ID: 1079130865

View in Genome Browser
Species Human (GRCh38)
Location 11:17746227-17746249
Sequence GGGGGTCCAAACCCCAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079130856_1079130865 21 Left 1079130856 11:17746183-17746205 CCTGGAGCAGCGAATAACAGGCA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1079130865 11:17746227-17746249 GGGGGTCCAAACCCCAATCCAGG 0: 1
1: 0
2: 0
3: 8
4: 94
1079130852_1079130865 29 Left 1079130852 11:17746175-17746197 CCCCTGAGCCTGGAGCAGCGAAT 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1079130865 11:17746227-17746249 GGGGGTCCAAACCCCAATCCAGG 0: 1
1: 0
2: 0
3: 8
4: 94
1079130853_1079130865 28 Left 1079130853 11:17746176-17746198 CCCTGAGCCTGGAGCAGCGAATA 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1079130865 11:17746227-17746249 GGGGGTCCAAACCCCAATCCAGG 0: 1
1: 0
2: 0
3: 8
4: 94
1079130854_1079130865 27 Left 1079130854 11:17746177-17746199 CCTGAGCCTGGAGCAGCGAATAA 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1079130865 11:17746227-17746249 GGGGGTCCAAACCCCAATCCAGG 0: 1
1: 0
2: 0
3: 8
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079130865 Original CRISPR GGGGGTCCAAACCCCAATCC AGG Intronic
902482023 1:16717078-16717100 AGGGGTCCAGACCCCCATTCAGG - Intergenic
902516810 1:16993897-16993919 GGGCCTCCAAACCCCAGGCCCGG + Intronic
905323411 1:37133321-37133343 GGTGGTCCAAACCAGAAGCCTGG - Intergenic
907280530 1:53344235-53344257 GGAGGCCCAAACCCCCAACCCGG + Intergenic
908172978 1:61526425-61526447 AGTGGTCCAAACCCAAAACCTGG + Intergenic
908869891 1:68597430-68597452 GGGGTTCAAAACCCCAGTTCAGG + Intergenic
909556829 1:76963525-76963547 GGGTGTCCAAATCACAAGCCTGG + Intronic
909867046 1:80686404-80686426 GAGGATGCAAACCCCAAGCCTGG - Intergenic
911091643 1:94022130-94022152 AGGAGTCCAAACCCTCATCCTGG + Intronic
915524512 1:156467699-156467721 GGGGGTGCATACCCAAAGCCTGG - Intronic
1062972883 10:1662043-1662065 GGAGGTCCACACCCTAAGCCCGG + Intronic
1063007578 10:1988210-1988232 GTGGGTTCAAATCCCAATTCTGG - Intergenic
1072319535 10:94235000-94235022 CGGGGACCAAACCCAAATCTAGG + Intronic
1075165801 10:120067215-120067237 GGGGATGCAAAGCCCTATCCAGG + Intergenic
1079130865 11:17746227-17746249 GGGGGTCCAAACCCCAATCCAGG + Intronic
1084365614 11:68695877-68695899 GGTGGCCCAAACCCCAACCAGGG + Intergenic
1089617193 11:119701589-119701611 GGGATTCCAAAGCCCAAACCTGG + Intronic
1096572406 12:52531232-52531254 GGAGTTCTAACCCCCAATCCTGG + Intergenic
1101421603 12:104555642-104555664 GTGGGGCCCAACCCCCATCCTGG - Intronic
1104595655 12:130118500-130118522 GGGGATCCAAACCCTAATCTGGG - Intergenic
1106013965 13:25850598-25850620 GGGGGACAAAACCCCAAACCGGG - Intronic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1113719738 13:112546043-112546065 GGAGGTCCAGACTCCAACCCTGG + Intronic
