ID: 1079120470

View in Genome Browser
Species Human (GRCh38)
Location 11:17680485-17680507
Sequence CTGAAGGCACAGACTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079120470_1079120473 -5 Left 1079120470 11:17680485-17680507 CCAATCTCAGTCTGTGCCTTCAG No data
Right 1079120473 11:17680503-17680525 TTCAGTACCGGCAAATGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079120470 Original CRISPR CTGAAGGCACAGACTGAGAT TGG (reversed) Intergenic
No off target data available for this crispr