ID: 1079121447

View in Genome Browser
Species Human (GRCh38)
Location 11:17688129-17688151
Sequence AAGGAGGATGTAAGAACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079121440_1079121447 -2 Left 1079121440 11:17688108-17688130 CCCCTCCTCAGGCAGTAAATTAA No data
Right 1079121447 11:17688129-17688151 AAGGAGGATGTAAGAACAGAGGG No data
1079121444_1079121447 -7 Left 1079121444 11:17688113-17688135 CCTCAGGCAGTAAATTAAGGAGG No data
Right 1079121447 11:17688129-17688151 AAGGAGGATGTAAGAACAGAGGG No data
1079121433_1079121447 17 Left 1079121433 11:17688089-17688111 CCCTCTCCAGAGCCCTGGCCCCC No data
Right 1079121447 11:17688129-17688151 AAGGAGGATGTAAGAACAGAGGG No data
1079121437_1079121447 5 Left 1079121437 11:17688101-17688123 CCCTGGCCCCCTCCTCAGGCAGT No data
Right 1079121447 11:17688129-17688151 AAGGAGGATGTAAGAACAGAGGG No data
1079121439_1079121447 -1 Left 1079121439 11:17688107-17688129 CCCCCTCCTCAGGCAGTAAATTA No data
Right 1079121447 11:17688129-17688151 AAGGAGGATGTAAGAACAGAGGG No data
1079121441_1079121447 -3 Left 1079121441 11:17688109-17688131 CCCTCCTCAGGCAGTAAATTAAG No data
Right 1079121447 11:17688129-17688151 AAGGAGGATGTAAGAACAGAGGG No data
1079121442_1079121447 -4 Left 1079121442 11:17688110-17688132 CCTCCTCAGGCAGTAAATTAAGG No data
Right 1079121447 11:17688129-17688151 AAGGAGGATGTAAGAACAGAGGG No data
1079121430_1079121447 27 Left 1079121430 11:17688079-17688101 CCATCTAATCCCCTCTCCAGAGC No data
Right 1079121447 11:17688129-17688151 AAGGAGGATGTAAGAACAGAGGG No data
1079121435_1079121447 11 Left 1079121435 11:17688095-17688117 CCAGAGCCCTGGCCCCCTCCTCA No data
Right 1079121447 11:17688129-17688151 AAGGAGGATGTAAGAACAGAGGG No data
1079121432_1079121447 18 Left 1079121432 11:17688088-17688110 CCCCTCTCCAGAGCCCTGGCCCC No data
Right 1079121447 11:17688129-17688151 AAGGAGGATGTAAGAACAGAGGG No data
1079121434_1079121447 16 Left 1079121434 11:17688090-17688112 CCTCTCCAGAGCCCTGGCCCCCT No data
Right 1079121447 11:17688129-17688151 AAGGAGGATGTAAGAACAGAGGG No data
1079121438_1079121447 4 Left 1079121438 11:17688102-17688124 CCTGGCCCCCTCCTCAGGCAGTA No data
Right 1079121447 11:17688129-17688151 AAGGAGGATGTAAGAACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079121447 Original CRISPR AAGGAGGATGTAAGAACAGA GGG Intergenic
No off target data available for this crispr