1113949745 13:114065411-114065433 GAGGAACCAAACCCCAAACCGGG + Intronic
1114917805 14:27289111-27289133 GAGGGTGCAAGCCCCAAGCCTGG - Intergenic
1120060673 14:79978723-79978745 GAGGGTGCAAGCCCCAACCCTGG + Intergenic
1123782874 15:23644955-23644977 GGAGGTCCAAAGCCCTATCCAGG - Exonic
1124063063 15:26313226-26313248 AGAGGCCCAAACCCCAAGCCTGG + Intergenic
1129269361 15:74411294-74411316 GAGTGTCCCAACCCCAAACCAGG - Exonic
1132435341 15:101796430-101796452 GGGTTTCCCACCCCCAATCCGGG - Intergenic
1136318349 16:29466853-29466875 GGGGGTCGGACCCCAAATCCAGG - Exonic
1136432924 16:30206202-30206224 GGGGGTCGGACCCCAAATCCAGG - Exonic
1136712931 16:32254416-32254438 GGGGGTCCAAGCGGCACTCCTGG - Intronic
1136997559 16:35201227-35201249 GGGTGTCCGCATCCCAATCCAGG - Intergenic
1137010291 16:35314429-35314451 GGGAGTCCACACCCCCATCCAGG - Intergenic
1142421853 16:89975746-89975768 TGGGTTCCAAACCCCCATCGGGG + Intergenic
1203057126 16_KI270728v1_random:935352-935374 GGGGGTCCAAGCGGCACTCCTGG + Intergenic
1143598067 17:7927569-7927591 TGTTGTCCAAACCCCTATCCAGG + Intronic
1144203716 17:12964365-12964387 TGGAGTCCAAAGCCCAATGCTGG - Intronic
1145899918 17:28483921-28483943 GGGCTTCCAAACCCTAAGCCAGG - Intronic
1152546740 17:81004098-81004120 GGGGGTGCGAGCCCCACTCCCGG - Intronic
1156078409 18:33307812-33307834 GAGGGTGCAAGCCCCAAGCCTGG + Intronic
1158028228 18:52929246-52929268 GGGGATCCAGATCCAAATCCAGG + Intronic
1160875625 19:1295139-1295161 GGGGTTGCACACCCCAATCACGG - Intronic
1163125143 19:15240475-15240497 GGGGGTGCAAGACCCAGTCCTGG + Intronic
1164919436 19:32077780-32077802 GAGGCTCCTAATCCCAATCCAGG + Intergenic
1166542396 19:43614164-43614186 TGGGGGCCAAACCCTAAGCCAGG + Exonic
1167277164 19:48545497-48545519 GGGCGTCCAAATCCCAAGTCAGG - Intergenic
1167906413 19:52664628-52664650 GGGGTTCCACCCCCCAGTCCTGG - Intronic
926611923 2:14955664-14955686 GAGGGTGCAAGCCCCAAGCCTGG - Intergenic
929211261 2:39359748-39359770 GAGGGTGCAAGCCCCAAGCCTGG - Intronic
930220007 2:48736539-48736561 AGGGGCCCAAGCCCCAATCCTGG - Intronic
932594634 2:73086458-73086480 GGGAGTCCAAGCCCAAAGCCTGG + Intronic
932761637 2:74441938-74441960 GGGGCTCCAAACCCCGCCCCCGG + Intronic
935175857 2:100648223-100648245 GAGGGTCCAACCCTCAAGCCTGG + Intergenic
936152922 2:110031412-110031434 GGGGCTCCAGACCCCACTCAGGG + Intergenic
936191758 2:110340000-110340022 GGGGCTCCAGACCCCACTCAGGG - Intergenic
939668299 2:144977808-144977830 GGGGTTTCAAACCCAACTCCTGG - Intergenic
942644509 2:178095819-178095841 GAGGGTGCAAGCCCCAAGCCTGG - Intronic
948869723 2:240791929-240791951 GGGGGTCCCAGCCCCAGTGCAGG - Intronic
1168884700 20:1240625-1240647 CGGTGTCCAACCCCCAATTCTGG - Intronic
1168962713 20:1879991-1880013 CGGGATTCAAACCCCCATCCAGG - Intergenic
1170924636 20:20712223-20712245 GGGGGTCCAAGCCCAGATCCAGG + Intronic
