ID: 1079130804

View in Genome Browser
Species Human (GRCh38)
Location 11:17745837-17745859
Sequence GCACGAAGTGGGGAAGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 2, 2: 4, 3: 54, 4: 471}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079130804_1079130811 -4 Left 1079130804 11:17745837-17745859 CCGGCCCCTTCCCCACTTCGTGC 0: 1
1: 2
2: 4
3: 54
4: 471
Right 1079130811 11:17745856-17745878 GTGCTTTGCTCTTTTCTCCTTGG 0: 1
1: 0
2: 5
3: 55
4: 960

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079130804 Original CRISPR GCACGAAGTGGGGAAGGGGC CGG (reversed) Intronic
900286252 1:1901973-1901995 GCACCTAGAGGGGAAGGGCCAGG + Intergenic
900475609 1:2875010-2875032 GCAGAAAGTGGGGCAGGCGCTGG + Intergenic
901510945 1:9717784-9717806 ACAGGAAGTGGGGAGGGGGTGGG + Intronic
901514383 1:9735181-9735203 GCAAGAAATGGGGAAGGGTCAGG + Intronic
901735653 1:11310561-11310583 GCAGGGAGGTGGGAAGGGGCAGG - Intergenic
901735661 1:11310579-11310601 GCAGGGAGGTGGGAAGGGGCAGG - Intergenic
902112837 1:14097382-14097404 GCAGGGAGTGGGGAAAAGGCAGG - Intergenic
902399525 1:16150435-16150457 GCTAGAGGTGGGAAAGGGGCGGG + Intronic
902423808 1:16303384-16303406 ACATGAAGTAGGCAAGGGGCAGG - Intronic
902754551 1:18540471-18540493 GCAGGGAGTGGAGAAGGGTCAGG - Intergenic
902772378 1:18652818-18652840 GCAAGAGGTGGGCAAGGGGAGGG - Intronic
903741777 1:25562615-25562637 ACAGGAAGTGGGGATGGGGAGGG - Intronic
903974251 1:27138767-27138789 GCATGAAGTGGAGAAAGGGGTGG + Intronic
904277474 1:29393892-29393914 GAAGGAAGTGGGGAGGGGGGAGG - Intergenic
904392698 1:30196357-30196379 GCCAGGTGTGGGGAAGGGGCTGG - Intergenic
906100238 1:43255721-43255743 GCCAGCAGGGGGGAAGGGGCTGG - Intronic
906205729 1:43985409-43985431 GCACGCGGTGGGGAATAGGCTGG + Intronic
906212512 1:44019946-44019968 ACAGGAAGTGGGGAGGGGGAGGG + Intronic
906240821 1:44241124-44241146 CCAGGAACTGGGGGAGGGGCTGG + Intronic
906724002 1:48030434-48030456 ACAGGTGGTGGGGAAGGGGCAGG + Intergenic
907188963 1:52633135-52633157 GAGCGCAGTGGGGAGGGGGCAGG + Intergenic
907401457 1:54227304-54227326 GCATGGAGTGGGCAGGGGGCCGG + Intronic
908648613 1:66307461-66307483 GCACAAAGTGGTGAAGTGGATGG + Intronic
909025728 1:70479766-70479788 GCAGGAAGTGAGGGAAGGGCGGG - Intergenic
909994279 1:82259976-82259998 GAAGGAAGAGGTGAAGGGGCAGG + Intergenic
912496518 1:110095297-110095319 CCACTAAGCGTGGAAGGGGCAGG - Intergenic
913089223 1:115465308-115465330 GCCCAGAGTGGGGAAGGGACAGG + Intergenic
913518143 1:119622612-119622634 GAAGGAAGTGGGGAAGGGGCGGG - Exonic
914845677 1:151282461-151282483 TGACCAAGTGGGGGAGGGGCGGG - Intronic
915313434 1:155015819-155015841 GCAGCAAGGGGGGAAGGGCCCGG + Intronic
915347457 1:155204995-155205017 GCACCAGCTGGGGAAGGGGTTGG - Intronic
915459552 1:156061582-156061604 GCAGGGAGTGGGGGAGGGTCTGG + Intronic
917215150 1:172670474-172670496 AGAGGAAGTGGGAAAGGGGCTGG + Intergenic
917683428 1:177391608-177391630 GGAAGAGGAGGGGAAGGGGCTGG + Intergenic
918038493 1:180897691-180897713 GCATGGAGGGGTGAAGGGGCCGG - Intergenic
918138801 1:181702563-181702585 GCAGGCAGTGGGGAAGTGGAGGG - Intronic
919811916 1:201414224-201414246 GCATGGAGTGGGGAGGCGGCCGG - Intronic
919933908 1:202239006-202239028 GCCCCAAGTGAGGACGGGGCAGG + Intronic
920735707 1:208531418-208531440 GAAGGAAGTGGGCAAGGGCCAGG + Intergenic
923093099 1:230754125-230754147 GCAGGAGGCTGGGAAGGGGCGGG + Intronic
923191722 1:231626754-231626776 ACGGGAAGTGGGGAGGGGGCTGG - Intronic
923345253 1:233045416-233045438 GGAGGTAGTGGGGAAGGGGATGG - Intronic
924795693 1:247290715-247290737 GCACCAAGTGAGGACAGGGCAGG - Intergenic
924823592 1:247518039-247518061 GCAGGAGGTGGAGAAGGGCCCGG - Intronic
1063462028 10:6221181-6221203 GCACTAGGAAGGGAAGGGGCAGG + Intronic
1064176664 10:13080998-13081020 ACACTAAGTAGGGATGGGGCAGG + Intronic
1064691970 10:17927578-17927600 GCAGGAAGTGGGAAAGAAGCTGG + Intergenic
1065867837 10:29928981-29929003 GCACCAAATGAGGATGGGGCAGG + Intergenic
1067848182 10:49739136-49739158 GCAGGAAGGGAGGAAGGAGCAGG - Intronic
1068910593 10:62374641-62374663 GCACGCAGCGGAGAGGGGGCGGG + Intronic
1070764577 10:79048993-79049015 GAACGAGGTAGGGGAGGGGCGGG - Intergenic
1073117472 10:101099677-101099699 ACACACAGTGAGGAAGGGGCAGG + Intronic
1073120551 10:101120012-101120034 GCAAGAAGTAGGCAGGGGGCTGG + Intronic
1073155279 10:101341671-101341693 GCAGGAAGTGGGGAAAAGGCAGG - Intergenic
1074188081 10:111114089-111114111 GCACTAAGGGGGAAAAGGGCAGG - Intergenic
1074791234 10:116889583-116889605 GCATGAAGAGGGGAAGGAACTGG + Intronic
1074853120 10:117454543-117454565 GCATGGACTGGGGAAGGGGATGG + Intergenic
1075185457 10:120252086-120252108 GCCGGAAGTGGGGAAGGGGGTGG + Intergenic
1075339913 10:121638594-121638616 CAAGGAAATGGGGAAGGGGCAGG + Intergenic
