ID: 1079122545

View in Genome Browser
Species Human (GRCh38)
Location 11:17695995-17696017
Sequence CGGTGCCGGGGCGAGGGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079122529_1079122545 18 Left 1079122529 11:17695954-17695976 CCGGCCGCCCCCAGCTGTGGCGT No data
Right 1079122545 11:17695995-17696017 CGGTGCCGGGGCGAGGGATTAGG No data
1079122531_1079122545 11 Left 1079122531 11:17695961-17695983 CCCCCAGCTGTGGCGTCGTTCAG No data
Right 1079122545 11:17695995-17696017 CGGTGCCGGGGCGAGGGATTAGG No data
1079122535_1079122545 8 Left 1079122535 11:17695964-17695986 CCAGCTGTGGCGTCGTTCAGGCC No data
Right 1079122545 11:17695995-17696017 CGGTGCCGGGGCGAGGGATTAGG No data
1079122530_1079122545 14 Left 1079122530 11:17695958-17695980 CCGCCCCCAGCTGTGGCGTCGTT No data
Right 1079122545 11:17695995-17696017 CGGTGCCGGGGCGAGGGATTAGG No data
1079122532_1079122545 10 Left 1079122532 11:17695962-17695984 CCCCAGCTGTGGCGTCGTTCAGG No data
Right 1079122545 11:17695995-17696017 CGGTGCCGGGGCGAGGGATTAGG No data
1079122534_1079122545 9 Left 1079122534 11:17695963-17695985 CCCAGCTGTGGCGTCGTTCAGGC No data
Right 1079122545 11:17695995-17696017 CGGTGCCGGGGCGAGGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079122545 Original CRISPR CGGTGCCGGGGCGAGGGATT AGG Intergenic
No off target data available for this crispr