ID: 1079131409

View in Genome Browser
Species Human (GRCh38)
Location 11:17748930-17748952
Sequence GTGTGGGGCTGGAGAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 855
Summary {0: 1, 1: 1, 2: 9, 3: 106, 4: 738}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079131401_1079131409 1 Left 1079131401 11:17748906-17748928 CCCATACACGGTTCTCTGAGCTG 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG 0: 1
1: 1
2: 9
3: 106
4: 738
1079131402_1079131409 0 Left 1079131402 11:17748907-17748929 CCATACACGGTTCTCTGAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG 0: 1
1: 1
2: 9
3: 106
4: 738
1079131398_1079131409 21 Left 1079131398 11:17748886-17748908 CCCAGCAGGAGATGGTGGGTCCC 0: 1
1: 0
2: 3
3: 19
4: 192
Right 1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG 0: 1
1: 1
2: 9
3: 106
4: 738
1079131399_1079131409 20 Left 1079131399 11:17748887-17748909 CCAGCAGGAGATGGTGGGTCCCA 0: 1
1: 0
2: 1
3: 14
4: 219
Right 1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG 0: 1
1: 1
2: 9
3: 106
4: 738

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079131409 Original CRISPR GTGTGGGGCTGGAGAGAAGT TGG Intronic
900117745 1:1035693-1035715 GGGTGGGGCTGGACAGAGGCTGG + Intronic
900360032 1:2284018-2284040 GTCTGGGTCTGGGGAGAAGATGG - Intronic
901317214 1:8317358-8317380 GTGTGGGGCTGCAGAGGCGCTGG - Intergenic
901442849 1:9290067-9290089 GTGTGGGGGTGGGGTGGAGTTGG + Intergenic
901453811 1:9352076-9352098 GTGAGGGGGTGGAGGGAAGGTGG + Intronic
901653819 1:10757878-10757900 TTGTGTGCCTGGGGAGAAGTTGG - Intronic
902527254 1:17067325-17067347 CTCTGGGGCTGGAGAGATCTGGG + Exonic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902837442 1:19056082-19056104 GTGGAGGGCTGGGGAGATGTTGG + Intergenic
903540246 1:24092690-24092712 GTGTGGGGCTGGAGTGATTCTGG - Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903672919 1:25047020-25047042 GTGTGGGTCTGCAGAGCAGCTGG - Intergenic
903764163 1:25722780-25722802 ATGTGGGGCAGAAGAGAAGATGG + Intronic
904989110 1:34577181-34577203 GTGTGGGGCTGGGGAGGTGTTGG - Intergenic
905105895 1:35563427-35563449 GTGAGGGGCTCGGGAGAGGTGGG + Intronic
905120587 1:35678830-35678852 GTGTGGGCCTGTAGGGGAGTGGG - Intergenic
905630170 1:39514180-39514202 GGCTGGGGCTGGAGAGAACCCGG + Intronic
905667590 1:39772010-39772032 GGCTGGGGCTGGAGAGAACCCGG - Intronic
905848099 1:41251013-41251035 GTGGGAGGCGGGAGAGAAGCAGG - Intergenic
905935574 1:41821519-41821541 GTTTGGGGCTGGGGTGGAGTAGG - Intronic
906259851 1:44378566-44378588 GTATAGGGCTGGACAGAAATAGG - Intergenic
906781050 1:48573143-48573165 GGAGGGGGCTGGGGAGAAGTTGG - Intronic
906931083 1:50170159-50170181 TTGTGGGGCATGAGAGAAGAAGG + Intronic
906947817 1:50310435-50310457 GTGTGTGTCAGGAGAGAGGTTGG - Intergenic
907077710 1:51593443-51593465 GGGTGAGGCTGGAGAGCAGGTGG - Intronic
907147065 1:52244425-52244447 GGGTGGGGCTAGACAGAGGTTGG + Intronic
907476422 1:54708898-54708920 GTGTGGGGCTGGAGGATAATGGG + Intronic
907783890 1:57593156-57593178 GTCAGGGGCTGGGGAGAAGGAGG - Intronic
909432331 1:75603622-75603644 GGGTGAGGCTGCAGAGAAATGGG - Intronic
910653772 1:89599431-89599453 GTGGAGAGCTGGACAGAAGTGGG - Intergenic
910768411 1:90806443-90806465 GTGTGGGGGTGGGGAGTAGGGGG + Intergenic
910863851 1:91769411-91769433 GTGTGTGCCCAGAGAGAAGTTGG - Intronic
911575665 1:99574417-99574439 ATGTGGGGCTAGGGAGAAGTGGG + Intergenic
912689324 1:111792451-111792473 GGGTGGGGCTAGAGAGAGGATGG + Intronic
912696942 1:111848967-111848989 GGGAGGGGCAGGAGAGAACTGGG - Intronic
914213624 1:145604797-145604819 GGGTGGGGTTGGAGAGATGTTGG + Intergenic
914676182 1:149909124-149909146 GTGTGGGCTGGGAGAGAGGTGGG - Intronic
915327612 1:155088772-155088794 GTGTGGGGTGGGAGAGCAGGTGG + Intergenic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915729150 1:158040793-158040815 GTGGGGGGCTGAAGATAAGATGG + Intronic
915858298 1:159414221-159414243 GGGTGGTGATGAAGAGAAGTTGG - Intergenic
916177442 1:162054342-162054364 GTGTGGGGTGGGAGAGGAGGAGG + Intergenic
917471999 1:175333954-175333976 GTTTGGTGTTGGAGAGGAGTCGG + Intronic
917727254 1:177839590-177839612 GTGTCGGGGTGGAGAGGAGAAGG - Intergenic
918136924 1:181681945-181681967 AAGTGTGGCTGAAGAGAAGTAGG - Intronic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918663134 1:187114260-187114282 GTAGGGGGCTGGAGAGGAGGTGG + Intergenic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919595745 1:199559991-199560013 GTGGGGGGATGGAGAGAGGTTGG + Intergenic
919819504 1:201464178-201464200 GGGCGTGGCTGGAGAGAAGAGGG - Intergenic
920761395 1:208786782-208786804 GTGTGGGGCAAGAAAGAAGGAGG - Intergenic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921395401 1:214663728-214663750 CTTTGGGGCTGGGGACAAGTCGG - Exonic
922223651 1:223627359-223627381 GGGGGTGGCTGGAGAGAGGTTGG - Intronic
922318035 1:224459610-224459632 GGGTGGGGGTGGAGTGAAGCTGG + Intronic
922672785 1:227525624-227525646 GTGGGGGGCTAGAGGGATGTGGG - Intergenic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923196313 1:231671532-231671554 GTGTTGAGCTGGGGAGAAGAAGG - Intronic
923570328 1:235107704-235107726 CAGTGAGGCTGGAAAGAAGTGGG + Intergenic
924073847 1:240312188-240312210 GTGGGTGGCTGGAGAGCAGAGGG - Intronic
924257386 1:242195935-242195957 GTGAGGGGCTGAAGAGAAGAGGG + Intronic
924292270 1:242548565-242548587 GTGAGGAGATGGAGAGATGTGGG + Intergenic
1062764062 10:48088-48110 GTGTGGGGCCGGAAACAACTGGG - Exonic
1063487162 10:6430686-6430708 GAGTGGGGCTGGTGGGGAGTTGG + Intronic
1064250695 10:13704419-13704441 GGGTCTGGCTGGAGGGAAGTGGG - Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1066348247 10:34610886-34610908 GTGTGGTGATGGGGAGAGGTGGG + Intronic
1067092620 10:43276630-43276652 GGGTGGGGCTGGGGAGATGTTGG - Intergenic
1067295528 10:44973289-44973311 GTGTAGGCCTGGAGAGAGTTGGG + Intronic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067758844 10:49027600-49027622 GGGTCGGGCTGGAGGGAAGGTGG - Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068559716 10:58500074-58500096 ATGTTGGGATGGAGAGAATTAGG - Intergenic
1068922439 10:62498809-62498831 GTGGGGGGGTGGAGGGCAGTGGG + Intronic
1069291649 10:66787421-66787443 GGGTGAGGTTGGACAGAAGTTGG + Intronic
1069867415 10:71512353-71512375 GCCTGGGGCGGGAGAGAACTGGG + Intronic
1070495293 10:77015836-77015858 GAGTGGAGGTGGAGAGAGGTGGG - Intronic
1071067263 10:81650741-81650763 TTGTGGGGTTAGAGAGATGTTGG - Intergenic
1071178536 10:82955998-82956020 GAATTGGGCTGGGGAGAAGTTGG - Intronic
1071337294 10:84611399-84611421 GTGTGGGGAGGGAGAGCATTAGG + Intergenic
1071571574 10:86700195-86700217 CTGTGGGGCAGGAGAGCAGCAGG - Intronic
1071755445 10:88533608-88533630 TTGTGAGGATGGAGTGAAGTGGG + Intronic
1073119138 10:101111009-101111031 GGGTGGGGGTGGAGAAAAGTAGG + Intronic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1073926774 10:108525605-108525627 GTCAGGGGCTGGAGAGAAATAGG + Intergenic
1074445511 10:113518117-113518139 CTGTGGGGCTGCAGAGAGTTGGG + Intergenic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1074958107 10:118412286-118412308 GAATGGGGCTGGGGAGGAGTGGG + Intergenic
1075383384 10:122037208-122037230 CGGTGTGGCTGGAGAAAAGTGGG + Intronic
1075509976 10:123064230-123064252 CTGGGGTGCTGGGGAGAAGTTGG - Intergenic
1075598602 10:123750357-123750379 TTGTGTGGCTGGAGAGAGGCCGG - Intronic