1075920692 10:126210496-126210518 GGAACAAGTGGGGTAGGGGCAGG + Intronic
1075990483 10:126834228-126834250 GCTCTCAGTGGGGAAGGGGAAGG - Intergenic
1076002530 10:126923729-126923751 GTATGAAGTGGGGAGGGGGAGGG - Intronic
1076751693 10:132546607-132546629 GAAGGAGGCGGGGAAGGGGCCGG - Intronic
1076760826 10:132605154-132605176 GGAGGGAGTGGGGAAGGGGCTGG + Intronic
1076760847 10:132605202-132605224 GGAGGGAGTGGGGGAGGGGCTGG + Intronic
1076760868 10:132605250-132605272 GGAGGGAGTGGGGGAGGGGCTGG + Intronic
1077139935 11:1019799-1019821 GCTCGGTGTGGGGCAGGGGCAGG + Intronic
1077145634 11:1043044-1043066 GCAAGAAGGGGTGACGGGGCAGG + Intergenic
1078003641 11:7516624-7516646 GCACCAAGTGAGGACGAGGCAGG + Intronic
1078642640 11:13110751-13110773 AAATGAAGTTGGGAAGGGGCGGG + Intergenic
1079130804 11:17745837-17745859 GCACGAAGTGGGGAAGGGGCCGG - Intronic
1079918383 11:26399723-26399745 GCAGGAAAGGGGGCAGGGGCAGG - Intronic
1081447409 11:43144228-43144250 GAAGGAAGTGGGGAAGGGAAGGG + Intergenic
1081566674 11:44264822-44264844 TCCCGAGGTGGGGACGGGGCAGG + Exonic
1081705644 11:45180842-45180864 GCGCGCGGTGGGGAAGGGGAGGG - Intronic
1082044712 11:47715381-47715403 GCAGGAAGCGGAGAAAGGGCGGG + Intronic
1082915677 11:58433897-58433919 GTAGGAAGTGGGGAGGGGGGAGG + Intergenic
1083186622 11:61021584-61021606 GAAGGAAGTGGGGATGAGGCTGG + Intergenic
1083395557 11:62389271-62389293 GGGAGAAGAGGGGAAGGGGCAGG - Intronic
1083594947 11:63914768-63914790 GCACGATGTGGAGAAGTCGCTGG - Exonic
1083654017 11:64220359-64220381 GCAGGAGCTGGGGCAGGGGCAGG + Intronic
1083689109 11:64396047-64396069 GCACAAGGTGGGGGAGGGGCGGG - Intergenic
1083929607 11:65833572-65833594 CCAGGCAGTGGGGAAGGGGAAGG - Intronic
1084805547 11:71576608-71576630 GCAGGTGGTGGGGAAGGGGCTGG + Intergenic
1085052019 11:73384805-73384827 GCTCGTGGTGGGGAAAGGGCTGG + Intronic
1085279406 11:75320257-75320279 GCCCAAGGTGGGGAGGGGGCTGG + Intronic
1086537307 11:87863449-87863471 GCATGAAGTGGGTAGTGGGCTGG + Intergenic
1087007496 11:93483872-93483894 GCACAAAGTGGGCGAAGGGCGGG - Intronic
1087610458 11:100427982-100428004 TCAGGAATTGGGGAAGGGGAGGG + Intergenic
1089346895 11:117796708-117796730 GCAGGAAGAGGGCAAGGGGCTGG + Intronic
1089457248 11:118632793-118632815 GCACGAAATCTGAAAGGGGCAGG - Intronic
1090199737 11:124845666-124845688 GGAGGACGTGGGGAAGGGGTTGG + Intergenic
1090575625 11:128099707-128099729 GCAAGAAGTGGAGCAGGGACTGG - Intergenic
1090768161 11:129895310-129895332 GCACGGCGTGGGGGAGGGGCGGG - Intronic
1091172529 11:133531395-133531417 AGACAAGGTGGGGAAGGGGCTGG + Intronic
1091396038 12:154727-154749 GCACGAGGAGAGGAAGGGACAGG - Intronic
1092184833 12:6471027-6471049 GCGCGGGGTGGGGCAGGGGCGGG - Intergenic
1092920485 12:13227402-13227424 GCAGGGAGTAGAGAAGGGGCCGG - Intergenic
1093525805 12:20102467-20102489 GCAAGGAGTGGGGAAAGGCCAGG + Intergenic
1094084572 12:26575403-26575425 CCACGATGCGGGGAAGGGGAGGG + Intronic
1096073470 12:48788599-48788621 GCACGTACTGGGGGAGGGGCTGG - Intronic
1098399150 12:70054684-70054706 GCACAAAATGGGGAAGCTGCAGG - Intergenic
1100209346 12:92385497-92385519 GCAGGGAGTGGGGAAGAGGTTGG - Intergenic
1100299024 12:93290319-93290341 GCACCAAGTGAGGATGGGGCAGG + Intergenic
1100482068 12:94988765-94988787 GCACCAAATGAGGATGGGGCAGG - Intronic
1101262456 12:103046767-103046789 CCACGGACTGGGGAAGGGGATGG - Intergenic
1101408235 12:104447715-104447737 CCACAAGGTGGGGAAGGGGATGG - Intergenic
1101466765 12:104957864-104957886 GCCCGAGGTGGGGCAGGCGCGGG + Intronic
1101548408 12:105738757-105738779 GCAAGAGGTGGGAAAGGGTCCGG + Intergenic
1102636598 12:114329969-114329991 GCTCAGAGAGGGGAAGGGGCTGG - Intergenic
1102681525 12:114693511-114693533 CCAGGAAGTGGGGAAAGGGTGGG - Intergenic
1102946175 12:116990374-116990396 CCAGGAAGTGGGGAAGGAGCAGG + Intronic
1103449460 12:121018252-121018274 GCACCAAATGAGGACGGGGCAGG + Intergenic
1103522738 12:121547255-121547277 GCTCGAGGTGGGGAGGGAGCAGG - Intronic
1103905656 12:124326164-124326186 GCACCAGGTGGGGACAGGGCTGG - Intronic
1104179842 12:126368655-126368677 GCAGGAAGTGTGGCAGGTGCAGG + Intergenic
1104809536 12:131611993-131612015 CAGCGGAGTGGGGAAGGGGCAGG - Intergenic
1105217432 13:18297470-18297492 GCACGCAGGGAGGAAGGCGCAGG - Intergenic
1105847793 13:24308236-24308258 GCGGGAAGCGGGGAAGGGCCGGG + Intronic
1108018011 13:46096320-46096342 GCAAGAAATGGGGAGAGGGCTGG - Intronic
1108269312 13:48743566-48743588 GCAAGAGGTGGGGAGGGGGGAGG - Intergenic
1111739434 13:92184451-92184473 GTAGGAAGTGGGGAAGGGAGAGG - Intronic
1112509576 13:99997669-99997691 GACCGATGTGGGGAAGGGGAAGG - Intergenic
1112532658 13:100220051-100220073 ACAAGAAGTGAGGAAGGAGCTGG + Intronic
1112558753 13:100493169-100493191 GCACGCAGATGGGCAGGGGCAGG - Intronic