1174803039 20:53581345-53581367 GGCTCTCCAAACCCCATTCCTGG + Intronic
1182189367 22:28442840-28442862 GGGGCCCCAAAGCCCAACCCGGG - Intronic
952264518 3:31772552-31772574 GGGGGTTCAAATCCCAGTGCTGG - Intronic
953398453 3:42591141-42591163 GGGGGACCGAACCCCATGCCGGG - Intronic
959940679 3:112077670-112077692 GGTGGACCAAATCCAAATCCTGG - Intronic
960937838 3:122913983-122914005 CGGGGTCCACGCCCCATTCCTGG + Exonic
975942132 4:79660434-79660456 GAGGGTACAAGCCCCAAGCCTGG + Intergenic
986687968 5:10290343-10290365 GGTGCTCCTAACCCCATTCCTGG - Intronic
989186575 5:38632075-38632097 GAGGGTCCCACCCCAAATCCTGG + Intergenic
990788981 5:59455373-59455395 GAGGGTGCAAACCCCAAGCTTGG + Intronic
991535902 5:67669193-67669215 GAGGGTGCAAGCCCCAAGCCTGG + Intergenic
992206475 5:74435091-74435113 TGGGCTCCAAACCCCATGCCAGG - Intergenic
998369017 5:141649463-141649485 TGGGGGCCAAACCCGACTCCAGG - Exonic
1001934131 5:175692700-175692722 GGGGGTCCTGACCCTAAGCCTGG + Intergenic
1002500298 5:179643576-179643598 CAGGGTCTAATCCCCAATCCCGG - Intronic
1006097046 6:31662507-31662529 CGGGGTCCCAGCCCCATTCCTGG + Exonic
1007419661 6:41712023-41712045 GGGGGTCCAGTCCCCAGCCCCGG + Intronic
1015110722 6:129588892-129588914 GAGGGTGCAAACCCCAAGCCTGG - Intronic
1016175225 6:141071612-141071634 GAGGGTGCAAGCCCCAAGCCTGG + Intergenic
1016454522 6:144216605-144216627 GTGGGTTCGAACCCCACTCCTGG + Intergenic
1018059429 6:160078991-160079013 GGGGTTCCGTACCCCAGTCCAGG - Intronic
1019658144 7:2208974-2208996 GGGTGTCCACACCACACTCCCGG + Intronic
1022500218 7:30878075-30878097 GGGGGTCCAGCACCCAAGCCTGG + Intronic
1025806538 7:64838631-64838653 GGGCCCCCAAACCCCTATCCAGG - Intergenic
1029411183 7:100412130-100412152 GGGGTCCCAAAGCCCAATCATGG + Intronic
1034734067 7:153412625-153412647 GGGCCCCCAAACCCCTATCCAGG - Intergenic
1035741453 8:1930967-1930989 GGGGGTGCAGACCGGAATCCAGG - Intronic
1035848922 8:2894317-2894339 GGATTTCCAAACCCCAATACAGG + Intergenic
1036398882 8:8390841-8390863 GGGGCTCCAAACACCACTTCTGG - Intergenic
1041984834 8:63909413-63909435 AGGTGCCCAAACCCCAATTCTGG + Intergenic
1042958879 8:74281621-74281643 GGGAATCCAAACTCCAAGCCTGG + Intronic
1053007050 9:34611648-34611670 GGGGGGCTAAGCCCCAGTCCTGG - Intronic
1057285356 9:93749166-93749188 GAGGGTTCAAGCCCCAAGCCTGG - Intergenic
1057757996 9:97852767-97852789 TGGTTTCCAAACCCCAATCGTGG - Intergenic
1062337872 9:136080331-136080353 GGGCATCCAAAACCCAACCCAGG + Intronic
1186458129 X:9727040-9727062 TGGGGTCGAAACCCCAAACCAGG - Intronic
1194435052 X:93859916-93859938 GAGGGTGCAAGCCCCAAGCCTGG + Intergenic
1198807391 X:140505113-140505135 GGCGGACCAAGCCCCAACCCCGG - Exonic
1201770150 Y:17611225-17611247 GGGCCCCCAAACCCCTATCCAGG + Intergenic
1201831404 Y:18294762-18294784 GGGCCCCCAAACCCCTATCCAGG - Intergenic