1075919059 10:126195103-126195125 GCTTGGGGGTGGAGAGATGTGGG + Intronic
1076364645 10:129914191-129914213 GTGCAGGGCTGGAGGGAGGTGGG - Intronic
1077054493 11:584348-584370 GTTGGGGGCTGGAGTGAAGGTGG + Intronic
1077243441 11:1524111-1524133 GGGTGGGGCTGGAGAGAGACAGG + Intergenic
1077279648 11:1736850-1736872 GAGTGGAGCTGGAAAAAAGTTGG + Intronic
1077332336 11:1989137-1989159 GGGTGTGTCTGGAGAGAAGGGGG + Intergenic
1077743996 11:4880239-4880261 TTATGGGACTGAAGAGAAGTTGG + Intronic
1077860483 11:6173786-6173808 GTCAGGAGCTGCAGAGAAGTGGG - Intergenic
1079032247 11:16994479-16994501 GGGTGGGGCTGGACATAGGTTGG - Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079152509 11:17913248-17913270 GTGTGGGGCTGGAAGAAAGTGGG - Intronic
1080475043 11:32582880-32582902 GCCAGGGGCTGGAGAGAGGTGGG + Intergenic
1080815519 11:35752647-35752669 GCATGGGGATGGAGAGAGGTAGG - Intronic
1080840382 11:35978296-35978318 GTGTGAGGCTGGAGACAGGCAGG - Intronic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081713578 11:45233407-45233429 CTGTGGGGGTGGGGAGAGGTAGG - Intronic
1082684275 11:56219462-56219484 GTGTGGGGGTGGAGCCAAGATGG + Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083173583 11:60936494-60936516 TTGTGGGGCTGGGGGGAGGTGGG - Exonic
1083192376 11:61061592-61061614 GGGTGGGGCGGGAGGGAGGTGGG - Intergenic
1083293954 11:61705306-61705328 GTGCGAGGGTGAAGAGAAGTGGG - Intronic
1083614689 11:64020557-64020579 GTCTGGGGCTGGAGAGCATGGGG - Intronic
1083827764 11:65212796-65212818 GTGAGGGGCTGGAGGGCAGGAGG + Intergenic
1083993452 11:66260402-66260424 GTGTGAAGCTGGAGCAAAGTGGG + Intronic
1084032704 11:66490467-66490489 GAGGGGAGCTGGAGTGAAGTTGG - Intronic
1084097092 11:66918708-66918730 GTGTGGGTATAGAGATAAGTAGG + Intronic
1084157367 11:67321409-67321431 CTGTGGAGCGGGAGTGAAGTGGG - Intronic
1084258193 11:67956571-67956593 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1084734592 11:71096331-71096353 GTGTGGGGATTGAGACCAGTTGG + Intronic
1084972911 11:72781366-72781388 GTGGGGAGCTGGAGAGAGGTAGG + Intronic
1085447535 11:76610707-76610729 GTGTAGGGTGGGGGAGAAGTGGG + Intergenic
1085498916 11:76999604-76999626 AGGTGGGGCAGGAGGGAAGTAGG - Intronic
1085518861 11:77126635-77126657 GTGTGGTGGTGGGGAGAAGCAGG + Intergenic
1085839695 11:79997171-79997193 GTGGGGGGGTGGAGAGAAAGTGG + Intergenic
1086096597 11:83056174-83056196 GCTGGGGGCAGGAGAGAAGTGGG - Intronic
1086133405 11:83423052-83423074 TTTTGGGGGTGGACAGAAGTTGG - Intergenic
1086303118 11:85451292-85451314 GTCTGCTGTTGGAGAGAAGTGGG - Intronic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1086855698 11:91862482-91862504 GTGCAGGGCTGGGGAGAAGTTGG + Intergenic
1087034486 11:93742180-93742202 GTGTGGGGCAGGGGGGATGTAGG - Intronic
1087045852 11:93843283-93843305 GTGTGTTGCTGGAGAGAAACAGG - Intronic
1088061301 11:105654206-105654228 TGGTGGGGCTGGAAAGATGTTGG + Intronic
1089240495 11:117074331-117074353 TTGTGGGGCTGTAGGGAAGTGGG - Intronic
1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG + Intronic
1089580350 11:119477795-119477817 GTCTGGGGGTGAAGAGAGGTGGG + Intergenic
1089596196 11:119582222-119582244 GTGTGGGGCAGTAGAGAACATGG - Intergenic
1089680969 11:120118712-120118734 GCCTGGGGCAGGAGAGAAGATGG - Intronic
1089792175 11:120953227-120953249 GTGGGGGTCTGGGGAGAAGTGGG - Intronic
1090075332 11:123577231-123577253 GTGAGGGGCTGGGGAGAAACCGG - Intronic
1091108524 11:132944110-132944132 GTGTCGGGACGGAGCGAAGTGGG - Intronic
1091131333 11:133149561-133149583 GGGTGGGGGTTGAGAGAATTTGG - Intronic
1202815318 11_KI270721v1_random:44313-44335 GGGTGTGTCTGGAGAGAAGGGGG + Intergenic
1092313928 12:7389522-7389544 ATGGGGGGCTGGAGAGAAGGTGG + Intronic
1092798209 12:12135338-12135360 GAGTGGAGGGGGAGAGAAGTGGG + Intronic
1093547830 12:20369134-20369156 TTGTGGGCCTGGGGAGAAGAAGG + Intergenic
1093809254 12:23472523-23472545 GCCTGGGGCTGGAGTGAAGTGGG - Intergenic
1094693629 12:32794871-32794893 GAGTGGGGCTGCAGAGCAGAAGG + Intronic
1094839668 12:34337665-34337687 ATGTGTGGCTGGAGGGACGTGGG - Intergenic
1095103039 12:38202724-38202746 GTGTGGGGCCGGAAACAACTGGG + Intergenic
1095406968 12:41877391-41877413 GTGGGGTACTGGAGAGATGTTGG + Intergenic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1095716547 12:45352313-45352335 GAGTGGGGAGGGAAAGAAGTGGG - Intronic
1096238258 12:49944135-49944157 GTGTGGGGCAGGGCACAAGTGGG + Intergenic
1096248842 12:50013663-50013685 GTGTGGGACTTGAGGGAAATAGG - Intronic
1096468734 12:51863550-51863572 GGGTGGGGCTGGCGAGGAGGAGG + Intergenic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1096806530 12:54144344-54144366 TTGTGGGGCTGAAGAGAGGGAGG - Intergenic
1096861564 12:54532430-54532452 GTAGGGGGATGGAGAGAAGTGGG + Intronic
1097218157 12:57430521-57430543 GTGCGCTGCTGGAGAGAAGCTGG - Intronic
1097257441 12:57690227-57690249 GTGTGGGGTTGAGGAGAAGTGGG - Intergenic
1097583489 12:61486903-61486925 GTGGGGGGAGGGAGAGGAGTGGG + Intergenic
1097880674 12:64683464-64683486 GTGTGGGGAGGTAGAGAAGTGGG + Intronic
1097967344 12:65595348-65595370 GTGGGGGGATGGGGAGAAGTAGG - Intergenic
1098029839 12:66242398-66242420 ATCTAGAGCTGGAGAGAAGTCGG + Intronic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098556113 12:71820885-71820907 GGGTGGGGTTGGAGAGATATTGG - Intergenic
1098718388 12:73861658-73861680 GTGTGGGGATGGCGCGAAATGGG + Intergenic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1100737043 12:97546935-97546957 GTGAGAGGTTGGAGAGATGTTGG - Intergenic
1100837570 12:98581210-98581232 CTGTGGGGCAGGAGAGTGGTGGG + Intergenic
1101676581 12:106922422-106922444 GTGGGGGGCTGGAGTGAGGGAGG - Intergenic
1101884245 12:108648113-108648135 GTGTGGGGCTGGCAACAAGGGGG - Intronic
1102521802 12:113482139-113482161 GTGTGAGGCAGGAGAGAAAGGGG - Intergenic
1103082741 12:118038287-118038309 CTCTGCAGCTGGAGAGAAGTCGG - Exonic
1104617561 12:130283319-130283341 GGGTGAGGCTGGAGAGAGGCAGG + Intergenic
1105911622 13:24873678-24873700 GTGGGGGGATGAAGAGAGGTTGG - Intronic
1106011051 13:25823590-25823612 GTGTACTGCTAGAGAGAAGTAGG + Intronic
1106077059 13:26469385-26469407 GTCAAGGGCTGGAGAGATGTTGG + Intergenic
1106150912 13:27100745-27100767 TTGAGGGGCTGAAGAAAAGTTGG + Intronic
1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG + Intergenic
1107555830 13:41516090-41516112 GTGAGGGGCTGGCCAGTAGTGGG + Intergenic
1107772629 13:43805598-43805620 GTGGGGGGCGGGAGAGCATTAGG - Intergenic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108007232 13:45961556-45961578 ATGTGGGGGTGGGGAGATGTGGG + Intronic
1108275721 13:48807596-48807618 TGGTGTGGCTGGAGAGAAGCGGG - Intergenic
1108690073 13:52851540-52851562 AGGTGGCGCTGGAGAGGAGTAGG + Intergenic
1109593600 13:64520918-64520940 GTGTGGTGGTAAAGAGAAGTTGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110441553 13:75532115-75532137 CTTTTGGGGTGGAGAGAAGTGGG + Intronic
1111202526 13:84959281-84959303 GTGGGGGAATGGAGAGATGTTGG - Intergenic
1111538581 13:89638987-89639009 TTGTGAGGCTGTAGAGAAATTGG - Intergenic
1111806514 13:93044989-93045011 GTGTTGGGGTGGAGAGATGAGGG - Intergenic
1112202078 13:97286658-97286680 GTGGGGGGCTGGGGAGCAGGTGG - Intronic
1112461100 13:99604543-99604565 GAGTGGGGCTGGAGATAAATTGG + Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112566800 13:100558836-100558858 GAGAGGGGATGGAGAGAGGTTGG + Intronic
