ID: 1079130804

View in Genome Browser
Species Human (GRCh38)
Location 11:17745837-17745859
Sequence GCACGAAGTGGGGAAGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 2, 2: 4, 3: 54, 4: 471}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079130804_1079130811 -4 Left 1079130804 11:17745837-17745859 CCGGCCCCTTCCCCACTTCGTGC 0: 1
1: 2
2: 4
3: 54
4: 471
Right 1079130811 11:17745856-17745878 GTGCTTTGCTCTTTTCTCCTTGG 0: 1
1: 0
2: 5
3: 55
4: 960

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079130804 Original CRISPR GCACGAAGTGGGGAAGGGGC CGG (reversed) Intronic