTGTTTTGTTTGAGACACTTTGG + Intergenic
981031440 4:140129527-140129549 CTGTCTTTTCAGAGAACCAAGGG - Intronic
981075685 4:140589044-140589066 CGGTCTTTGCAGATACACATAGG - Intergenic
988149156 5:27353690-27353712 ATGTCTTGACAGCGCCACATTGG - Intergenic
988238017 5:28572093-28572115 CAGTCTAAACAGAGACACATTGG - Intergenic
989215535 5:38901053-38901075 CTGTATTTTCACAGACTCATGGG - Intronic
997376770 5:133403130-133403152 CTGTCTTGGGAGAGAAACAAAGG - Intronic
998004570 5:138648598-138648620 CTGAGTGGGCAGAGACACATAGG - Intronic
1000166430 5:158653578-158653600 CTGAATTGACAGAAACACATGGG - Intergenic
1000365441 5:160486451-160486473 CTGTCTTCTCAGTGACACCGAGG + Intergenic
1003890198 6:10557211-10557233 CTCTCTTGATAGAGCCACATAGG - Intronic
1003963030 6:11226852-11226874 CTGTCTTGTCAGATAGTTATAGG - Intronic
1004165250 6:13251197-13251219 ACCTCTTGTTAGAGACACATCGG + Intronic
1004278563 6:14259272-14259294 CTGTTTTGTCAGGGGCACAGGGG + Intergenic
1005190216 6:23213130-23213152 CAGACATCTCAGAGACACATAGG - Intergenic
1005281449 6:24279022-24279044 CTTCATTGTGAGAGACACATGGG - Intronic
1006535243 6:34694516-34694538 GTGTTTAGTCAGAGAGACATGGG - Intronic
1015117251 6:129663349-129663371 CTGTGTTGTCAGAGCAAGATAGG - Intronic
1016177164 6:141095269-141095291 CTTTATTGTCAGTGATACATAGG - Intergenic
1016287507 6:142489529-142489551 CTGTCTTATCAGAGTTCCATTGG - Intergenic
1020637591 7:10715124-10715146 CTCTCTTGTCACCGCCACATAGG - Intergenic
1021324263 7:19246451-19246473 CTGTTTTGTCAGGGCCAGATTGG - Intergenic
1023256262 7:38315681-38315703 CTGTCATGTCAGAAGGACATAGG - Intergenic
1023848702 7:44138833-44138855 GTGTCTTGTCTGTGACAGATGGG - Intergenic
1023849718 7:44143906-44143928 CTGTCCAGTCAGAGTCACTTAGG - Intergenic
1024481344 7:49866565-49866587 CCGTCTTTTCTGAGTCACATGGG - Intronic
1026513067 7:71043605-71043627 TTGGCTTGTCTGAGCCACATTGG + Intergenic
1028859841 7:95636775-95636797 CTGTCTAGGCAGAGAGACAAAGG - Intergenic
1030872067 7:114767977-114767999 CCCTATTGTGAGAGACACATTGG + Intergenic
1031078723 7:117238513-117238535 CTATGCTGTCAGAGACACCTAGG - Intergenic
1031153780 7:118085307-118085329 CTGTCAGGTCAGAGAGGCATTGG - Intergenic
1036490019 8:9216244-9216266 CTGTTTTGTCACAGATACTTGGG - Intergenic
1039129746 8:34249574-34249596 TTGTCTTGTTTGAGAAACATAGG + Intergenic
1039613895 8:38939692-38939714 CTCTCTAGTCAGTGACAAATAGG + Intronic
1040640139 8:49323602-49323624 CTGTTTTGACAGAGACTCACAGG - Intergenic
1044695393 8:94917269-94917291 CTGTCTTGTGAGAGCTACAGAGG + Intronic
1052421110 9:28244022-28244044 CATTCTTCTCAGAGCCACATGGG + Intronic
1055914836 9:81390434-81390456 CTATATTGTCAGAAACACAACGG - Intergenic
1060055924 9:120412930-120412952 GTATCTTTTCAGAGACACCTGGG + Intronic
1062154979 9:135042653-135042675 CTTTCTTATAAGAGACACACAGG - Intergenic
1188007363 X:25024654-25024676 ATGTCTTGTCAAAGACAGAGAGG + Intergenic
1189018853 X:37313553-37313575 CTGTCCTGTAAGAAACACACGGG + Intergenic
1190477162 X:50839858-50839880 CTGTCTTCCCAAAGACACATGGG - Intergenic
1196934388 X:120715217-120715239 TGGGCTTGTCAGAGACAGATGGG - Intergenic
1198930184 X:141849082-141849104 CTTTTCTGTAAGAGACACATTGG - Intronic
1202585939 Y:26427123-26427145 CTGTCTAGTCAGACTCATATTGG - Intergenic