1113042134 13:106115945-106115967 GTGTGGGGAGGGAGAGCATTAGG - Intergenic
1114259810 14:21028318-21028340 GTTTGGGGCTGCAGTGAACTAGG - Intronic
1114491169 14:23102949-23102971 GGCTGGGGCTGGTGAGATGTTGG + Intergenic
1114621561 14:24099237-24099259 GTGAGGGCCTGGTGAGAAGCAGG + Intronic
1114703756 14:24705421-24705443 GGGTGGGGGTGGGGAGCAGTGGG + Intergenic
1115078355 14:29418826-29418848 GTTTGGGGCATGAGAGAAGTCGG - Intergenic
1115437797 14:33396004-33396026 GGGTGGGGCTGGAGGGAATGGGG - Intronic
1115831775 14:37350708-37350730 GTTGAGGGCTGGAGGGAAGTGGG - Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116403124 14:44533431-44533453 GTGATGGGGTGGAGAGAAATGGG + Intergenic
1116907050 14:50414391-50414413 GTTTGGGGATGGGGAGATGTTGG - Intronic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117840588 14:59856650-59856672 GATTGGGGGTGGAGAGAAGTCGG - Intronic
1117954240 14:61110555-61110577 TGGTGGGGCTGAAGCGAAGTTGG - Intergenic
1117996960 14:61487094-61487116 GGGTGGTGCTGGAGATAAGTGGG + Intronic
1118527053 14:66657214-66657236 TTGTAGGGCTGAAGAGAATTCGG - Intronic
1119047830 14:71336346-71336368 GGGTGCGGCTGGAAAGAAATGGG - Intronic
1119672105 14:76527736-76527758 GCGTGGGGCAGGTGAGAAGCAGG + Intergenic
1120138676 14:80901763-80901785 AGGTGGAGCTGGAGAGAAGGAGG - Intronic
1121141110 14:91543363-91543385 GTGTGCAGCTGGAGGGAAATGGG - Intergenic
1121507993 14:94490977-94490999 GTATGGGGATGGAGTGAAGGTGG - Intronic
1121732714 14:96197671-96197693 GTGCGGGGCTGGAGAGCAATGGG + Intergenic
1121843621 14:97154867-97154889 AGGTGGGGCTGGAAGGAAGTGGG + Intergenic
1122149104 14:99715008-99715030 GTGGGGGGATGAAGAGAAGTTGG + Intronic
1122207541 14:100155495-100155517 GTGAGCGGCTGGTGAGAAGCTGG - Intronic
1122606048 14:102948228-102948250 GTGTGGAGGTGGAGGGGAGTCGG + Intronic
1124177502 15:27440045-27440067 GTGGGAATCTGGAGAGAAGTGGG - Intronic
1124354206 15:28983356-28983378 GTGTGTGGCGGGAGAGTAATTGG + Intronic
1124790423 15:32720836-32720858 GTTTGGGGCTAGATAGAATTGGG + Intronic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1126216723 15:46163924-46163946 GTGAGGGGCAGGGGAGAAGTGGG + Intergenic
1126730932 15:51681627-51681649 GTGTGGGGCGGGAGAGGGGCCGG - Exonic
1126859491 15:52870293-52870315 GTATGGTGATGGAGAGAAGGGGG + Intergenic
1127002791 15:54529720-54529742 GTGTGGAGGAGGAGAGGAGTGGG + Intronic
1127170401 15:56294695-56294717 GTGAGGGGCTTGAGAGTAGCTGG + Intronic
1127964949 15:63916442-63916464 GTCCTGGGCAGGAGAGAAGTGGG - Intronic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128234177 15:66056240-66056262 TTCTGGGCCTGGAGAGAAGAGGG + Intronic
1128278013 15:66370467-66370489 GTGGGGGGCTGGAGGGGAGGAGG + Intronic
1128452883 15:67817072-67817094 GCCTAGGGCTGGAGGGAAGTAGG + Intergenic
1129319406 15:74765954-74765976 GCCTGGGGCTGGGGAGAAGGGGG + Intergenic
1129645847 15:77431783-77431805 GGGTGGGGCTGGGAAGATGTTGG - Intronic
1129703017 15:77778760-77778782 GTGGGAGGCAGGACAGAAGTAGG - Intronic
1129714612 15:77839866-77839888 TAGTGGGGTTGGAGAGAAATGGG - Intergenic
1129933520 15:79431511-79431533 GTGTGGGGGGGGAGAGAAACAGG + Intergenic
1130020942 15:80231189-80231211 ATGTGAACCTGGAGAGAAGTAGG - Intergenic
1130288106 15:82572109-82572131 GTTTGGGGGTGGAGAGCAGGGGG - Intronic
1130573357 15:85068715-85068737 GTGAGGGGCTGGAGAAAATTTGG + Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131285010 15:91049584-91049606 GACTGGGGCTGGAGAGAAGCGGG + Intergenic
1132026248 15:98406504-98406526 GTGTGGTGACGGAGACAAGTAGG - Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132340661 15:101076383-101076405 GTGGGAGGCTGGATTGAAGTCGG - Intronic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1132654250 16:1035261-1035283 GTGTGGGGCTGGGCAGAGGAGGG + Intergenic
1132765084 16:1530488-1530510 GTGTGGGGCTGGACAGGGCTGGG + Intronic
1132958011 16:2606641-2606663 GTGGGGGTCTGGAGAGGGGTTGG + Intergenic
1132970485 16:2685889-2685911 GTGGGGGTCTGGAGAGGAGTTGG + Intronic
1133278476 16:4651967-4651989 GTGGGGGGCAGGAGTGACGTAGG - Exonic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134451225 16:14364918-14364940 GTCGGGGGCTGGAGAGGAGTGGG + Intergenic
1135159429 16:20080593-20080615 GTGTGGGGATGGAGGGCATTTGG - Intergenic
1135477747 16:22792428-22792450 GAGTGGGGCAGGAGAGAGGTGGG + Intergenic
1135829141 16:25758127-25758149 GTTTGAGGGTGGAGAGAATTAGG - Intronic
1135839200 16:25859023-25859045 GTGTGGGGTGGGAGGGATGTTGG - Intronic
1135896682 16:26411568-26411590 GGGTGGGGATGGGGAGATGTAGG + Intergenic
1136265083 16:29111500-29111522 GAGTGGGGCTGGACAGAAGGTGG + Intergenic
1136378194 16:29877560-29877582 GGGCGGGGCTGGAGAGTAGGAGG - Intronic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1137693135 16:50442865-50442887 GTGGGGGGGTGGGGGGAAGTGGG + Intergenic
1138105108 16:54283929-54283951 GTCTGGGGCTGGAAAGAGGTGGG + Intronic
1138304564 16:55962622-55962644 GGGTGTGGCTGGAGAGGAGCAGG - Intergenic
1138506379 16:57480294-57480316 GCCTGGGGCTGGAGAGAAACAGG - Intronic
1138540479 16:57684534-57684556 TATTGGGGCTGGAGAGAGGTGGG + Intronic
1138542875 16:57699058-57699080 GCCTGGGGCTGGAGAGCAGAGGG + Intronic
1138634692 16:58328376-58328398 GGGTGGGGATGGGGAGAAATGGG - Intronic
1138669010 16:58597859-58597881 GGGTCTGGCTGGACAGAAGTAGG + Intronic
1139120215 16:64007274-64007296 GTGTGGAGAGAGAGAGAAGTGGG - Intergenic
1140240151 16:73192885-73192907 GTGGGGAGCTGGACACAAGTGGG + Intergenic
1141164809 16:81653305-81653327 GTGTGGGCCTGCAGAGAAAGGGG - Intronic
1141708040 16:85680134-85680156 GTGTGGTGCGGGAGAGATGTGGG - Intronic
1142134178 16:88444094-88444116 AAGTGGGGTAGGAGAGAAGTGGG + Intergenic
1142440590 16:90095138-90095160 GTGTGGGGCCGGAAACAACTGGG + Intergenic
1142598677 17:1042055-1042077 GCTTGGGTCTGGAGAGAAGGAGG + Intronic
1143023405 17:3928110-3928132 GTGTCGGGCTGGAGAGAAGTGGG - Intronic
1143107897 17:4538531-4538553 GGTTGGGGCTGGTGTGAAGTTGG - Exonic
1143193091 17:5054889-5054911 GTGTGTGACTGGAGGGAGGTAGG + Intergenic
1144043396 17:11432885-11432907 GCCTGGGGCTGGAGAGCAGGAGG + Intronic
1144156438 17:12508631-12508653 ATCTGGGGCTGGAAAGAAGAGGG - Intergenic
1144761859 17:17711520-17711542 GGATGGAGCTGGAGGGAAGTGGG + Intronic
1145059878 17:19725881-19725903 GTCAGGGGCTGGAGAGAAGGTGG + Intergenic
1146216773 17:30982721-30982743 GTTTAGGGCCAGAGAGAAGTGGG - Intronic
1147047829 17:37767837-37767859 GCGTGGGGCTGGAGAACATTGGG - Intergenic
1147360609 17:39927425-39927447 GGGAGGGGCGGGAGAGAAGGTGG - Intronic
1147711359 17:42468513-42468535 GTGGGGGGATGAAGAGAGGTTGG - Intronic
1147980810 17:44272851-44272873 GTCTGGGGGTGGATGGAAGTGGG + Intergenic
1148690025 17:49521741-49521763 TTGTGGGGCTGGAAAGGAGCTGG + Intergenic
1148705206 17:49624142-49624164 GAGTGGGACTGGGGAGATGTAGG + Intronic
1148862913 17:50613885-50613907 GTGTGGGGCTGGAGAGCCTGGGG - Intronic
1149306084 17:55347726-55347748 CTGGGGGGCTGGAGAGGAGTGGG - Intergenic
1149652542 17:58285026-58285048 GTGTGTGGTTGGAGAGAAAGAGG + Intergenic
1149689055 17:58558465-58558487 TAGTGGGGCTAGAGAGAATTTGG - Intronic
1149751752 17:59153420-59153442 GTGTGGGGTTGGAGAAGTGTAGG - Intronic
1149891126 17:60391721-60391743 GTGTGGTGGAGGAGAGAGGTCGG - Intronic
