ID: 1079121448

View in Genome Browser
Species Human (GRCh38)
Location 11:17688149-17688171
Sequence GGGCACCAGCGTCAGCAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079121442_1079121448 16 Left 1079121442 11:17688110-17688132 CCTCCTCAGGCAGTAAATTAAGG No data
Right 1079121448 11:17688149-17688171 GGGCACCAGCGTCAGCAGAGCGG No data
1079121438_1079121448 24 Left 1079121438 11:17688102-17688124 CCTGGCCCCCTCCTCAGGCAGTA No data
Right 1079121448 11:17688149-17688171 GGGCACCAGCGTCAGCAGAGCGG No data
1079121439_1079121448 19 Left 1079121439 11:17688107-17688129 CCCCCTCCTCAGGCAGTAAATTA No data
Right 1079121448 11:17688149-17688171 GGGCACCAGCGTCAGCAGAGCGG No data
1079121440_1079121448 18 Left 1079121440 11:17688108-17688130 CCCCTCCTCAGGCAGTAAATTAA No data
Right 1079121448 11:17688149-17688171 GGGCACCAGCGTCAGCAGAGCGG No data
1079121441_1079121448 17 Left 1079121441 11:17688109-17688131 CCCTCCTCAGGCAGTAAATTAAG No data
Right 1079121448 11:17688149-17688171 GGGCACCAGCGTCAGCAGAGCGG No data
1079121444_1079121448 13 Left 1079121444 11:17688113-17688135 CCTCAGGCAGTAAATTAAGGAGG No data
Right 1079121448 11:17688149-17688171 GGGCACCAGCGTCAGCAGAGCGG No data
1079121437_1079121448 25 Left 1079121437 11:17688101-17688123 CCCTGGCCCCCTCCTCAGGCAGT No data
Right 1079121448 11:17688149-17688171 GGGCACCAGCGTCAGCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079121448 Original CRISPR GGGCACCAGCGTCAGCAGAG CGG Intergenic
No off target data available for this crispr