ID: 1079131428

View in Genome Browser
Species Human (GRCh38)
Location 11:17749020-17749042
Sequence GAACCCTGTGAGCACCACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079131428_1079131431 -5 Left 1079131428 11:17749020-17749042 CCTCCGTGGTGCTCACAGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1079131431 11:17749038-17749060 GGTTCTCACTGCAGGTGTGCCGG 0: 1
1: 0
2: 1
3: 21
4: 227
1079131428_1079131437 18 Left 1079131428 11:17749020-17749042 CCTCCGTGGTGCTCACAGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1079131437 11:17749061-17749083 GAGAAGATGGCTAGTGGCATGGG 0: 1
1: 0
2: 0
3: 12
4: 127
1079131428_1079131433 5 Left 1079131428 11:17749020-17749042 CCTCCGTGGTGCTCACAGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1079131433 11:17749048-17749070 GCAGGTGTGCCGGGAGAAGATGG 0: 1
1: 0
2: 2
3: 25
4: 328
1079131428_1079131436 17 Left 1079131428 11:17749020-17749042 CCTCCGTGGTGCTCACAGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1079131436 11:17749060-17749082 GGAGAAGATGGCTAGTGGCATGG 0: 1
1: 0
2: 2
3: 20
4: 256
1079131428_1079131434 12 Left 1079131428 11:17749020-17749042 CCTCCGTGGTGCTCACAGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1079131434 11:17749055-17749077 TGCCGGGAGAAGATGGCTAGTGG 0: 1
1: 0
2: 0
3: 10
4: 140
1079131428_1079131432 -4 Left 1079131428 11:17749020-17749042 CCTCCGTGGTGCTCACAGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1079131432 11:17749039-17749061 GTTCTCACTGCAGGTGTGCCGGG 0: 1
1: 0
2: 1
3: 17
4: 184
1079131428_1079131438 24 Left 1079131428 11:17749020-17749042 CCTCCGTGGTGCTCACAGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1079131438 11:17749067-17749089 ATGGCTAGTGGCATGGGCACAGG 0: 1
1: 0
2: 2
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079131428 Original CRISPR GAACCCTGTGAGCACCACGG AGG (reversed) Intronic
901129416 1:6952948-6952970 GAACCCAGTGTCCACCACGGTGG - Intronic
902744049 1:18461281-18461303 TAACCCTTTGAGCACTACGCAGG + Intergenic
904679030 1:32215988-32216010 GTACCCTGTGAGCCCAGCGGAGG - Exonic
915161190 1:153922254-153922276 GCACCCTGAGGGCACCACTGGGG + Intronic
916720573 1:167482296-167482318 GAGTCTTGTGAGCACCAGGGGGG - Intronic
919859559 1:201730468-201730490 GAAGCCTGTGAGCATGACAGGGG + Intronic
920541910 1:206785130-206785152 GACCCCTGTGAAAACCACTGTGG + Intergenic
921502455 1:215922378-215922400 GAAGACTGTGAGCAACACGATGG + Intronic
1063395714 10:5685205-5685227 GAACCCTGCGAGGAGGACGGCGG + Intronic
1064104999 10:12493286-12493308 GAGCCCTGTGAGCACCCCAAAGG - Intronic
1064149251 10:12849215-12849237 GAACCCACTTAGCACCACCGGGG + Intergenic
1068984086 10:63090970-63090992 GAACCCTGGGAGCAGTACAGAGG + Intergenic
1069584539 10:69589326-69589348 GAACCCAGTGAGGACCAGGCTGG + Intergenic
1070565810 10:77603175-77603197 GAGCCCTGAGGGCACCAGGGGGG - Intronic
1074287467 10:112111496-112111518 CAACCCTGTGAGCTCCATGAGGG - Intergenic
1076506206 10:130974279-130974301 GTACCTTGTGAGCACCACAATGG - Intergenic
1077332416 11:1989390-1989412 GAGCCCTGTGAGCCCCTGGGGGG - Intergenic
1077468715 11:2746856-2746878 GACCCCTGTGAGCCCCACTGGGG + Intronic
1079131428 11:17749020-17749042 GAACCCTGTGAGCACCACGGAGG - Intronic
1082159544 11:48873182-48873204 GAACCCTTTGAGGCCTACGGTGG + Intergenic