1150646106 17:66978464-66978486 GTGTGGGGGAGGGGTGAAGTGGG - Intronic
1150827301 17:68488239-68488261 GTCTGTGGCTGGAGAAAGGTGGG + Intergenic
1151189490 17:72387754-72387776 GGGGAGGGGTGGAGAGAAGTGGG + Intergenic
1151221662 17:72617161-72617183 GTGGGGGGCTGTGGAGGAGTTGG + Intergenic
1151552422 17:74829823-74829845 GTGTGGGGCTGGAGAGAGTTGGG - Intronic
1152056124 17:78028254-78028276 TTCTGGGGATGGGGAGAAGTGGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152541811 17:80980343-80980365 GTGCTGGGCTGGAGGGATGTTGG - Intergenic
1152554858 17:81047966-81047988 TTGAGGGGCTGGAGGGAGGTGGG + Intronic
1152624060 17:81380172-81380194 GAGTGGGGGTGGGGAGTAGTGGG - Intergenic
1152956969 18:48421-48443 GTGTGGGGCCGGAAACAACTGGG - Exonic
1153344865 18:4014408-4014430 TTGTGGGGGTGAAGAGATGTTGG + Intronic
1153501603 18:5755442-5755464 GGGTGGGGCTGGATAGGAGCGGG + Intergenic
1153679025 18:7483041-7483063 GTGTGGGGTTGGTGAGATCTGGG - Intergenic
1153948409 18:10037012-10037034 GTGTGGTGTTGGAGAGTTGTGGG + Intergenic
1154203595 18:12318264-12318286 GGGAAGGGGTGGAGAGAAGTTGG + Intronic
1154408074 18:14114662-14114684 GTGGGGGGTTGGTGGGAAGTGGG + Intronic
1155231443 18:23778798-23778820 GTGTGGGCCAGCAGAGAAGATGG + Intronic
1155565921 18:27133879-27133901 GTGTGGCGCTGTCCAGAAGTGGG + Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1155979276 18:32163859-32163881 GGGTGGGGGAGGAGAGAAGGGGG + Intronic
1156481072 18:37436751-37436773 GGCTGGGGCTAGAGGGAAGTCGG + Intronic
1156625303 18:38901070-38901092 GTGTGGGGAGAGAGAGAAGAAGG + Intergenic
1157328446 18:46686013-46686035 GGATGGGGCTGGAGAGAAGAAGG + Intronic
1157555079 18:48608172-48608194 GTATGGGTCTGCAGAGAACTGGG + Intronic
1157759442 18:50249707-50249729 GGGTGGGGCAAGAGGGAAGTAGG + Intronic
1157880641 18:51318094-51318116 GTGGGTAGGTGGAGAGAAGTAGG - Intergenic
1157883017 18:51340209-51340231 GGATGGGGCGGGAGAGAAGGAGG - Intergenic
1158028435 18:52932289-52932311 GTGTGGAGCTGGGTAAAAGTTGG - Intronic
1158856494 18:61547713-61547735 GTGTGGGGCGGGGGTGTAGTGGG - Intronic
1158858255 18:61565744-61565766 GCTTGGGGTTGGAGAGGAGTAGG - Intergenic
1158963375 18:62604235-62604257 GTGTGGGGCAGGGGAGAGATGGG + Intergenic
1159730892 18:72026202-72026224 GTGTGGGACTGGAGGAAGGTGGG - Intergenic
1160059234 18:75514597-75514619 GAGTGGGGCCTGAGGGAAGTTGG + Intergenic
1160205019 18:76824368-76824390 GTGGGCTGCTGGAGAGATGTTGG + Exonic
1160621165 18:80171637-80171659 GTGTGGGGCTGAGGAGAGGAAGG - Exonic
1160702336 19:513781-513803 ATGTGGGGCTGGTGTGCAGTAGG - Intronic
1160939323 19:1612886-1612908 GTGTGGGTGTGGACAGCAGTGGG + Intronic
1160939354 19:1613084-1613106 GTGTGGGTGTGGACAGCAGTGGG + Intronic
1161218957 19:3109187-3109209 GTGTGAGGGTGAAGAAAAGTGGG + Intronic
1161255501 19:3306812-3306834 GTGAGGGGGTGGAGAGGAGGCGG - Intergenic
1161345635 19:3767586-3767608 GTGTCGGCCTGGCGGGAAGTGGG + Intronic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162524156 19:11197666-11197688 GGGTGGGGATGGAGAGACGCTGG + Intronic
1163695278 19:18760659-18760681 GTGTGGAGCTGGAGACGGGTGGG - Intronic
1164520027 19:28972144-28972166 GTGTGGAGCTGCAGAGACATTGG - Intergenic
1164581304 19:29437041-29437063 GAGTGGGGCTGGAGAGATGGAGG + Intergenic
1164759930 19:30721020-30721042 GCCAGGGGCTGGGGAGAAGTGGG - Intergenic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1165353619 19:35290928-35290950 TTGTGGGGCTGGGGGGGAGTTGG - Intergenic
1165445667 19:35855765-35855787 GTGTGGGGGTGGGGAGAGATTGG + Intronic
1166366495 19:42280900-42280922 GTGGGGGGGTTGAGAGACGTGGG - Intronic
1166705352 19:44905393-44905415 CTAGGGGGCTGGACAGAAGTGGG - Intergenic
1167035673 19:46993853-46993875 GCGTGGGCCGGGAGAGAAGGTGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167331216 19:48857459-48857481 GGGGGGAGCTGGAGATAAGTGGG + Exonic
1167569664 19:50279139-50279161 GGGTGGGGTGGGGGAGAAGTGGG - Intronic
1167716083 19:51143641-51143663 GAGAGGGGCTGGAGAGGAGCTGG - Intronic
1167786882 19:51644521-51644543 GTCCCGGACTGGAGAGAAGTGGG + Intronic
1168319291 19:55499726-55499748 GTGAGTGACTGGAGAGAAGGAGG + Intronic
925334036 2:3080129-3080151 GTTTGGGGGTGGAGAGAGGGAGG + Intergenic
926216839 2:10911256-10911278 GTGTGGGACTGCAGAGAGATAGG + Intergenic
927073249 2:19551037-19551059 GTGTGGGGCTTGGGAGCAGCTGG + Intergenic
927092479 2:19722586-19722608 GCATGGGGCTGGAGAGGGGTAGG - Intergenic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927868470 2:26608261-26608283 GAGTGGGTCTGGTGAGAAGGGGG + Intronic
927957400 2:27217419-27217441 GCGGGGCGCTGGAGAGAAGCCGG - Exonic
927965597 2:27265691-27265713 GTGTGAGCCTTGAGAGAAGCAGG - Intronic
928599688 2:32892032-32892054 GAGTGGGGGTGGGGAGATGTTGG + Intergenic
930307383 2:49692485-49692507 GTGTGAGGCTGTGGAGAAATAGG - Intergenic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931355756 2:61537220-61537242 CCCTGGGGCTGGGGAGAAGTTGG - Intronic
931624563 2:64245189-64245211 ATGTGGGACTGAAGGGAAGTTGG - Intergenic
932042620 2:68317484-68317506 GTCTGGGGCTGGGGATAGGTAGG - Intronic
932410165 2:71542764-71542786 GTGTCTGTGTGGAGAGAAGTGGG - Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932751138 2:74372397-74372419 CTGTGGGGCAGGGGAGAAGGTGG + Intronic
932760579 2:74436711-74436733 ATTTGGGGCTGGAGATCAGTAGG - Intronic
933350026 2:81142083-81142105 GAGAGGGGATGAAGAGAAGTTGG - Intergenic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933679216 2:85084307-85084329 GGGTGGGGTGGGAGAAAAGTAGG + Intergenic
934514985 2:94980956-94980978 GGGAGGGGCTGGAGAGAGATGGG - Intergenic
934543388 2:95194743-95194765 GTGGGGGGTGGGAGGGAAGTGGG + Intergenic
934574323 2:95390777-95390799 GTTGGGGGCTGGGGAGAGGTGGG + Intergenic
934905338 2:98196123-98196145 GGGTGGGGATGGGGAGATGTTGG + Intronic
935282090 2:101527105-101527127 GTGTGGAGCTGGAGACAATGGGG + Intergenic
936679797 2:114757147-114757169 GGGTGGGGAGGGAGAGAGGTGGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937065701 2:119015518-119015540 GTGTGGGGAGGGAGAGCACTGGG - Intergenic
937197567 2:120173265-120173287 TTGTGGGGCTGGGGAGAGGGTGG + Intronic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
938698899 2:133858977-133858999 GGGTGGGGCATGAGAGGAGTCGG + Intergenic
939917460 2:148064982-148065004 GTATGGGGCCTGAAAGAAGTAGG - Intronic
940625829 2:156173659-156173681 CTGAGAGGCAGGAGAGAAGTTGG - Intergenic
940755100 2:157673167-157673189 TTCTGGGGCTGAAGAGATGTGGG - Intergenic
940968112 2:159862936-159862958 GTGGGGGACTGGGGAGATGTTGG - Intronic
941203617 2:162544786-162544808 ATGTGGGGCTGGAGACAGGCTGG - Intronic
942723069 2:178974436-178974458 GTGTGGGCCAGGAGTGGAGTAGG - Intronic
942789029 2:179737179-179737201 GTGTGGGGCTTGAGAGGTCTAGG + Intronic
943013907 2:182487657-182487679 GTGTGGGGATGGGTAGGAGTGGG + Intronic
943581340 2:189687102-189687124 TGGTGGGGCAGGAGGGAAGTGGG - Intronic
943720939 2:191202970-191202992 GTTTGGGGGTGGAGAGCAGCTGG + Intergenic
943955664 2:194186257-194186279 GTATGGGGCTGAAAAGAGGTTGG - Intergenic
944095384 2:195961392-195961414 GGGTGGGGCTGGTGGGTAGTGGG - Intronic
944426722 2:199591171-199591193 GTGTGTGGGTGGAGGGAGGTTGG - Intergenic
945039740 2:205733782-205733804 GGGTGGGGCTGGAGAAGAGCAGG - Intronic
945128164 2:206536447-206536469 GTGGTGGGTTGGAGAGATGTAGG + Intronic