1113048458 13:106182649-106182671 GCAGGAAGTGGTGAAGTTGCGGG + Intergenic
1114265702 14:21071405-21071427 GCAGGGAGTGGAGGAGGGGCAGG + Intronic
1114426807 14:22630738-22630760 GAAAGAAGTGTGGAAGGGGAGGG - Intergenic
1116016591 14:39414993-39415015 GCAAGAAATGGGGGAAGGGCTGG + Intronic
1117173822 14:53128454-53128476 GGTGGAAGTGGGGAAGGAGCAGG + Intronic
1119038005 14:71246744-71246766 GCAGGAAGTGGGTGAGGGGAGGG + Intergenic
1119485599 14:74984779-74984801 GGAAGGAGTGGGGATGGGGCCGG + Intergenic
1119854379 14:77888290-77888312 GCTCGAAGTGGAGATGAGGCTGG + Intronic
1120746723 14:88159117-88159139 GCATGAAGTGGGGATGGGATGGG - Intergenic
1120945148 14:89987820-89987842 GTAGGAAGTGGGGAAGGAGTTGG + Intronic
1121221403 14:92288290-92288312 CCCCAAAGTGGGGCAGGGGCTGG - Intergenic
1121343100 14:93116354-93116376 TCACTGAGGGGGGAAGGGGCGGG + Intergenic
1122233954 14:100321784-100321806 GCACAGAGTGGTCAAGGGGCTGG + Intergenic
1122342409 14:101037081-101037103 GGAGGAAGTGGGGAGGGGGCAGG + Intergenic
1122544846 14:102516754-102516776 GCCCGAGGCGGGGAAGGGGCCGG + Intergenic
1122659836 14:103287819-103287841 GGAGGAGGTGGGGAAGAGGCAGG + Intergenic
1122819586 14:104334841-104334863 CCAGGAAGTGGGGCAGAGGCCGG - Intergenic
1123014621 14:105367846-105367868 GCAGGAAGTGGGGAGGGGCAGGG - Intronic
1123684280 15:22786521-22786543 GCAGGAAGAGGGGCGGGGGCGGG - Intronic
1126330152 15:47523038-47523060 GGAGGCAGTGGGGATGGGGCTGG + Intronic
1127682454 15:61310979-61311001 GCAGGCTGTGGGGAAGTGGCTGG - Intergenic
1129169600 15:73799558-73799580 GCAGGAGGTGGGGAGGGTGCAGG - Intergenic
1129602971 15:77010987-77011009 GAAAGAAGTGGGGATTGGGCTGG + Intronic
1129682056 15:77663617-77663639 TCAGGCAGTGGGGCAGGGGCTGG - Intronic
1129701642 15:77771788-77771810 GCAGCAACTAGGGAAGGGGCAGG + Intronic
1131272715 15:90956911-90956933 GGAATAAGTGGGGACGGGGCGGG - Intronic
1131832873 15:96365588-96365610 GGACGGAGTGGGGTGGGGGCGGG - Intergenic
1132483392 16:177456-177478 GCAGGAAGGGGAGGAGGGGCTGG - Exonic
1132850479 16:2022867-2022889 GCAGGCGGTGGGGAAGGGGGAGG - Intergenic
1133116779 16:3582086-3582108 GCACGGACAGAGGAAGGGGCTGG + Exonic
1133301913 16:4787765-4787787 GCATGAAGTGTGGAGGGGGTTGG - Intronic
1135013653 16:18905906-18905928 TAAAGAAGTGAGGAAGGGGCCGG - Intronic
1135892691 16:26371678-26371700 GAAAGAAGTGGGGGAGGGGAGGG + Intergenic
1136140261 16:28283830-28283852 GGTCGGAGTGGGGAAGGGGTGGG - Intergenic
1137223710 16:46481878-46481900 GCAGGAGCTGGGGAAGGGACCGG - Intergenic
1137687307 16:50395163-50395185 GGACCAGGTGGTGAAGGGGCAGG + Intergenic
1138085185 16:54127056-54127078 GCAGGAAGTGGGGGTGGGGAAGG - Intergenic
1138453000 16:57104939-57104961 GCAGGAAGTGGGGACAGGTCAGG + Intronic
1138570303 16:57867146-57867168 GGATGAAATGGGGAAGTGGCGGG - Intergenic
1138599820 16:58047717-58047739 ACACAAAGAGAGGAAGGGGCGGG - Intergenic
1139379175 16:66519822-66519844 GCTCTCAGTGGGGAGGGGGCAGG + Intronic
1139387125 16:66579784-66579806 GCACGAAGTGGGCACGAGGAGGG + Exonic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1141762578 16:86038538-86038560 GCACAGTGTGGGGGAGGGGCTGG + Intergenic
1141775845 16:86122028-86122050 GATCAAAGTGGAGAAGGGGCAGG - Intergenic
1142251530 16:88994086-88994108 GCACGTTATGGGGCAGGGGCAGG - Intergenic
1143513251 17:7407165-7407187 GGAGGAAGACGGGAAGGGGCTGG - Intronic
1143513454 17:7408041-7408063 GCACGGGGTGGGGAAGGGGAAGG - Intronic
1143611509 17:8020458-8020480 GCCTGAAGAGGGGAAGTGGCCGG + Intergenic
1144523058 17:15967113-15967135 GCAGGAAGTGGGAAAGGAGAGGG + Intronic
1144626512 17:16846863-16846885 GCCTGGAGTGGGGAGGGGGCTGG - Intergenic
1144879920 17:18425848-18425870 GCCTGGAGTGGGGAGGGGGCTGG + Intergenic
1145152313 17:20518536-20518558 GCCTGGAGTGGGGAGGGGGCTGG - Intergenic
1145976842 17:28988744-28988766 GCTCCAAGTGGGGCAGTGGCTGG + Intronic
1146058113 17:29591089-29591111 GCGGGAAGGGGGTAAGGGGCGGG + Intronic
1146061339 17:29609004-29609026 GCAGGAAGTGGGGCAGGGTGGGG + Intronic
1146704715 17:34992611-34992633 GCAGGAGGTGGAGAAGGAGCCGG + Exonic
1147557508 17:41488825-41488847 GCTGGAAATGGTGAAGGGGCTGG - Intronic
1147613170 17:41813106-41813128 GCAGGCCGTGGGGAGGGGGCTGG + Exonic
1147760828 17:42796433-42796455 GCACTAAGTGAGGAAAGGGGAGG - Intronic
1148389444 17:47260330-47260352 GAAGGTGGTGGGGAAGGGGCAGG - Intronic
1148688531 17:49513791-49513813 GCAGGCAGTGGGGAAGGGGTGGG - Exonic
1148874384 17:50678052-50678074 GGAGGAAATGGGGCAGGGGCAGG - Intronic
1150237887 17:63607825-63607847 GCACCAAGTGAGGAAGAAGCTGG + Exonic
1151227538 17:72658118-72658140 TAAGGAAGTGGGGAAGGCGCTGG + Intronic
1151536511 17:74741925-74741947 GACCGAAGTGGGAAAAGGGCAGG + Intronic
1152637922 17:81437784-81437806 GCACAGGGTGGGGAAGGGACGGG - Intronic
1152870079 17:82749101-82749123 GGAGGAAGGGGGGCAGGGGCGGG + Intronic