1084717945 11:70885390-70885412 GATCTCTGTGTGCACCATGGGGG + Intronic
1084969051 11:72759698-72759720 GACCCCTGTGAGCTCCTCGTGGG + Intronic
1085771711 11:79331457-79331479 GCACCCTGTGAGCACCACCCAGG - Intronic
1085951562 11:81338616-81338638 AAACACTGTGATCACAACGGAGG + Intergenic
1089212404 11:116814377-116814399 GGTCCCTGTGGGCACCAGGGAGG - Intergenic
1202815397 11_KI270721v1_random:44566-44588 GAGCCCTGTGAGCCCCTGGGGGG - Intergenic
1091558845 12:1594947-1594969 TAACCCTGTGGGCGCCACGGGGG + Intronic
1096451866 12:51749629-51749651 GACCCCTGTAAGCGCCACGTGGG - Intronic
1102564101 12:113783397-113783419 GATGACTGTGAGCACCCCGGAGG + Intergenic
1103969871 12:124663879-124663901 GGACCCTGTGTGCATCCCGGTGG - Intergenic
1104642970 12:130479153-130479175 GAGCCCTGTTGGCAGCACGGAGG - Intronic
1105828071 13:24140261-24140283 GTAATCTGTGAACACCACGGTGG + Intronic
1115178290 14:30591228-30591250 GACCCCTTTGAGCACCACCTAGG - Intronic
1119700797 14:76753177-76753199 GAGCCCTGTGGGCAGCACGATGG + Intergenic
1121108558 14:91296523-91296545 GGACCCTGAGGGCCCCACGGGGG - Intronic
1121720980 14:96108531-96108553 GAACACTGTGGGTACCACAGTGG - Intergenic
1123052974 14:105556087-105556109 GAACCCAGTGGGCACCAGGCTGG - Intergenic
1126978342 15:54211817-54211839 CAACCCTGTGAGCAGGACTGAGG + Intronic
1134234999 16:12458699-12458721 CAATGCTGTGAGCACCAAGGAGG + Intronic
1135591268 16:23706547-23706569 GAAGCCTGTGAACATCACAGTGG + Intronic
1135969213 16:27060216-27060238 AAATCCTGTGACCACCACCGAGG - Intergenic
1138565695 16:57831247-57831269 GAACCCTGCTAACCCCACGGGGG + Intronic
1139591790 16:67936984-67937006 GTACCCAGTGAGCAGCACAGAGG - Exonic
1140229859 16:73108713-73108735 TAACCCTGTTAGAACCACAGTGG - Intergenic
1140488903 16:75317691-75317713 GAACCCTGGGAGCTCAACAGAGG + Intronic
1142719528 17:1766970-1766992 GAACCCTGCCAGCCCCCCGGAGG + Exonic
1142876431 17:2854045-2854067 GAGTCCGATGAGCACCACGGCGG - Intronic
1142899587 17:3003884-3003906 GAGCCCTGTGGGCCACACGGAGG - Intronic
1144521977 17:15958774-15958796 GAACCCTGTGTGCCCCCCAGAGG - Intronic
1144795407 17:17888057-17888079 GAAGCCTGAGAGCAGCACTGAGG + Intronic
1147521756 17:41179817-41179839 AGACCCTGTGAGCCCCATGGTGG + Intergenic
1148541209 17:48482151-48482173 CAACCCTGTGAGCATTACAGTGG + Intergenic
1148647461 17:49227327-49227349 GACCCCTGAGAGCAACAGGGAGG - Intronic
1151226214 17:72650190-72650212 GATCACTGTGAGCACCACTGGGG - Intronic
1152120262 17:78414117-78414139 AAACCCTGTGAGGACAAAGGGGG - Intronic
1153678368 18:7476619-7476641 GAGCCCTGTGACCATGACGGAGG - Intergenic
1159456529 18:68666459-68666481 GAAGCCTGCTAGCACCACTGAGG - Intergenic
1161246801 19:3257258-3257280 GAAGCATGTGAGGACCACTGAGG + Intronic
1165896682 19:39145690-39145712 GGGGCCTGTGTGCACCACGGAGG + Intronic
925263118 2:2545330-2545352 GACTCCTGTGAGACCCACGGGGG - Intergenic
927913630 2:26919205-26919227 GACCCCCATGAGCCCCACGGTGG + Intronic
934164464 2:89281561-89281583 GAAACCTGCAAACACCACGGTGG + Intergenic
934202810 2:89900963-89900985 GAAACCTGCAAACACCACGGTGG - Intergenic
935698325 2:105789050-105789072 GAACCCTCTGAGCACAAGTGAGG - Intronic
947588293 2:231370428-231370450 CAACTCTGTGAGCTCCACAGAGG - Intronic
1169198748 20:3697434-3697456 CAACCCTGTGGGCACCCCAGGGG - Intronic