945301185 2:208217728-208217750 GTGGGAGGCTGGATTGAAGTCGG + Intergenic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
946943801 2:224798404-224798426 GGGTGGGGCCGGGGAGAAATGGG + Intronic
947458674 2:230282929-230282951 GTGTGTGGCTGGGGAGAGGGTGG + Intronic
947468902 2:230382065-230382087 GTGTGTGGCTGGGGAGAGGTGGG + Intronic
947758097 2:232583343-232583365 GTAAAGGGCTGGAGAGGAGTAGG - Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948530307 2:238599861-238599883 GTGGGGGACAGGAGAGCAGTGGG - Intergenic
948562472 2:238863860-238863882 GTGTGGGACTGAGGAGAGGTCGG + Intronic
948618148 2:239214841-239214863 GCATGGGACTGGAGAGAAATAGG + Intronic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1170178689 20:13503050-13503072 GGGTGGGGCAAGAAAGAAGTGGG - Intronic
1170976601 20:21170747-21170769 GTTCGGGGGCGGAGAGAAGTGGG - Intronic
1171029418 20:21663894-21663916 GTATGGAGCTGGAGGGAAGGAGG + Intergenic
1171151924 20:22834951-22834973 GTGTAGGGAGGGAGAGAAGGAGG - Intergenic
1171519887 20:25767643-25767665 GTGTGCGGCCTGAGAGCAGTAGG + Intronic
1171557032 20:26088850-26088872 GTGTGCGGCCTGAGAGCAGTAGG - Intergenic
1172433691 20:34913533-34913555 GGGTGGGGCTCTGGAGAAGTAGG + Intronic
1172790505 20:37502095-37502117 AGGTGGAGCTGGAGAGAAGGAGG - Intronic
1173147262 20:40535576-40535598 ATTTGGGGCTGGGGAGAAGGGGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175175765 20:57110986-57111008 GTGTGGGGGAGCAGGGAAGTGGG - Intergenic
1175285175 20:57833100-57833122 ATGTGGGGCTGTAGAGGATTTGG + Intergenic
1175889451 20:62309877-62309899 TTTTGGGGCTGGAGAGAGGCTGG - Intronic
1176191295 20:63811351-63811373 GGGTGGGGCTGGGGAGAGGAAGG - Intronic
1176242259 20:64080464-64080486 CTGCGGGGCTGGGGAGAACTGGG + Intronic
1176896443 21:14383721-14383743 GTGCGGGGCCTGAGGGAAGTCGG + Intergenic
1177029874 21:15969061-15969083 GTGTCTGGTTGGGGAGAAGTTGG + Intergenic
1177149516 21:17440897-17440919 CTGGGGTGCTGGAGAGAAGTAGG - Intronic
1177412919 21:20754336-20754358 ATGTGGGACTGGAGAGATGAAGG + Intergenic
1177713283 21:24807543-24807565 CTGTGGGTCAGCAGAGAAGTAGG + Intergenic
1179292326 21:40029560-40029582 GTGTGAGGGTGGAGAGTAGGAGG + Intronic
1179482351 21:41686133-41686155 GTGTGGGGCAGGTGGGCAGTGGG + Intergenic
1180047510 21:45316413-45316435 GGGTGGGGGTGGAGAGCATTAGG + Intergenic
1180063843 21:45403211-45403233 GAGTGGGGCAGGAGAGAGGTAGG + Intergenic
1180146347 21:45921855-45921877 GTGAGGAGCTGGAGAAAAGCAGG - Intronic
1180244936 21:46540559-46540581 GAGTGGGGCAGGTGAGAAGAGGG - Intronic
1180629803 22:17220666-17220688 GAGTGGGACTGGGGAGGAGTGGG - Intronic
1180842557 22:18966102-18966124 GGGTGGGGCTGGGGAGTAGGAGG - Intergenic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181656690 22:24306811-24306833 GTCAGGCGCTGGAGAGAAGAGGG - Intronic
1181854282 22:25771027-25771049 GTATGGAGCTGGGGTGAAGTGGG - Intronic
1182116219 22:27757961-27757983 TAGTGGGGCAGGAGAAAAGTGGG - Intronic
1182137361 22:27918860-27918882 GTGGGGGGTTGGGGAGAAGGCGG + Intronic
1182707408 22:32294547-32294569 GGGTGGGGCAGGAGGAAAGTGGG - Intergenic
1183179902 22:36253001-36253023 GGGTGGGGCTGGACTGAAGGTGG + Intronic
1183297588 22:37040378-37040400 CTGTGGTGCTGGACTGAAGTTGG + Intergenic
1183377055 22:37471492-37471514 GGATGGGGGTGGAGAGGAGTTGG - Intronic
1183583892 22:38740957-38740979 GGGTGGGGCTGGGGAGGAGCAGG + Intronic
1184011284 22:41750554-41750576 GTGTGGGGAAGGTGAGAAATGGG + Intronic
1184014820 22:41778045-41778067 GTGGGGGGCAGGGGAGAAGGAGG - Intronic
1184272773 22:43394079-43394101 GGGTGTGGCAGGAGAGCAGTGGG + Intergenic
1184292885 22:43507545-43507567 GTGTGCGGGTGGAGAAAAGCAGG + Exonic
1184395749 22:44238000-44238022 GGGTGGGGCAGGAGGAAAGTGGG - Intergenic
1184411438 22:44328625-44328647 GGGTGGGGCTGGAGAGGGCTTGG + Intergenic
1184742778 22:46438702-46438724 GGAAGGGGCTGAAGAGAAGTGGG + Intronic
1184782520 22:46656297-46656319 GAGTGGGGCTGGTGAGATGCAGG + Intronic
949487574 3:4554540-4554562 GGGTTGGGCTGGAGAGAAAGGGG + Intronic
949649924 3:6145502-6145524 GGGTGGGGCAGGAGGGAAGTAGG - Intergenic
950725411 3:14913922-14913944 GTGTGGGGAAGAAGAGAAGCAGG - Intronic
951173584 3:19572606-19572628 GTTTGGGGCTGGAGAGCAGCAGG + Intergenic
951919153 3:27834552-27834574 GTGTGGGGAGGGAGAGAATCAGG - Intergenic
952227431 3:31392724-31392746 GTGCTGAGGTGGAGAGAAGTAGG - Intergenic
952406962 3:33013642-33013664 GTGTGGGGCTGGATGCAGGTGGG + Intronic
952755136 3:36859116-36859138 GTGGGGAGCTGGAGAGGAGGCGG - Intronic
953371486 3:42392276-42392298 GTGTGGGGGTAGACAGATGTGGG + Intergenic
953772945 3:45792718-45792740 GTGTGGGGTTGGGGAGAGGTGGG - Intronic
953849485 3:46455071-46455093 CCGTGGGGCTGGTGAGAAGTTGG + Intronic
953927447 3:46989613-46989635 GTTTGGGGGTGGAGCCAAGTGGG - Intronic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954060476 3:48062101-48062123 GTGTCTGTGTGGAGAGAAGTGGG + Intronic
954139348 3:48596814-48596836 GTGGGGGGCTGCAGAGAACCAGG + Intergenic
954222805 3:49164974-49164996 GTGTGGAGCTGGAGTGGGGTGGG + Intronic
954466479 3:50658091-50658113 GAGTGGGGCTGAGGAGATGTTGG + Intergenic
954506050 3:51074684-51074706 GTGAGGGGAGGGAGAGAATTAGG + Intronic
955213301 3:56962107-56962129 GTGTTTGGCTGGGGAGAAGGAGG - Intronic
955741539 3:62096073-62096095 GAGTTGAGCTGGAGAGAAGTAGG + Intronic
956331336 3:68113291-68113313 AGGTGGTGCTGCAGAGAAGTAGG + Intronic
956373825 3:68592664-68592686 GTGGGGGGAGGGAGAGAATTAGG - Intergenic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956725694 3:72154905-72154927 GTGGGGGCATGGAGAGAAGCAGG - Intergenic
957073142 3:75581087-75581109 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
957699901 3:83695377-83695399 GTGGGGTGTTGGGGAGAAGTAGG + Intergenic
957800536 3:85074152-85074174 TAATGTGGCTGGAGAGAAGTGGG - Intronic
958639271 3:96783930-96783952 GAGAGGGGCTGAAAAGAAGTTGG - Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
959985408 3:112565819-112565841 GTGGTTGGCTGGAGAGAGGTTGG + Intronic
960580892 3:119277924-119277946 GTGGGGGGGTGGGTAGAAGTGGG - Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
960930915 3:122848945-122848967 GTGGGAGGATGAAGAGAAGTTGG - Intronic
960935554 3:122899248-122899270 GGGAGGGGCTTGAGACAAGTGGG - Intergenic
960942189 3:122942417-122942439 GTGTGGGGTTGGGGAGAGGATGG - Intronic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961873454 3:130003892-130003914 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
962139694 3:132776114-132776136 GTGGGGGGTGGGAGAGAGGTGGG + Intergenic
962255970 3:133870486-133870508 TGGTGGGGCTGGAGAGAATGGGG + Intronic
962743315 3:138379156-138379178 GTGGGGGGATGAAGAGAAGTTGG - Intronic
964401958 3:156309133-156309155 GTATGGAGCCAGAGAGAAGTAGG - Intronic
964674795 3:159265789-159265811 GCGTGGGGCTGCAGAGCAGCTGG - Intronic
966206574 3:177412599-177412621 GTGTCTGTGTGGAGAGAAGTGGG - Intergenic
966669344 3:182509337-182509359 TTGTGGGGCTGGAGAGCAAAGGG + Intergenic
967300791 3:188010122-188010144 GGTTGGGGCAGAAGAGAAGTAGG - Intergenic
967893823 3:194381986-194382008 GTGAGGGGCTGGAGAGGGGTGGG + Intergenic
967893844 3:194382037-194382059 GTGAGGGGCTGGAGAAGGGTGGG + Intergenic
967893866 3:194382088-194382110 GTGAGGGGCTGGAGAGGGGTGGG + Intergenic
967893887 3:194382139-194382161 GTGAGGGGCTGGAGAGGGGTGGG + Intergenic
967893909 3:194382190-194382212 GTGAGGGGCTGGAGAGGGGTGGG + Intergenic
