ID: 1079125237

View in Genome Browser
Species Human (GRCh38)
Location 11:17714230-17714252
Sequence AGGATCTATACCCATGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079125231_1079125237 -4 Left 1079125231 11:17714211-17714233 CCCAGACTGGGCCCAGAGAAGGA No data
Right 1079125237 11:17714230-17714252 AGGATCTATACCCATGTGGTGGG No data
1079125232_1079125237 -5 Left 1079125232 11:17714212-17714234 CCAGACTGGGCCCAGAGAAGGAT No data
Right 1079125237 11:17714230-17714252 AGGATCTATACCCATGTGGTGGG No data
1079125224_1079125237 9 Left 1079125224 11:17714198-17714220 CCCTCCTGACCAACCCAGACTGG No data
Right 1079125237 11:17714230-17714252 AGGATCTATACCCATGTGGTGGG No data
1079125228_1079125237 5 Left 1079125228 11:17714202-17714224 CCTGACCAACCCAGACTGGGCCC No data
Right 1079125237 11:17714230-17714252 AGGATCTATACCCATGTGGTGGG No data
1079125226_1079125237 8 Left 1079125226 11:17714199-17714221 CCTCCTGACCAACCCAGACTGGG No data
Right 1079125237 11:17714230-17714252 AGGATCTATACCCATGTGGTGGG No data
1079125229_1079125237 0 Left 1079125229 11:17714207-17714229 CCAACCCAGACTGGGCCCAGAGA No data
Right 1079125237 11:17714230-17714252 AGGATCTATACCCATGTGGTGGG No data
1079125223_1079125237 26 Left 1079125223 11:17714181-17714203 CCTGGCAATATCACAGTCCCTCC No data
Right 1079125237 11:17714230-17714252 AGGATCTATACCCATGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079125237 Original CRISPR AGGATCTATACCCATGTGGT GGG Intergenic
No off target data available for this crispr