ID: 1079122460

View in Genome Browser
Species Human (GRCh38)
Location 11:17695746-17695768
Sequence GGCCGCGGCCGTGGGGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079122444_1079122460 23 Left 1079122444 11:17695700-17695722 CCTGAGGACAGAGATGGAGGCCG No data
Right 1079122460 11:17695746-17695768 GGCCGCGGCCGTGGGGGTGCTGG No data
1079122452_1079122460 3 Left 1079122452 11:17695720-17695742 CCGGTGGGCAAAGCGGGGAGGAT No data
Right 1079122460 11:17695746-17695768 GGCCGCGGCCGTGGGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079122460 Original CRISPR GGCCGCGGCCGTGGGGGTGC TGG Intergenic
No off target data available for this crispr