ID: 1079121439

View in Genome Browser
Species Human (GRCh38)
Location 11:17688107-17688129
Sequence TAATTTACTGCCTGAGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079121439_1079121447 -1 Left 1079121439 11:17688107-17688129 CCCCCTCCTCAGGCAGTAAATTA No data
Right 1079121447 11:17688129-17688151 AAGGAGGATGTAAGAACAGAGGG No data
1079121439_1079121446 -2 Left 1079121439 11:17688107-17688129 CCCCCTCCTCAGGCAGTAAATTA No data
Right 1079121446 11:17688128-17688150 TAAGGAGGATGTAAGAACAGAGG No data
1079121439_1079121448 19 Left 1079121439 11:17688107-17688129 CCCCCTCCTCAGGCAGTAAATTA No data
Right 1079121448 11:17688149-17688171 GGGCACCAGCGTCAGCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079121439 Original CRISPR TAATTTACTGCCTGAGGAGG GGG (reversed) Intergenic
No off target data available for this crispr