1153975127 18:10262607-10262629 GCACTAAGCCGGGAAGGGGGAGG - Intergenic
1153979026 18:10293903-10293925 GCAGGAAGTGGGGAAGGTTGGGG - Intergenic
1154197879 18:12279495-12279517 GGAGGAATTGGGGAAGGGACGGG + Intergenic
1154293482 18:13130643-13130665 GCACCCAGTGGGGATGGGGCTGG - Intergenic
1157302231 18:46487333-46487355 GTACCAAGAGGGAAAGGGGCAGG + Intronic
1157331206 18:46705096-46705118 GGATCAAGTGGGAAAGGGGCAGG - Intronic
1157359466 18:46964363-46964385 GCGCGCAGTGGGGAAGCTGCAGG - Exonic
1157361060 18:47023882-47023904 GCGCGCAGTGGGGAAGCTGCAGG - Exonic
1157362050 18:47029797-47029819 GCGCGCAGTGGGGAAGCTGCAGG - Exonic
1157362929 18:47035219-47035241 GCACGCAGTGGAGAAGCTGCAGG - Exonic
1160480583 18:79236731-79236753 GCACACAGTGGGGAAGGGGCAGG - Intronic
1160480593 18:79236782-79236804 GTACACAGTGGGGAAGGGGCAGG - Intronic
1160480603 18:79236833-79236855 GTACACAGTGGGGAAGGGGCAGG - Intronic
1160480626 18:79236942-79236964 GTACACAGTGGGGAAGGGGCAGG - Intronic
1160480635 18:79236993-79237015 GTACACAGTGGGGAAGGGGCAGG - Intronic
1160480658 18:79237102-79237124 GTACACAGTGGGGAAGGGGCAGG - Intronic
1160480695 18:79237269-79237291 GTACACAGTGGGGAAGGGGCAGG - Intronic
1160480705 18:79237320-79237342 GCACACAGTGGGGAAGGAGCAGG - Intronic
1160480713 18:79237371-79237393 GTACACAGTGGGGAAGGGGCAGG - Intronic
1160537514 18:79603014-79603036 GCGAGGTGTGGGGAAGGGGCCGG - Intergenic
1160881603 19:1323328-1323350 GCAGGGACTCGGGAAGGGGCTGG + Intergenic
1160919253 19:1512180-1512202 GCACCAGCTGGGGAAGAGGCTGG + Intronic
1160960518 19:1718756-1718778 GCTTGGAGTGGGGGAGGGGCGGG - Intergenic
1161576756 19:5058637-5058659 ACACGACGTGAGGCAGGGGCTGG - Intronic
1162105447 19:8367177-8367199 GCACGGAGGTGGGAAGGAGCGGG - Intronic
1162153963 19:8664353-8664375 GCAGGAAGTGGGGGGTGGGCAGG - Intergenic
1162169095 19:8774662-8774684 GAAGGAAGAGGGGAAGGGGAAGG - Intergenic
1162169773 19:8779973-8779995 GAAGGAAGAGGGGAAGGGGAAGG - Intergenic
1162209039 19:9077250-9077272 GCCCCAAGTGAGGACGGGGCAGG + Intergenic
1162394494 19:10409002-10409024 GAAGGAAGTGGGGAGTGGGCGGG + Intronic
1162422328 19:10572907-10572929 GGAAGAGGTGAGGAAGGGGCGGG + Exonic
1162766762 19:12924529-12924551 GCAGGAAGTGGGGGGCGGGCAGG + Intronic
1162777854 19:12990461-12990483 GGGCGCAGAGGGGAAGGGGCGGG - Intergenic
1163191504 19:15680146-15680168 GCATGGAGTGGGGAAAGTGCTGG + Intronic
1163442259 19:17328146-17328168 GTACGAGGTGAGGAGGGGGCGGG - Exonic
1163699875 19:18781725-18781747 GCAGGATGGGGGGCAGGGGCTGG + Exonic
1163765844 19:19162827-19162849 TCACGCAGTGGGCAAGTGGCGGG - Intronic
1165174110 19:33914552-33914574 GCACGGAGTGGAGTAGGGGTGGG + Intergenic
1165420853 19:35721232-35721254 GCAGGGGGTGGGGAGGGGGCCGG - Exonic
1165498568 19:36169313-36169335 GCAGGAACTGGGGAAGGTGCTGG - Intergenic
1166367238 19:42283999-42284021 GGGGGAAGCGGGGAAGGGGCGGG + Intronic
1166392791 19:42419348-42419370 CAAAGGAGTGGGGAAGGGGCTGG + Intronic
1166675320 19:44737501-44737523 GCAGGAGGTGGGGTGGGGGCGGG - Intergenic
1166720202 19:44992137-44992159 GTAGGAAGTGGTGAGGGGGCTGG + Intronic
1166750234 19:45161055-45161077 GCAGGCGCTGGGGAAGGGGCGGG - Intronic
1167116441 19:47491786-47491808 GCACTAAGTGAGGCAGGAGCTGG + Intronic
1167498440 19:49832224-49832246 GCAGGGAGTGGGGGTGGGGCAGG - Intronic
1168276173 19:55279889-55279911 GCACGCAGTGGAGATGGGGAAGG - Intronic
927088021 2:19690084-19690106 GAAGGAAGAGGGGAAGGGGAAGG + Intergenic
927180781 2:20445557-20445579 GCAGGAAGGTGGGAAGGAGCGGG - Intergenic
927846797 2:26476364-26476386 CCAAGAGGTGGGGAAGGGGCAGG + Intronic
927852186 2:26506407-26506429 TGGGGAAGTGGGGAAGGGGCAGG - Intronic
929200332 2:39228574-39228596 GCAGGAAGTGCGGAAGCTGCTGG - Intronic
929552713 2:42904576-42904598 GCTTGGAGTGGGGCAGGGGCAGG + Intergenic
929581662 2:43085384-43085406 GGAGGAGGAGGGGAAGGGGCAGG - Intergenic
929656684 2:43739699-43739721 GCAGGAAGTGGAGAAAGAGCGGG - Intronic
929869473 2:45746115-45746137 CAACGAAGGAGGGAAGGGGCAGG - Intronic
929978612 2:46658089-46658111 GCACCAAGTGGGACAGGGTCGGG + Intergenic
931175071 2:59846235-59846257 GCTGGAAGTGGGGCTGGGGCTGG - Intergenic
932497459 2:72153494-72153516 GCACGAAGTGGGGGAAGGGTAGG - Intergenic
932637292 2:73401994-73402016 ACACGAGGAGGGGAAGGGGGAGG - Intronic
932758241 2:74423395-74423417 GGACCAAGTGGGGTGGGGGCAGG + Intronic
933246134 2:79976789-79976811 GCCCCAAGTGGGGAAGGAACTGG - Intronic
934686939 2:96327950-96327972 GTAAGAAGTGAGGATGGGGCGGG - Exonic
934729366 2:96646973-96646995 GAAAGACGTGGGGAACGGGCTGG - Intergenic
935780118 2:106503242-106503264 GCGCAGAGAGGGGAAGGGGCTGG - Intergenic
936264688 2:110994504-110994526 TCAGGAAGTGGGGAAAGGGGAGG + Intronic
936272494 2:111059938-111059960 GGAGGAAGAGGGGAAGGGGTAGG + Intronic
936666797 2:114606339-114606361 GCAGGAAGTCAGGAAAGGGCTGG - Intronic
936868600 2:117107296-117107318 GCACAGAATGGGGATGGGGCGGG - Intergenic
937204382 2:120226038-120226060 GCCAGAGGTGGGGTAGGGGCAGG + Intergenic
938259790 2:129887538-129887560 GAAGGAAGTGGGGGAGGGGATGG - Intergenic
939960568 2:148561673-148561695 GCCCGAAGTGGGGACCTGGCTGG + Intergenic
940569952 2:155418288-155418310 GAGGGAAGTGGGGGAGGGGCAGG - Intergenic
943789568 2:191917166-191917188 GCAGGAATTGGTGAAGGGGTGGG + Intergenic
944811065 2:203328200-203328222 GCCGGAAGTGGGGGAGGGGCCGG + Exonic
946895508 2:224319563-224319585 GCCGGAGGTGGGGAGGGGGCAGG - Intergenic
947503359 2:230688093-230688115 ACAGTAAGAGGGGAAGGGGCTGG - Intergenic
948783702 2:240340217-240340239 GCATGGAGTGGGGAGGGGGCCGG - Intergenic
948868778 2:240788028-240788050 GCACGAAGCGGGGGGCGGGCGGG - Intronic
1168842025 20:915766-915788 GCACAAAGAGGGGCAGGGGTGGG - Intronic
1170705276 20:18738745-18738767 GCAGGGAGGGAGGAAGGGGCTGG + Intronic
1170955880 20:20978981-20979003 CCAGGGAGTGGGGCAGGGGCTGG + Intergenic
1170975580 20:21160829-21160851 GCTCGCAGGGTGGAAGGGGCAGG - Intronic
1172244779 20:33438429-33438451 GTGCGGACTGGGGAAGGGGCAGG - Intronic
1172637873 20:36422163-36422185 GGACGATGTGTGGAAGGGGAAGG - Intronic
1172936365 20:38623334-38623356 GTAGCAAGTGGGGAAGGTGCAGG - Intronic
1173313071 20:41917677-41917699 GGAGGGAGTGGGGAAGGGGGAGG + Intergenic
1173553670 20:43950479-43950501 GCAAGCAGTGGGGAGGGGGAGGG - Intronic
1173788246 20:45810958-45810980 GCAGGGAGAGGAGAAGGGGCAGG - Intronic
1174660702 20:52210485-52210507 GCCCGAAACGGGGACGGGGCAGG + Intergenic
1175267697 20:57712456-57712478 GCAAGTAGAGGAGAAGGGGCCGG + Intergenic
1175293100 20:57891345-57891367 GGACGAAGAGGGGCAGGGCCTGG - Intergenic
1175415251 20:58796732-58796754 AAACGAGGTGTGGAAGGGGCAGG - Intergenic
1175498913 20:59435494-59435516 GCACCAGGTGGGGAAGGGGTGGG - Intergenic
1175658814 20:60794517-60794539 GCTGGAACTGGGGAAGGGGTGGG - Intergenic
1175903416 20:62368693-62368715 GCTCCAAGTGGGGGAGGGGCTGG + Intergenic
1175923177 20:62459372-62459394 GCCCACAGTGGGGAAGGGCCTGG - Intergenic
1176064470 20:63187541-63187563 GCAGGAGGTGGGGGTGGGGCAGG - Intergenic
1176217616 20:63955761-63955783 GCATGAAGTGGGGAAGTTGTGGG - Intronic
1178202677 21:30425673-30425695 GCAGGAGGTGTGGCAGGGGCTGG + Exonic
1178334633 21:31732182-31732204 GGACGAGGCGGGGAGGGGGCGGG - Intergenic
1178360159 21:31942583-31942605 GCAGCAAGAGGGGAAGGGGTGGG - Intronic
1178610163 21:34073281-34073303 GCAGGAGGCGGGGTAGGGGCAGG + Intronic
1179016037 21:37595038-37595060 CCACGATGTGGGGCGGGGGCTGG + Intergenic
1179273284 21:39867915-39867937 GGACAAGGTGGGGAAAGGGCTGG + Intronic
1179286905 21:39985337-39985359 GGAGGAAGAAGGGAAGGGGCGGG - Intergenic
1179463714 21:41556588-41556610 ACACCAAGTGGGGAGGCGGCTGG - Intergenic
1179523661 21:41961663-41961685 GAACAAGCTGGGGAAGGGGCTGG - Intergenic
1179534939 21:42045336-42045358 GCAGGAAGAGTGGAAGGCGCTGG - Intergenic
1179666563 21:42916867-42916889 GCCCCAAGTGAGGATGGGGCAGG + Intergenic
1179667992 21:42925629-42925651 GCCCCAAGTGAGGAGGGGGCAGG + Intergenic
1180737098 22:18025191-18025213 GCTGGAAGTGTGGAAGGGGCTGG - Intergenic
1181439370 22:22927866-22927888 GCACGCCTTAGGGAAGGGGCTGG - Intergenic
1182095267 22:27621549-27621571 GCAGGGCCTGGGGAAGGGGCTGG - Intergenic
1182280778 22:29216774-29216796 CCACGCAGTGGGGAGGGGTCTGG + Intronic
1182344142 22:29648498-29648520 GCACCAAGTGTGGAAGGGACGGG + Intronic
1182570662 22:31235262-31235284 GAAGGATGTGGGGAAGGGGAAGG - Intronic
1182661166 22:31926188-31926210 GAAGGGAGTGGGGAAGGGGTGGG + Intergenic
1183231883 22:36587611-36587633 GCCAGAAGTTGGGAAGAGGCAGG - Intronic
1183724434 22:39580638-39580660 GAACCATGTGGGGCAGGGGCTGG + Intronic
1183829717 22:40411355-40411377 AGACGGGGTGGGGAAGGGGCTGG - Exonic
1183947194 22:41333111-41333133 GCACAGAGTGGGGAGGGGACGGG + Intronic
1184147007 22:42617684-42617706 GGAAGAAGAGGGGACGGGGCAGG - Intergenic
1184182693 22:42841525-42841547 GCATAAGGTGTGGAAGGGGCAGG - Intronic
1184681697 22:46075559-46075581 GCACGTTGTCGGGGAGGGGCGGG + Intronic
1185151923 22:49168673-49168695 GCAGGAATTCGGGATGGGGCTGG - Intergenic
1185347939 22:50318699-50318721 CCACGGAGTGGGCATGGGGCTGG + Intronic
1185377275 22:50488300-50488322 GCACGACCTGGGGAAGGTCCTGG + Exonic
949366775 3:3290338-3290360 CCTCAAAGTGGGGAAGGGGAAGG - Intergenic
950195666 3:11007517-11007539 GCACAGAGAGGGGAAGGGACTGG + Intronic
950200122 3:11036701-11036723 GCAGGAGGTGGGGATGTGGCTGG + Intronic
950451360 3:13067518-13067540 GCATGCAGTGGGGAAGGGGTGGG + Intronic
950668863 3:14513435-14513457 GGACCAAGTGGGGATGGGGTTGG - Intronic
950765917 3:15272943-15272965 GCACGAGGTGGGGCAGGGGTTGG - Intronic