967893931 3:194382241-194382263 GTGAGGGGCTGGAGAGGGGTGGG + Intergenic
967893949 3:194382293-194382315 GTGAGGGGCTGGAAAGGAGTAGG + Intergenic
967924326 3:194633962-194633984 GTGTGTGGCTGGACAGGAGGCGG - Intergenic
968030098 3:195476242-195476264 GTTTGGGGTTGGAAAGATGTTGG - Intergenic
968357343 3:198119726-198119748 GTGTGGGGCCGGAAACAACTGGG + Intergenic
968496362 4:919454-919476 GGGTGCGGCTGGAGAGGAGGAGG - Intronic
968594426 4:1474909-1474931 GTGTGTGTCAGGAGAGAAGGTGG + Intergenic
968707917 4:2091861-2091883 GTGTGGGGCAGAAGAGCACTCGG - Intronic
968850725 4:3075574-3075596 GTTTGGAGCTGGAGAGATGTGGG + Intronic
969131603 4:4994687-4994709 GTGGTGGGCTGGGGAGAGGTAGG + Intergenic
969242133 4:5906209-5906231 ATGTTGGCATGGAGAGAAGTGGG + Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
969875502 4:10133067-10133089 GTGTGGGGATGGACACAAGGTGG + Intergenic
969939862 4:10721187-10721209 GTTGGGGGCTGGAGGGAACTGGG + Intergenic
971152040 4:24043623-24043645 GGGTTGGACTGGAGAGCAGTGGG - Intergenic
971423148 4:26492033-26492055 GTGTGGGGCTGGAAAGACAGTGG + Intergenic
972086989 4:35230162-35230184 GAATGTGGCTGGAGAGAAATAGG - Intergenic
972182097 4:36479768-36479790 GCCAGGGGCTGGAGAGAAGGAGG - Intergenic
972351685 4:38242155-38242177 GGCTGGGGGTGGAGTGAAGTAGG - Intergenic
973219683 4:47711173-47711195 GGGTGTGGCAGGAGAGATGTGGG - Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974281588 4:59801930-59801952 GTTGGGGGATGGAGAGAAGCAGG + Intergenic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
976047526 4:80968855-80968877 GTGGGGGGAAGGAGAGAAGAGGG - Intergenic
976330216 4:83823041-83823063 GTGGGGAGCTGGAGAGATGCAGG - Intergenic
977285796 4:95105267-95105289 GTGTGTGCCAAGAGAGAAGTGGG + Intronic
977889383 4:102290784-102290806 CTGTGGGGTTGGGGAAAAGTGGG - Intronic
978110334 4:104956185-104956207 GAGTGGGGCTGGGGAGATATTGG - Intergenic
978761693 4:112360058-112360080 GTCAGGGCCTGGGGAGAAGTTGG - Intronic
979270841 4:118759741-118759763 GTGGGTGGGAGGAGAGAAGTTGG - Intronic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981307482 4:143262261-143262283 GGTAGGGGCTGGAGAGAAGATGG + Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
982310189 4:153976283-153976305 GAATGAGGCTGGAGAGAAGTTGG - Intergenic
982852199 4:160332722-160332744 AGGTGGGGGTGAAGAGAAGTTGG - Intergenic
983562842 4:169118173-169118195 ATGTGGAGCTGGAGGCAAGTAGG - Intronic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
983907326 4:173197734-173197756 GGCTGTGGTTGGAGAGAAGTGGG + Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984329626 4:178298069-178298091 GTGTGGGGCGGGGGGGCAGTCGG + Intergenic
984758570 4:183345023-183345045 GTGGAGAGGTGGAGAGAAGTGGG + Intergenic
984837282 4:184033663-184033685 TGGTGGAGCTGGAGATAAGTGGG - Intergenic
985441193 4:189983524-189983546 GTGTGGGGCCGGAAACAACTGGG - Intergenic
985606615 5:861454-861476 GGGAGGGGCTGGACAGAGGTTGG + Intronic
985614067 5:909057-909079 GGGTGGGATAGGAGAGAAGTGGG - Intronic
985812289 5:2098992-2099014 GTGTGGGGCTGCAGAGGAGTTGG - Intergenic
986092406 5:4523262-4523284 GGGTGGTGATGGCGAGAAGTGGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986290674 5:6396753-6396775 ACGAGGGGCTGGAGAGAGGTAGG + Intergenic
986723714 5:10578593-10578615 GGGTGGGGCTGGATTGGAGTTGG + Intronic
986812668 5:11376833-11376855 GGGTGGGGCTGGGGAGAGATGGG - Intronic
988093849 5:26576142-26576164 GTGTTGCGCAGGAGAAAAGTGGG + Intergenic
988249185 5:28732894-28732916 GAGTGGGGATGGGGAGATGTTGG - Intergenic
988609429 5:32711195-32711217 GGGTGGGGGTGGGGAGATGTGGG - Intronic
989187617 5:38640408-38640430 GGGTGGGGCTTGAGAGAAGAAGG - Intergenic
989345858 5:40428768-40428790 GTCTGGGGCTGGATAGTGGTGGG - Intergenic
989474874 5:41863439-41863461 GTGAGGGGTTGGTGAGATGTTGG - Intronic
991707102 5:69369213-69369235 GGGGGGGGGTGGAGAGAGGTCGG - Intronic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
992447958 5:76850750-76850772 TGGAGGGGCTGGGGAGAAGTTGG + Intronic
992525111 5:77602091-77602113 GGGTGGGGATGAAGAGAGGTTGG - Intronic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993017697 5:82554268-82554290 TTGTGAGGCTGTAGAGAAATTGG - Intergenic
993983205 5:94567865-94567887 CTATGGGGCTTGAGTGAAGTAGG - Intronic
994085698 5:95756164-95756186 GTCAGGGGCTGGAAAGAGGTCGG - Intronic
994883163 5:105524499-105524521 GTTGGGAGCTGGAGAGATGTTGG - Intergenic
995296505 5:110530723-110530745 GTGAAGGGCTGGGGAGATGTTGG + Intronic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996293219 5:121879352-121879374 TTCTGGGGATGGAGAGAAATGGG + Intergenic
996580539 5:125027924-125027946 GTGGTGGGCTGAAGAGAGGTGGG + Intergenic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997055483 5:130438498-130438520 GTCTGGGGGTGGAGTGAAGAGGG + Intergenic
997221388 5:132168842-132168864 GTCTGGGAATGGAGAGTAGTTGG - Intergenic
997743441 5:136278061-136278083 GGGAGGGACTGGAGAGGAGTTGG + Intronic
997833070 5:137169193-137169215 GTGAGGGGTTGGGGGGAAGTGGG + Intronic
998192834 5:140042184-140042206 GGTTGGGGTTGGAGAGAAGAAGG - Intronic
998958121 5:147457728-147457750 TTATGAGGCAGGAGAGAAGTAGG + Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999143419 5:149377666-149377688 GGGTGTGGCTGGAGAAGAGTGGG + Intronic
999383902 5:151140885-151140907 GAGCGGGGCTGGAGAGCAGAGGG - Intronic
999598860 5:153237803-153237825 CTCTGGGGCTGGAGAGAAAGGGG - Intergenic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
1000433461 5:161179658-161179680 GTGTGGGGTTGGGGAGGAGGTGG - Intergenic
1000570846 5:162912177-162912199 GAGTGGGGCGAGAGGGAAGTGGG - Intergenic
1001412424 5:171520573-171520595 GTGTGGGGCTGGGAAGGACTCGG + Intergenic
1001440571 5:171739727-171739749 TTGTGGGGCTGGGGTGGAGTGGG - Intergenic
1001753473 5:174148643-174148665 GTATGAGGGTGGAGAGAGGTGGG - Intronic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002360208 5:178664465-178664487 GGATGAGGCTGGAGATAAGTGGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002690460 5:181046259-181046281 GTTGGGGGCTGGAGAGATGGTGG - Intronic
1002690476 5:181046318-181046340 GTTGGGGGCTGGAGAGATGGTGG - Intronic
1002851853 6:1003643-1003665 GTGTGGATGTGGAGAGAGGTGGG - Intergenic
1002945791 6:1759885-1759907 GTGGGGGGCTGGGGCGCAGTAGG - Intronic
1003098527 6:3159742-3159764 GGGTGGGGGTGGGGAGAAGGTGG - Intergenic
1003252185 6:4439688-4439710 GAGTGGGGCTGAAAAGAGGTTGG + Intergenic
1003693670 6:8380062-8380084 GGGTGAGGCTGGGGAGAAGTTGG + Intergenic
1003963162 6:11228099-11228121 GTGGGGGGCTGGGGAGTAGGGGG + Intronic
1004070155 6:12290275-12290297 GTCTGGGGCTGGAATAAAGTCGG + Intergenic
1004331630 6:14727207-14727229 GTATGGGGGTGGAGGGAAATAGG + Intergenic
1004565913 6:16797540-16797562 GGCTGAGGCTGGAGAGAAGCTGG + Intergenic
1005595545 6:27375274-27375296 GTCTGCGGCTGGAGAGATTTAGG + Intronic
1005705770 6:28451241-28451263 GTGTGGGGGTGAAGAGAGGTTGG - Intergenic
1005907559 6:30277748-30277770 GTGGGGGGCTGAAGGGAAGGTGG - Intergenic
1006080366 6:31561923-31561945 GTCTGGAGCTCAAGAGAAGTTGG + Intergenic
1006175628 6:32119797-32119819 GTGTTGGGGAGGAGAGAAGTAGG - Intronic
1006430616 6:33993446-33993468 GAGTGAGGCTGGAGAGGATTGGG + Intergenic
1006627590 6:35408387-35408409 GAATGGAGCTGGGGAGAAGTAGG + Intronic
1007186425 6:39976040-39976062 GTGTAGAGCAGGAGACAAGTTGG + Intergenic