1175292127 20:57882795-57882817 GAGCCCTGTGAGCCCCCAGGAGG - Intergenic
1175329185 20:58150973-58150995 GAAACCTCTCAGCACCGCGGCGG + Exonic
1176658735 21:9614064-9614086 AAATCATGTGAGCACCACAGGGG - Intergenic
1179460899 21:41534357-41534379 GAATCCAGTGAGCACCATGCTGG - Intergenic
1181037642 22:20177617-20177639 GAACCCAGAGAGCATCGCGGAGG + Intergenic
1183007282 22:34913956-34913978 TGACCTTGTGAGAACCACGGGGG - Intergenic
1183705774 22:39474178-39474200 AAACCATGTGAGCACCCCGGTGG - Intronic
1184295212 22:43519071-43519093 TCACCATGTGAGCACCACAGTGG - Intergenic
952926876 3:38326683-38326705 GAGCCCTGTGGGCCCCATGGAGG - Intergenic
953620136 3:44525911-44525933 CAACCCTGGGAGCACCCCGGTGG - Intergenic
954600323 3:51862654-51862676 AAACCCAGTGAGCACCAAAGAGG + Intronic
957415065 3:79891187-79891209 GGACCCTGTGATAACCACTGAGG + Intergenic
958955962 3:100466363-100466385 GACCCCTGAGAGCAACAGGGGGG - Intergenic
960493947 3:118353216-118353238 GAACCCTTTCAGCACCACATTGG - Intergenic
961569152 3:127785854-127785876 GAGCACTGTGAGCACCATGAGGG + Intronic
968518414 4:1024345-1024367 GCACCCCGTGAACACGACGGTGG + Exonic
968668866 4:1837167-1837189 GACCCCTGTGAGCAGCACCAAGG - Intronic
969389081 4:6877304-6877326 CAAGCCTGTGGGCACCACGAAGG + Intronic
976967930 4:91067720-91067742 GAAACCTGTGAGAAACACTGAGG - Intronic
982093594 4:151900317-151900339 AAATCCTGTGAGCACCAAGATGG - Intergenic
982238741 4:153277384-153277406 GACCACAGTGAGCACCAGGGAGG - Intronic
984236001 4:177159746-177159768 AAACCCTCTGAGCTCCACGCTGG - Intergenic
985416545 4:189741195-189741217 AAATCATGTGAGCACCACAGGGG + Intergenic
985823742 5:2178316-2178338 GCACCCAGCGAGCACCACGCAGG - Intergenic
985853941 5:2410632-2410654 GAGCTCAGTGAGCACCACTGGGG - Intergenic
997894341 5:137702809-137702831 GCAGCCTCTGAGAACCACGGAGG + Intronic
1000655842 5:163876856-163876878 GACCCCTGAGAGCACCAAGCTGG - Intergenic
1002108120 5:176890276-176890298 CAACTCTGGGAGCACTACGGAGG - Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1007606823 6:43123555-43123577 GAGCCCAGAGAGCAACACGGAGG + Intronic
1007957336 6:45929704-45929726 GAGGCCTGGGAGCCCCACGGTGG - Intronic
1018001291 6:159580808-159580830 GAGCCAGGTGAGCAGCACGGAGG + Intergenic
1019614027 7:1950806-1950828 GAGCCCAGTGAGCACCGCGGTGG + Intronic
1027635407 7:80666546-80666568 GAACACTGTCAGTACAACGGTGG - Intronic
1033253423 7:139778607-139778629 GAACCCAGCGACCACCCCGGGGG - Intronic
1033261843 7:139850779-139850801 GAACACTGTGATGACCAAGGCGG + Intronic
1035225004 7:157428068-157428090 GAACCCTGGGCTCACCACAGGGG + Intergenic
1035878613 8:3219271-3219293 GAACCCTGAAAGGCCCACGGAGG + Exonic
1042342747 8:67697175-67697197 GGACCCTGGGAACACCACGAGGG + Intronic
1043950803 8:86307225-86307247 GAAGCCTTTGAGCACCAGAGGGG - Intronic
1048435217 8:134410076-134410098 GAACCATATGAGCACAAGGGTGG + Intergenic
1049714292 8:144082661-144082683 GCAGCCTGTGGGCACCGCGGCGG + Exonic
1203373152 Un_KI270442v1:332525-332547 GAGCCCTTTGAGCCCCATGGTGG + Intergenic
1203636462 Un_KI270750v1:117643-117665 AAATCATGTGAGCACCACAGGGG - Intergenic
1190021945 X:46886523-46886545 GTACTATGTGAGCACCATGGAGG - Intergenic
1195252673 X:103063852-103063874 GAAAACGGTGAACACCACGGGGG - Intronic
1201189615 Y:11435891-11435913 CACCCCTGTGGACACCACGGGGG + Intergenic