951247677 3:20359939-20359961 TCAAGAAGTGGGGGAGGGCCAGG - Intergenic
953463962 3:43103619-43103641 GCACCAAGTGGGTCAGAGGCAGG - Intronic
953637967 3:44678570-44678592 GCAGTAAGTGGAGAAGGGACTGG + Intergenic
953734698 3:45482938-45482960 GTAAGAAGTGGGGAAGGGTGGGG + Intronic
954247032 3:49340113-49340135 GCTCGAGGTGGGGCAGGGGCGGG - Intronic
954325485 3:49861153-49861175 GCAGGGGGTGGGGCAGGGGCAGG - Intronic
954558057 3:51533807-51533829 GCCCCAAGTGAGGATGGGGCAGG + Intergenic
954581997 3:51707912-51707934 GGACGCAGTGGGGAAGAGACAGG + Intronic
954634687 3:52065104-52065126 GCAAGAAGTAGTGATGGGGCTGG + Intergenic
954685552 3:52368317-52368339 GCACGCACCAGGGAAGGGGCTGG - Intronic
956710235 3:72032650-72032672 GCAGGATGGGAGGAAGGGGCGGG + Intergenic
957505530 3:81115852-81115874 GCAGGAGGTGGGGGTGGGGCGGG + Intergenic
961566007 3:127763731-127763753 GTAGGAAGAGGAGAAGGGGCGGG - Intronic
961768304 3:129229229-129229251 GCAGGAAGTGGGGAGGGAACTGG - Intergenic
963296710 3:143554687-143554709 GTGGGGAGTGGGGAAGGGGCAGG - Intronic
964065314 3:152570629-152570651 GTAAGAAGTGGGAAAGGGGTAGG - Intergenic
965378314 3:167954854-167954876 ACATAAAGTGGGGAAAGGGCCGG - Intergenic
967298593 3:187990008-187990030 GCAGGAGGTGGGGAGGGGGAGGG - Intergenic
967387710 3:188927625-188927647 AAAGGAAGTGGGGAAGGGGGAGG - Intergenic
967478631 3:189949341-189949363 GCAGGGAGTGGGGGAGGGGAGGG - Intergenic
967525618 3:190489154-190489176 GAACGAAGGGGGGAGGGGGGAGG - Intergenic
967904193 3:194487071-194487093 TCAGGAGGCGGGGAAGGGGCGGG + Intronic
968129678 3:196185523-196185545 GCATGAAGTGGGGTAAGGTCTGG - Intergenic
968602410 4:1516459-1516481 GCACTGAGTAGGGGAGGGGCTGG + Intergenic
968901410 4:3433660-3433682 GCACCACGTGGCGCAGGGGCTGG - Intronic
968933928 4:3600132-3600154 ACACAAACTAGGGAAGGGGCGGG - Intergenic
968961390 4:3746017-3746039 GCAGGGAGTGGGGGAGGGGCGGG + Intergenic
969327305 4:6451472-6451494 GCATGAGGTGGGGCAGGGGCAGG + Intronic
971019080 4:22516130-22516152 GAAAGAGGAGGGGAAGGGGCGGG - Intergenic
971154142 4:24064240-24064262 TAACGAAGAGGGGAGGGGGCTGG + Intergenic
971400803 4:26273721-26273743 GGAAGAAGTGGGGAAGTGGGAGG + Intronic
971480582 4:27111038-27111060 GCCCCAAGTGAGGACGGGGCAGG + Intergenic
971633806 4:29031251-29031273 GGACGAGGAGGGGAAGGGGGAGG - Intergenic
972127564 4:35789057-35789079 GCAAGAGGAGGGGAAGGGGAGGG + Intergenic
972371104 4:38424282-38424304 GCAATTAATGGGGAAGGGGCTGG + Intergenic
973755180 4:54067012-54067034 GCAGGAACTGTGGAAGGTGCTGG - Intronic
973764261 4:54149353-54149375 GCAGGGGGTGGGGAGGGGGCGGG + Intronic
974610846 4:64213807-64213829 GCACAAAGTGGGAAAGGGATGGG + Intergenic
978067264 4:104420947-104420969 GGAGGAAGGGGGGAAGGGGTGGG - Intergenic
978157892 4:105510269-105510291 GCAAGAAGTAGAGAAGTGGCTGG - Intergenic
981602478 4:146506111-146506133 GCACATAGAAGGGAAGGGGCTGG - Intronic
981776079 4:148369082-148369104 GGAAGAAGTGGGGCTGGGGCTGG + Intronic
982404656 4:155006303-155006325 GCAGGAAGTGGCGAAAGGGAAGG + Intergenic
984763695 4:183383779-183383801 GCCAGAAGTGGGGAAAGGCCCGG - Intergenic
985587587 5:748920-748942 GCACTTAGTGAGGAAGGGGTGGG - Intronic
985587605 5:748988-749010 GCACTTAGTGAGGAAGGGGTGGG - Intronic
985587614 5:749024-749046 GCACTTAGTGAGGAAGGGGTGGG - Intronic
985602158 5:841049-841071 GCACTTAGTGAGGAAGGGGTGGG - Intronic
985602168 5:841085-841107 GCACTTAGTGAGGAAGGGGTGGG - Intronic
985602242 5:841351-841373 GCACTTAGTGAGGAAGGGGTGGG - Intronic
985602251 5:841387-841409 GCACTTAGTGAGGAAGGGGTGGG - Intronic
985602261 5:841423-841445 GCACTTAGTGAGGAAGGGGTGGG - Intronic
985602271 5:841459-841481 GCACTTAGTGAGGAAGGGGTGGG - Intronic
985781384 5:1873705-1873727 GGAAGAAGTGGGGGAGGGGAGGG - Intergenic
985790858 5:1926304-1926326 GCAAGAGCAGGGGAAGGGGCAGG - Intergenic
989095507 5:37777788-37777810 GCACCAAATGAGGATGGGGCAGG - Intergenic
990370050 5:55108781-55108803 GAACGTAGTGGGGAAGGAGAGGG - Intronic
992803115 5:80311121-80311143 GCATGAACTGGGGAGGAGGCAGG - Intergenic
995852345 5:116559469-116559491 GCCCCAAGTGCGGATGGGGCAGG - Intronic
996714000 5:126571800-126571822 GCACAAATTGGGGAAGGGGAAGG + Intronic
998160588 5:139810785-139810807 GCTGGCAGTGGGGAAGGGGCAGG + Intronic
998397039 5:141825432-141825454 GCAGGGAGTGGGAGAGGGGCAGG - Intergenic
998415940 5:141946016-141946038 GAACCAAGTGGGGAAGCAGCAGG + Intronic
998473284 5:142399990-142400012 TCACTAAGTGGAGAAAGGGCAGG + Intergenic
999758458 5:154682641-154682663 TCTCGAAGTGGGGGAGGGGAAGG + Intergenic
1001064952 5:168529187-168529209 GCGGGAGATGGGGAAGGGGCAGG + Exonic
1001087098 5:168708196-168708218 GCATGGAGTTGGGAAGGGGCTGG - Intronic
1001362009 5:171096029-171096051 GCTGGAGGAGGGGAAGGGGCTGG + Intronic
1001523583 5:172413143-172413165 GCAGGAAGTGGAGAAAGGCCTGG + Intronic
1001535264 5:172493619-172493641 GCCAGAAGAAGGGAAGGGGCGGG - Intergenic
1001958431 5:175864370-175864392 GCTCAAAGCAGGGAAGGGGCAGG - Intronic
1001959758 5:175872685-175872707 CCACGGGGTGGGGACGGGGCGGG + Intronic
1002193548 5:177490832-177490854 GCAGGAGGTGGGAGAGGGGCTGG + Intronic
1002570234 5:180136007-180136029 ACGGGAAGTGGGGCAGGGGCAGG + Intronic
1004050386 6:12072383-12072405 GCACGAAGTGGGAGAGGGGAAGG - Intronic
1005019926 6:21407682-21407704 GCAAGAAGTGGGGAAGGGGCTGG - Intergenic
1005612073 6:27535962-27535984 TCAAGAAGTGGGGTAGGGGAGGG - Intergenic
1005997472 6:30940122-30940144 GCAGGAAGTGAGGAAGGGAAGGG + Intergenic
1006412915 6:33885683-33885705 CCAGTAAGTGGGGAAGAGGCTGG + Intergenic
1006627938 6:35410855-35410877 GCAGGAACTAGGGAAGGAGCAGG + Intronic
1006750409 6:36373314-36373336 GCAGGAGGTGGGGGTGGGGCGGG + Intronic
1006874800 6:37285914-37285936 GTAAGAAGCGGGGAAGGGCCAGG - Intronic
1006988282 6:38191746-38191768 GCAGGAAGGTGGGAAGGGGCAGG + Intronic
1007227922 6:40327899-40327921 GCCAGAAATGGGGAAGGGGCAGG + Intergenic
1007418883 6:41707520-41707542 GCAGGAGATGGGGATGGGGCAGG - Intronic
1007727313 6:43924308-43924330 GCAGGAAGTGGGGTGGGGGCAGG - Intergenic
1009950943 6:70394866-70394888 GCACCAAATGAGGATGGGGCAGG - Intergenic
1011007173 6:82658934-82658956 TCACGAAGTGAGGAAGAGGAAGG + Intergenic
1012551090 6:100465194-100465216 GCACGACGTCGGGAAGGCCCAGG - Intergenic
1012831503 6:104209042-104209064 GCAGGATGGGGGGAAGAGGCAGG + Intergenic
1015645234 6:135379990-135380012 GGAGGAAGAGGGGAAGGGGAGGG - Intronic
1016356417 6:143223567-143223589 GCATGAAGTGGGGCTGGGGAGGG - Intronic
1017015779 6:150098485-150098507 GCACCAAATGAGGACGGGGCAGG - Intergenic
1017016131 6:150100928-150100950 GCACCAAATGAGGATGGGGCAGG - Intergenic
1017094965 6:150796736-150796758 CTATGAAATGGGGAAGGGGCAGG - Intronic
1017442271 6:154475285-154475307 GGACGAGGTGGAGAAGGGCCAGG - Intronic
1017491140 6:154946215-154946237 GCTGGGAGTGGGGAAGGGGAGGG - Intronic
1017719001 6:157232159-157232181 GCCAGAGCTGGGGAAGGGGCAGG + Intergenic
1017907946 6:158769632-158769654 GCAGCTGGTGGGGAAGGGGCTGG - Intronic
1018791147 6:167148721-167148743 GTAGGAATTGGGGAAGAGGCTGG - Intronic
1019327525 7:445689-445711 GCCCGCAGTGGGGAAGGGGCAGG - Intergenic
1019356800 7:584425-584447 GCAGGGAATGGGGAAGAGGCCGG + Intronic
1019426226 7:978219-978241 GTAAAAAGTGGGGAAGGGGCTGG + Intergenic
1019455881 7:1127264-1127286 GCACCAAGTGGCGAAGGAGCCGG - Exonic
1019588997 7:1819697-1819719 GCACGGAGTGAGGGAGGGGTGGG + Intronic
1021231416 7:18089717-18089739 ACACTCAGTGGGGAAGGTGCAGG + Intronic
1021894898 7:25224064-25224086 GCCTAAAGTGGGAAAGGGGCAGG - Intergenic
1022307330 7:29159607-29159629 GCACGAAGCGGGGAAGGAGGAGG - Intronic
1024011102 7:45267424-45267446 GCAGGGCGTGGGGAAGAGGCTGG + Intergenic
1024294292 7:47830388-47830410 GCACAGAGAGGGGAAGGGGGAGG + Intronic
1024637212 7:51300837-51300859 GCCAGAAGTGGGGAAAGGGTGGG - Intronic
1026035165 7:66825269-66825291 GCAAGAAGTGGGACAGGGTCTGG - Intergenic
1026223351 7:68419366-68419388 TCAAGAGGTGGGGAAGGGGGAGG - Intergenic
1026909353 7:74083581-74083603 GAATGAAGGGCGGAAGGGGCGGG + Intronic
1026984373 7:74545814-74545836 GCAAGAAGTGGGACAGGGTCTGG + Intronic
1027137051 7:75631914-75631936 GCAGGAAATGGGGAAGTGGGAGG + Intronic
1027175338 7:75899542-75899564 CCTGGAAGTGGGGAAGGGGCTGG + Intronic
1028343847 7:89756120-89756142 GGACAAAGTGGGGAAAGGGAGGG - Intergenic
1029686990 7:102155845-102155867 GCAGGGAGTGGGGAAGGGTCAGG - Intronic
1030407516 7:109133038-109133060 GCACTAACTTGGGAAGAGGCTGG + Intergenic
1031483507 7:122304281-122304303 GCAGGAAGTGGGGGACTGGCAGG + Exonic
1031987570 7:128173071-128173093 CCACAAAGTGAGGGAGGGGCTGG - Intergenic
1033453131 7:141479174-141479196 TCATATAGTGGGGAAGGGGCAGG + Exonic
1033665509 7:143437129-143437151 GCAGGGAGTGGGTAAGGTGCCGG + Intergenic
1034336161 7:150324837-150324859 GCAGGAAGTGGGGGAGAAGCAGG - Intronic
1034345248 7:150381855-150381877 GTAGGAAGAGGGGAAGGGTCAGG + Intronic
1034345957 7:150385175-150385197 GCGAGCAGTGGGGAAGGGGGCGG - Intronic
1034503654 7:151468285-151468307 GCAAGAAGTGGTTAAGGGACAGG - Intronic
1034895880 7:154876041-154876063 GCACGAAGTGAGGCGGCGGCTGG + Exonic
1034964906 7:155384829-155384851 ACTCGGAGTGGAGAAGGGGCAGG + Intronic
1035873195 8:3157712-3157734 GCATCCAGTGGGGAAGGTGCAGG + Intronic
1035917970 8:3645487-3645509 GGAAGAAATGGGGAAGGGGAAGG + Intronic
1036662463 8:10716846-10716868 GGGTGAAGCGGGGAAGGGGCCGG - Intergenic
1036739730 8:11349053-11349075 GTTAGAAGTGGGGAGGGGGCAGG + Intergenic
1037586555 8:20280678-20280700 GCAGGGAGGGAGGAAGGGGCAGG + Intronic
1037805621 8:22056748-22056770 GCTGGAAGTGGGGAGGGCGCGGG + Intronic
1038136202 8:24789032-24789054 GCAGGAAGTGGGAAATGGGGAGG - Intergenic
1038596432 8:28890498-28890520 GCAGGAAGAGGAGAAGGGGGAGG - Exonic
1038699093 8:29832931-29832953 GCACAAAGTGGGGAACTGGATGG + Intergenic
1038848782 8:31254488-31254510 CCAGGGAGTGGGGAATGGGCAGG - Intergenic
1039487378 8:37921631-37921653 GAACCCAGTGGGGAAGGGGTGGG - Intergenic
1041360580 8:57049437-57049459 GCTCAGAATGGGGAAGGGGCAGG - Intergenic
1041708598 8:60872727-60872749 TCACAAAGTGGGCTAGGGGCTGG - Intergenic
1043502268 8:80869895-80869917 GCAGTAAGTAGGGAAGGGGAGGG + Intronic
1043577355 8:81673371-81673393 ACTAGAAGTGGGGAAGGGGGCGG - Intronic
1043856756 8:85273712-85273734 GCCCCAAGTGAGGATGGGGCAGG - Intronic
1043857394 8:85277743-85277765 GCCGGAAGTGAGGACGGGGCAGG + Intronic
1044612909 8:94112135-94112157 GCAGGAGGTGGGGTAGGGGGAGG + Intergenic
1045031548 8:98141384-98141406 ACAGGAGGTGGGTAAGGGGCTGG + Intronic
1045269183 8:100647755-100647777 GCTTGAGGTGGGGAAGGGGCAGG - Intronic
1047537684 8:125734489-125734511 GCAGGAAGAGGGGAAGGGAGAGG - Intergenic
1048002716 8:130392793-130392815 GAAGGAGGTGGGGGAGGGGCTGG + Intronic
1049003864 8:139842660-139842682 GCAGGGGGTGGGGAGGGGGCGGG + Intronic
1049451504 8:142664510-142664532 GCAGGAAGTGGGGCAGCTGCGGG - Exonic
1049533339 8:143167211-143167233 GGAGGAAGTGGAGAAGGGGAAGG + Intergenic
1049533699 8:143168402-143168424 GGAGGAAGTGGAGAAGGGGAAGG + Intergenic
1049597171 8:143490098-143490120 GCAGGTACTGGGGATGGGGCAGG + Intronic
1049687940 8:143946444-143946466 GCAGGAAGGAGGGAAGGGGTGGG + Intronic
1049862203 8:144907163-144907185 GCACTTTGTGGGGAAGAGGCAGG - Intergenic
1050482043 9:6097477-6097499 GCTCAGAATGGGGAAGGGGCAGG - Intergenic
1050487524 9:6149616-6149638 GCACCAAATGAGGATGGGGCAGG - Intergenic
1050568436 9:6912177-6912199 GCAGGAAAGGAGGAAGGGGCAGG - Intronic
1051119590 9:13737498-13737520 GAAGGAAGGGAGGAAGGGGCAGG - Intergenic
1053215776 9:36269301-36269323 GTACGCAGAGGGGCAGGGGCAGG - Intronic
1054456229 9:65431846-65431868 ACACAAACTAGGGAAGGGGCAGG + Intergenic
1054891447 9:70256862-70256884 GCACCAAGTGTGGAAGTGGAAGG - Intergenic
1055508554 9:76971631-76971653 GCAGGAAGAGGGTAAGGGGGAGG - Intergenic
1056705426 9:88948621-88948643 GCACAGTGTGGGGGAGGGGCAGG + Intergenic
1056716782 9:89037966-89037988 GCACCCAGTGGGGGTGGGGCCGG - Intronic
1057164880 9:92917581-92917603 GCAAGAAAAGGGGAAGTGGCTGG - Intergenic
1057420166 9:94905868-94905890 GCAGGGAGTGCAGAAGGGGCTGG + Intronic
1057773098 9:97984228-97984250 GCGCGGAGCGGGGGAGGGGCGGG + Intronic
1058670933 9:107359893-107359915 GGAAGAAGCGGGGAAGGGGAGGG + Intergenic
1059819347 9:117955020-117955042 GGACGATGTGGAGAAAGGGCTGG + Intergenic
1060444798 9:123678051-123678073 ACATGAAGTGGGGATGGGGAGGG - Intronic
1060453486 9:123766186-123766208 GCAAGAAGTGGGCAAGTGGGAGG - Intronic
1061623691 9:131827900-131827922 GCATGATGTGGGGCAGGGGGAGG + Intergenic
1061632758 9:131883527-131883549 GCACAAAGTGGGGAAGGGGCAGG + Intronic
1061940256 9:133880162-133880184 GTGCCAAGTGGGCAAGGGGCTGG - Intronic
1062207645 9:135346164-135346186 GCAAAAAGTGGAGAAGGAGCAGG - Exonic
1062281454 9:135753752-135753774 GCAGTAGGTGGGGAGGGGGCAGG + Intronic
1062326843 9:136016606-136016628 GCACCAAGTAGGGATGGGGCAGG - Intronic
1062504357 9:136865760-136865782 GCAGGAGGTGGGGACGGGGACGG - Intronic
1062601418 9:137320211-137320233 GCAGGACGTGGGGAAGGGGCGGG - Intronic
1062607873 9:137356113-137356135 GCACGAGCTGGGCAAGAGGCAGG + Intronic
1062710589 9:137973089-137973111 GCAGGCAGTGGGGTAGGGGTAGG + Intronic
1203772653 EBV:57516-57538 GGAAGAAGTGGAGAAGGAGCCGG + Intergenic
1203772664 EBV:57567-57589 GGAAGAAGTGGAGAAGGAGCCGG + Intergenic
1185501496 X:600085-600107 GCAGGAGCTGGGGAAGAGGCAGG - Intergenic
1186375342 X:8992547-8992569 GTGCCAAGTGGGGAAGGGGTGGG + Intergenic
1186693624 X:12005787-12005809 GTGCCAAGTGGGGAAGGGGTGGG + Intergenic
1187018046 X:15350205-15350227 GGACATAATGGGGAAGGGGCTGG - Intronic
1188800080 X:34518593-34518615 ACAGGAAATGGCGAAGGGGCTGG + Intergenic
1189433825 X:40973386-40973408 GCACTAAGTGGGGATGGGGTGGG + Intergenic
1190245717 X:48688956-48688978 GGAGGGAGTGGGGGAGGGGCTGG - Exonic
1190253840 X:48747824-48747846 GCAGGAGGTAGGGCAGGGGCAGG - Intergenic
1190937091 X:55007174-55007196 GGCCAAAGTGGTGAAGGGGCAGG + Exonic
1192233775 X:69283635-69283657 GCATGTATTGGGGATGGGGCAGG + Intergenic
1195278845 X:103310502-103310524 GCCCGGCGTGGGGAAGGGGCCGG - Intronic
1195315618 X:103674839-103674861 AGACGAAGAGGGGAAGGGACGGG - Intergenic
1199057127 X:143310014-143310036 GCACGCATTGGGGAAGAGACCGG - Intergenic
1199966336 X:152823987-152824009 GGAGGTGGTGGGGAAGGGGCAGG - Intergenic
1199986871 X:152959139-152959161 CCACAAAGGGGGGAAGGGCCAGG - Intronic
1200759881 Y:7028008-7028030 GCAGGAAGTGGGTATGGGGGTGG + Intronic