1007231720 6:40352832-40352854 GTTTGTAGCTGGAGAGAAGAGGG - Intergenic
1007823704 6:44581450-44581472 GGGTCGGGGTGGAGAGAATTTGG + Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008222180 6:48868256-48868278 ATGTGGGGGTGGGAAGAAGTTGG + Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1008653924 6:53591749-53591771 GTGGGGGAATGAAGAGAAGTTGG - Intronic
1009600914 6:65797973-65797995 GTGTGGGGATGGAGCAAAATTGG + Intergenic
1009912052 6:69942506-69942528 GAGTGGGGATAGGGAGAAGTTGG - Intronic
1010018382 6:71130950-71130972 GTGGTGGGCAGGAGGGAAGTGGG - Intergenic
1010659939 6:78557625-78557647 GTGTGGGGCAGGTGGGAAGGGGG - Intergenic
1010806819 6:80246794-80246816 GCATGGGGCTGGACAGAAGATGG - Intronic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011704349 6:89985952-89985974 GTGTGGGGCTGGAGGGATGCGGG + Intronic
1012606089 6:101159090-101159112 GTCTGGAGCTGGAGATAATTTGG + Intergenic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1013317815 6:108958635-108958657 GTCTGGGGCTGGAGGAAACTAGG + Intronic
1013324489 6:109031395-109031417 GTGTGAGGCTGGAGAGGAGGTGG - Intronic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1013468504 6:110439104-110439126 GTTTGGGGCTGGTGGGAATTTGG - Intronic
1014179604 6:118370765-118370787 GAGTTGGCCTGGAGAGAGGTGGG - Intergenic
1014589867 6:123250896-123250918 GTGTAGTGTTGGAAAGAAGTGGG - Intronic
1014754460 6:125288044-125288066 GTTTAGTGCTGAAGAGAAGTAGG + Intronic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1015228127 6:130882211-130882233 GTGTGGGGGAGGAGGGAAGGAGG - Intronic
1015443622 6:133277337-133277359 TTTTGGGGCCAGAGAGAAGTTGG - Intronic
1015510222 6:134031040-134031062 GAGTGGAACTGGAGATAAGTAGG + Intronic
1015817975 6:137230081-137230103 AGGTGGGGCTGGGGAGAACTGGG + Intergenic
1016762495 6:147753689-147753711 GTGAGGGGCTGGGGGGAAGGTGG - Intergenic
1017196523 6:151706483-151706505 GGGCGGGGCAGGAGAGAGGTGGG + Intronic
1017319255 6:153069467-153069489 GTGTGGGGTGGGAGATAGGTGGG + Intronic
1017356379 6:153514174-153514196 GTGGGGGGCTGGAGAGCAGGTGG - Intergenic
1017951873 6:159141954-159141976 GTGTGGGGCAGGAAATTAGTTGG + Intergenic
1019526372 7:1482240-1482262 GTCTGGGGTTGGAGAGGAGGAGG - Intronic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1019772565 7:2892999-2893021 GGGTGGGGCTGGAGAGAAGCAGG + Intergenic
1019897645 7:3995127-3995149 GTGAGTGGCTGGAGATAAATCGG - Intronic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020986332 7:15139494-15139516 GTGGGAGGAGGGAGAGAAGTAGG - Intergenic
1021486632 7:21175331-21175353 GTGTGGGTCTTGAGAGAGGTGGG - Intergenic
1021545464 7:21808515-21808537 GAGAGGGGATGCAGAGAAGTTGG - Intronic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021792554 7:24220038-24220060 GTGTGGGGAGGGAGAGCATTAGG + Intergenic
1022103300 7:27181893-27181915 GTGTCTGGCTGCAGAGCAGTGGG - Exonic
1022395155 7:29981659-29981681 GTATGGGGCTGAAGGGAACTGGG - Intronic
1022496923 7:30859194-30859216 GTGTGGGGCTGGGAAGAGGGAGG + Intronic
1022504834 7:30903424-30903446 TTATGGGGCTGGGGAGGAGTAGG + Intergenic
1022537931 7:31109528-31109550 AAGTGGGGCTGGGGAGAAGCAGG + Exonic
1022638213 7:32157203-32157225 GAGGGGGGTTGAAGAGAAGTTGG - Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023648360 7:42342812-42342834 TTGTGAGGCTGCAGAGAAGGGGG + Intergenic
1023971756 7:44996777-44996799 GTAGGGGGCTGAAGAGAGGTTGG + Intergenic
1024046223 7:45587432-45587454 CGGTGGGGTTAGAGAGAAGTTGG + Intronic
1024202207 7:47118960-47118982 GGCTGGGGCTGGGGAGATGTTGG - Intergenic
1024245663 7:47468020-47468042 GTCTGCAGTTGGAGAGAAGTTGG - Intronic
1024541719 7:50480186-50480208 GTAGGGGGCTGGAGATGAGTTGG + Intronic
1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG + Intergenic
1024909528 7:54429190-54429212 GTGTGCTGCTGGAGAGGAGGTGG + Intergenic
1024961537 7:54981704-54981726 GGGGGCGGCTGGTGAGAAGTGGG - Intergenic
1025061860 7:55816205-55816227 GATTGGGGAGGGAGAGAAGTGGG + Intronic
1026017403 7:66682137-66682159 GTGTGAGGCTGGAGCGGACTGGG + Intronic
1026699403 7:72626732-72626754 GACTAGGGCTGGAGAGCAGTGGG - Intronic
1028893830 7:96018614-96018636 GAGTGATGCTGAAGAGAAGTTGG + Intronic
1029277904 7:99418477-99418499 GTGTGGAGCTGGGGAAAAGAAGG - Exonic
1029538834 7:101171477-101171499 ATGAGGGGCTAGAGAGAAGTGGG + Exonic
1030064232 7:105646873-105646895 GTTTGGGGCTGCAGAGAGCTAGG + Intronic
1030241661 7:107332701-107332723 GTGTGGGGCAAAAGAGAAGCAGG + Intronic
1030283283 7:107799045-107799067 GCGTGAGGCTGGATAGAAGCAGG + Intronic
1030338176 7:108347917-108347939 GTATGGGGGTGGAGAGGAGGCGG - Intronic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1031501432 7:122522694-122522716 GGATGGGGCTGAAGAGAGGTTGG - Intronic
1031502191 7:122532519-122532541 GGGTGGGGGTGGGGAGAGGTCGG - Intronic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032459727 7:132101755-132101777 GGCTGGGGCTGGAGAGATGAAGG + Intergenic
1032514405 7:132496024-132496046 GTGTGGGGATGGACAGACCTGGG + Intronic
1032565765 7:132941380-132941402 GTGTGGGTCCGTTGAGAAGTAGG - Intronic
1033480581 7:141736341-141736363 GTGGGGGGCTGGAGGGAAGGTGG - Intergenic
1033652815 7:143355167-143355189 CTGTGGGGTTGGAGAGCACTTGG - Exonic
1034194816 7:149238539-149238561 GTGTGGGGCTGTAGAAAGGGGGG + Intergenic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034498040 7:151433622-151433644 GTGTGGGGTTGGAAAGCTGTAGG - Intronic
1034569534 7:151944279-151944301 CTGTGGGGCTGGGGAGGAGGGGG - Intergenic
1034642106 7:152612428-152612450 GTGTGGGGGTGGAGTGAGGATGG - Intergenic
1035147834 7:156838356-156838378 GTGGGGGCTTGGAGAGATGTTGG - Intronic
1035391680 7:158508550-158508572 GTGGGGAGCTGGAGAGGAGCAGG + Intronic
1036095046 8:5714545-5714567 GAGTGGGACTGGGGAGGAGTAGG - Intergenic
1036242306 8:7091197-7091219 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036259543 8:7228959-7228981 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036307080 8:7610565-7610587 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036311587 8:7687529-7687551 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036357926 8:8058552-8058574 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036529154 8:9566341-9566363 TTTTGGGGCTGGGGAGAAGGAGG - Intronic
1036830433 8:12015933-12015955 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036891965 8:12602258-12602280 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036893021 8:12608394-12608416 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1037502240 8:19497174-19497196 GTGCAGGGCAGGAGGGAAGTGGG - Intronic
1037765656 8:21770797-21770819 TTGTGGGGCTAGAGAGAAGTGGG - Intronic
1037768967 8:21788025-21788047 GTGGGGGGCTGGCGGGAGGTCGG - Intronic
1038355111 8:26821740-26821762 GGGTGGGGCAGAAGGGAAGTGGG - Intronic
1039610644 8:38916396-38916418 GTGGGGGGCTGGGGGGAAATGGG - Intronic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1040864248 8:52032198-52032220 TTTTAGGGCTGGAGAAAAGTGGG + Intergenic
1041079461 8:54202592-54202614 CTGAGGGGCTGGGGAGGAGTAGG + Intergenic
1042332940 8:67600369-67600391 GTGGGTGGATGGAGAGATGTTGG + Intronic
1042692252 8:71513737-71513759 GTGAGGAGCTGGAGAGGAGGTGG - Intronic
