ID: 1079123611

View in Genome Browser
Species Human (GRCh38)
Location 11:17702740-17702762
Sequence GTCCCACTTGGGAGGCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079123611_1079123622 29 Left 1079123611 11:17702740-17702762 CCTCTCAGCCTCCCAAGTGGGAC No data
Right 1079123622 11:17702792-17702814 TTTTTTTGTACTTTTTGTAGAGG 0: 3
1: 78
2: 1274
3: 3990
4: 12219
1079123611_1079123616 -2 Left 1079123611 11:17702740-17702762 CCTCTCAGCCTCCCAAGTGGGAC No data
Right 1079123616 11:17702761-17702783 ACTACAGGCACATGCCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079123611 Original CRISPR GTCCCACTTGGGAGGCTGAG AGG (reversed) Intergenic
No off target data available for this crispr