ID: 1079122912

View in Genome Browser
Species Human (GRCh38)
Location 11:17697831-17697853
Sequence CACAGCTCCCACGCTAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079122912_1079122917 12 Left 1079122912 11:17697831-17697853 CCCACATTAGCGTGGGAGCTGTG No data
Right 1079122917 11:17697866-17697888 CTGTCCTGTCCTCTCAGTGAAGG No data
1079122912_1079122920 27 Left 1079122912 11:17697831-17697853 CCCACATTAGCGTGGGAGCTGTG No data
Right 1079122920 11:17697881-17697903 AGTGAAGGAATTCCCAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079122912 Original CRISPR CACAGCTCCCACGCTAATGT GGG (reversed) Intergenic
No off target data available for this crispr