1042849696 8:73204306-73204328 GGGAGAGGCTGGAGACAAGTGGG + Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043372558 8:79611709-79611731 GGGAGGGGATGGAGAGAACTGGG + Intronic
1043800088 8:84598039-84598061 GGGTGAGGCTGGAGAGAATAGGG - Intronic
1043973832 8:86563352-86563374 ATGGGGCACTGGAGAGAAGTGGG - Intronic
1044352865 8:91186797-91186819 GTGTGGGGGTGGTGAGGAGGTGG + Intronic
1044565723 8:93659489-93659511 GTGTGGAGCTGTAGAGATGTGGG + Intergenic
1045005344 8:97912629-97912651 GGGTGGGCCTGCAGAGACGTAGG + Intronic
1045286591 8:100796931-100796953 CTTTGGGGCTGGAGAGACCTCGG - Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045892239 8:107170577-107170599 GTGTGGTGCTGGAGAGTGCTGGG - Intergenic
1046781318 8:118218509-118218531 GGGTGGGGGTGGGGAGATGTTGG - Intronic
1047024698 8:120812354-120812376 GCGGTGGGCTGGAGAGAAGCGGG - Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047325761 8:123834494-123834516 GGATGTGGCTGGAGAGGAGTCGG + Intergenic
1047775515 8:128067309-128067331 ATGTGGGGCTAGAGAGTAGAAGG + Intergenic
1048070691 8:131017595-131017617 GTGTGGGGGTGGGGAGTAGATGG - Intronic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048404268 8:134103882-134103904 GTGTGGGGGTGTTTAGAAGTGGG - Intergenic
1048978793 8:139691822-139691844 GGGTGTGGCTGGTGAGGAGTGGG - Intronic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049144509 8:140988787-140988809 AGGTGGCGCTGCAGAGAAGTAGG + Intronic
1049492366 8:142912220-142912242 AGGTGGGGCTGGTCAGAAGTGGG - Intronic
1049509574 8:143020734-143020756 GAGTGGGTCAGGAGAGAAGCAGG + Intronic
1049609922 8:143550146-143550168 AGGTTGGGCTGGAGAGAAGTGGG - Intergenic
1049687770 8:143945821-143945843 GTGTGGGGCTGGAGAGCAGGAGG - Intronic
1049716752 8:144096513-144096535 GGGTGGTGCTGGAGAGATGGGGG + Intronic
1050040742 9:1490720-1490742 GTTTGGGGCCGGGGAGAAGAGGG + Intergenic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1052001518 9:23288013-23288035 TTGTGGAGCAGGAAAGAAGTTGG - Intergenic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1053008854 9:34622201-34622223 GTGTGGGGCTGAAGTGGAATGGG - Intronic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1053564628 9:39235981-39236003 GTGGGGGGCTGGGGAGGAGATGG + Intronic
1053830412 9:42073883-42073905 GTGGGGGGCTGGGGAGGAGGTGG + Intronic
1054132524 9:61383053-61383075 GTGGGGGGCTGGGGAGGAGATGG - Intergenic
1054600146 9:67113572-67113594 GTGGGGGGCTGGGGAGGAGGTGG - Intergenic
1054865868 9:70000290-70000312 GTGGGAGGCTGGAGGGAGGTGGG + Intergenic
1055090207 9:72356763-72356785 GTATTGGGGTGGAAAGAAGTTGG - Intronic
1055738945 9:79364590-79364612 GGGTTGGGCTGGAGAGAGATTGG - Intergenic
1057234239 9:93346209-93346231 GCGCTGGGCTGGAGAGAAGGTGG + Exonic
1057281211 9:93712957-93712979 GTTTGTGGCTGCAGGGAAGTGGG + Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057864560 9:98668681-98668703 GTTAGGGGCTGCAGAGAAGGAGG - Intronic
1057890173 9:98863968-98863990 ATCTGGGGGTGGAGAGAGGTGGG + Intergenic
1058366355 9:104213797-104213819 GGGTGGGAATGGGGAGAAGTTGG - Intergenic
1058576858 9:106413030-106413052 GTGTGGGGCTGAAGCCCAGTCGG - Intergenic
1058794130 9:108481388-108481410 GTGGGTGGCAGGAGAGATGTGGG - Intergenic
1058935229 9:109763769-109763791 ATGTGGGGTGGGAGGGAAGTAGG + Intronic
1059459071 9:114418285-114418307 GTGTGGGGGTGGGGAGAAGAGGG + Intronic
1060991659 9:127853256-127853278 GTGGGGAGGTGGGGAGAAGTTGG + Intronic
1061017722 9:127991976-127991998 GTGAGGCACTGGAGAGTAGTAGG + Intergenic
1061195068 9:129102981-129103003 GTGTGGGGCTGGGCAGGGGTGGG + Intronic
1061216337 9:129224118-129224140 GTGGGGGCCTGGTGAGAGGTTGG - Intergenic
1061628042 9:131853612-131853634 GTGTGTGGCTAGAGAGGGGTAGG + Intergenic
1061636332 9:131911946-131911968 CTGTGGGGCAGCAGGGAAGTTGG - Intronic
1061874970 9:133539114-133539136 GTGAGGGGCTGGAGGGAGGCAGG + Intronic
1061957366 9:133970571-133970593 ATGTGGGGCTGCAGAGATGGAGG + Intronic
1062265062 9:135683264-135683286 GTGTGAGGCTGGGGAGATGGGGG - Intergenic
1062291816 9:135798719-135798741 GTGCAGGGCTGGAGACAAGGAGG - Intergenic
1062460793 9:136661806-136661828 GAGTGGGGCTGGAGAGGTGGGGG + Intronic
1062539230 9:137034319-137034341 GAGGGGGGCTGGAGAGAGGGGGG + Intronic
1062741196 9:138176211-138176233 GTGTGGGGCCGGAAACAACTGGG + Intergenic
1203550704 Un_KI270743v1:163581-163603 GGGGAAGGCTGGAGAGAAGTTGG - Intergenic
1185877106 X:3710779-3710801 GTTTGGGGCCTGAGAGAATTCGG + Intronic
1185956673 X:4498439-4498461 GTTTGGAGCTTGAGAGAAGCTGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186497486 X:10023301-10023323 ATGTGGGGGTGGGGAGAGGTAGG + Intronic
1186863844 X:13699752-13699774 GTGCGGGGATGGTGAGTAGTAGG + Intronic
1187949785 X:24460490-24460512 GTGGGGGGAGGGAGAGAGGTAGG + Intergenic
1188197454 X:27254859-27254881 GTGTGGGACTGGGGAGATGTTGG - Intergenic
1188287239 X:28342790-28342812 GTGTGGGGTTGGAGGTAGGTGGG - Intergenic
1188642121 X:32519327-32519349 TGGTGGGGGTGGAGAGTAGTTGG + Intronic
1189084351 X:38004784-38004806 GTGAGGTGCTGGGGGGAAGTAGG + Intronic
1189214516 X:39311640-39311662 GGTGGGGGATGGAGAGAAGTGGG - Intergenic
1189271881 X:39757826-39757848 GTGTGGGGATGGTGGAAAGTAGG - Intergenic
1189858085 X:45243744-45243766 GTGGGGGGCTGGGAGGAAGTGGG - Intergenic
1189913466 X:45834785-45834807 GTGGGGGGTTGGAGGAAAGTGGG + Intergenic
1190076375 X:47320271-47320293 GCATGGGGCTTGAGGGAAGTTGG - Intergenic
1190448220 X:50552431-50552453 TGGTGGGGCTGGAGAGAAACAGG + Intergenic
1190936717 X:55004421-55004443 AGGTGGGGCTGGAGAGTTGTTGG + Intronic
1191682210 X:63852750-63852772 GTGTGTGGTTTGAGAGAAGGAGG - Intergenic
1191936204 X:66429668-66429690 GTGTGTGGCAGGAAAGTAGTAGG + Intergenic
1192264913 X:69531402-69531424 GTGTGGGGTTGGGGAGTAGGGGG + Exonic
1192526808 X:71853262-71853284 GTCTGGGGCTGGGGAGGATTGGG + Intergenic
1192544118 X:71998583-71998605 GTGAAGGGCTGGAGAGAAGGGGG + Intergenic
1193555871 X:82952754-82952776 GCATGGGGCAGGAGAGATGTTGG + Intergenic
1193820871 X:86163177-86163199 GTGAAGGGCTGGAGGGAAGGTGG - Intronic
1193859787 X:86651213-86651235 TTGTGGGGCAGGAGAGAGGTGGG + Intronic
1195078513 X:101349524-101349546 GTGTGGGGGTGGACCGAATTTGG - Exonic
1195329216 X:103783005-103783027 GTTTGGGGGTGGGGAGGAGTTGG + Intronic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195431176 X:104791215-104791237 GGGTGGGGGTGGAGAGAGGAGGG - Intronic
1195814527 X:108870295-108870317 GTGAGTGGCTGGAAAGAATTTGG + Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1197897720 X:131333269-131333291 GTGCGGGGCTGGGGAGAGGTGGG - Intronic
1198629435 X:138618380-138618402 GAGTGGGGATAGAAAGAAGTAGG - Intergenic
1198800851 X:140446325-140446347 GTGTGGAGCTGGAGTGAACCTGG - Intergenic
1199433763 X:147789671-147789693 GAGTGGGGCTGGACAGAAGCAGG - Intergenic
1200253503 X:154566627-154566649 GTGTGAGGCTGGCTAGAATTGGG + Intergenic
1200264264 X:154637781-154637803 GTGTGAGGCTGGCTAGAATTGGG - Intergenic
1200271058 X:154683864-154683886 GTTTGGGGATGGAGAGAAATTGG + Intronic
1200788171 Y:7276728-7276750 GTTTGGGGCCTGAGAGAATTAGG - Intergenic
1201438392 Y:13984811-13984833 GTGCGGGGAGGGAGGGAAGTGGG - Intergenic
1201446181 Y:14057897-14057919 GTGCGGGGAGGGAGGGAAGTGGG + Intergenic
1201646617 Y:16240491-16240513 GTGAAGGCCTGGGGAGAAGTTGG - Intergenic
1201656196 Y:16344826-16344848 GTGAAGGCCTGGGGAGAAGTTGG + Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic