ID: 1079131568

View in Genome Browser
Species Human (GRCh38)
Location 11:17749798-17749820
Sequence CAGCCCCAACACCTGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079131563_1079131568 -10 Left 1079131563 11:17749785-17749807 CCTGACCCCTGTTCAGCCCCAAC 0: 1
1: 0
2: 0
3: 23
4: 231
Right 1079131568 11:17749798-17749820 CAGCCCCAACACCTGGAGTATGG 0: 1
1: 0
2: 0
3: 22
4: 199
1079131560_1079131568 17 Left 1079131560 11:17749758-17749780 CCTGCAAGCTGCCGTGGGTGCTT 0: 1
1: 0
2: 1
3: 3
4: 109
Right 1079131568 11:17749798-17749820 CAGCCCCAACACCTGGAGTATGG 0: 1
1: 0
2: 0
3: 22
4: 199
1079131559_1079131568 18 Left 1079131559 11:17749757-17749779 CCCTGCAAGCTGCCGTGGGTGCT 0: 1
1: 0
2: 0
3: 20
4: 152
Right 1079131568 11:17749798-17749820 CAGCCCCAACACCTGGAGTATGG 0: 1
1: 0
2: 0
3: 22
4: 199
1079131562_1079131568 -9 Left 1079131562 11:17749784-17749806 CCCTGACCCCTGTTCAGCCCCAA 0: 1
1: 0
2: 1
3: 26
4: 228
Right 1079131568 11:17749798-17749820 CAGCCCCAACACCTGGAGTATGG 0: 1
1: 0
2: 0
3: 22
4: 199
1079131561_1079131568 6 Left 1079131561 11:17749769-17749791 CCGTGGGTGCTTCTGCCCTGACC 0: 1
1: 0
2: 2
3: 35
4: 262
Right 1079131568 11:17749798-17749820 CAGCCCCAACACCTGGAGTATGG 0: 1
1: 0
2: 0
3: 22
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079131568 Original CRISPR CAGCCCCAACACCTGGAGTA TGG Intronic
901002482 1:6155498-6155520 AAGCCCCGGCACCTGGGGTAGGG - Intronic
902034087 1:13443872-13443894 CAGCCCCACCCTCTGGAGTGGGG - Intergenic
902412406 1:16219186-16219208 CAGCCCCAAAGCCCTGAGTAAGG - Intergenic
903292947 1:22326196-22326218 CAGCCCCTCCAGCTGGAGTGTGG + Intergenic
903861034 1:26364711-26364733 CAGCTCCAGCACCTGGATTTCGG + Exonic
903885827 1:26540528-26540550 CACCCACAACACCTTGATTATGG + Intronic
903908258 1:26702085-26702107 CTGCCCAAACACCAGGAGTCTGG - Intronic
904468209 1:30720206-30720228 CAGGCTGAACACCTGGAGTCTGG + Intronic
905632724 1:39527574-39527596 CAGCCCCTCCACCTGGACCAGGG + Intergenic
905665092 1:39758843-39758865 CAGCCCCTCCACCTGGACCAGGG - Exonic
905960650 1:42039763-42039785 CAGGCCCAACTCCTGGAGTCTGG - Intergenic
906108198 1:43307131-43307153 CAGCCCCACAACCTGGAGGAAGG - Exonic
907179925 1:52560535-52560557 CAGCCCCAACTCCTGGGCTCAGG - Intergenic
908896588 1:68907890-68907912 CAGCCAAACCACCTGAAGTAAGG + Intergenic
910953503 1:92676396-92676418 TACCCCCAACCCCTGGAGAAAGG - Intronic
911944128 1:104084396-104084418 CATTCCCAACACCTGGAGAAAGG - Intergenic
913971505 1:143421184-143421206 CATGCCCAACACATGGAGTGCGG + Intergenic
914065882 1:144246797-144246819 CATGCCCAACACATGGAGTGCGG + Intergenic
914113269 1:144719557-144719579 CATGCCCAACACATGGAGTGCGG - Intergenic
915740992 1:158118243-158118265 CAGCCCCAACACACGCAGTCTGG + Intergenic
920052886 1:203174187-203174209 CAGCCCCCACGCCTTGAGAAAGG - Intronic
920702003 1:208225006-208225028 CTGCCTCACCGCCTGGAGTATGG - Intronic
922800660 1:228363301-228363323 GACCCCCAACACCTGGGGGAAGG - Intronic
1063379001 10:5572558-5572580 CAGCTCCAGCTCCTGGAGGATGG - Intergenic
1063623057 10:7666872-7666894 CAGCCCCAGCAGCAGGAGCATGG + Exonic
1070838857 10:79469243-79469265 GGGCCCCAACATCTGGAGTGGGG - Intergenic
1071795624 10:89002037-89002059 CAGCCCCAAGACCTCCAGTCTGG - Intronic
1072442885 10:95472456-95472478 CAGACCCAACAACTGTGGTATGG + Intronic
1072665268 10:97388222-97388244 CAGGCCCAAAAGCTGGAGAAAGG - Intronic
1075929995 10:126287924-126287946 CAGTCCCCACACCCGGAGCAGGG + Intronic
1076751635 10:132546363-132546385 CAGCCCCACCTCCAGGAGCATGG + Intronic
1077308371 11:1877843-1877865 CATGCCCAACACATGGAGTGCGG - Intronic
1079102515 11:17550764-17550786 CAGCCCCAGCCCCAGGAGTCAGG - Intronic
1079131568 11:17749798-17749820 CAGCCCCAACACCTGGAGTATGG + Intronic
1081373636 11:42334032-42334054 AAGCCCCAACACATGGTGTTGGG - Intergenic
1081731743 11:45376577-45376599 CAGCTCAAACATCTGCAGTAGGG - Intergenic
1082981887 11:59131702-59131724 CAGGCCCAACACCATGTGTAAGG - Intergenic
1083777964 11:64903414-64903436 CGGCCCCAGCACCTGGGGGAAGG + Intronic
1085955563 11:81389479-81389501 TGGCCCCAACAACAGGAGTAAGG + Intergenic
1088662561 11:112062218-112062240 CAGACCAGATACCTGGAGTATGG - Intronic
1089769106 11:120789906-120789928 TTGCCCCACCACCTGGAGTTTGG + Intronic
1091028940 11:132166476-132166498 AAGCCCCAACACATGGAGGAGGG + Intronic
1091292363 11:134448331-134448353 CAGCCCCAAAACTTGCAGAATGG + Intergenic
1092211769 12:6651035-6651057 CAGCCTCAGCACCGGGAGTGGGG + Exonic
1092501390 12:9051043-9051065 CAGTCCCACCAACTGGAGTGGGG + Intergenic
1098954078 12:76670448-76670470 CAATCCCAGCTCCTGGAGTACGG - Intergenic
1103415978 12:120741666-120741688 CTCCCCCATCACCTGGAGGAAGG - Intergenic
1103623119 12:122200804-122200826 CCGGCCCAGCACCTGGAGGATGG - Exonic
1105210117 13:18252648-18252670 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1111730211 13:92065337-92065359 AAGCCCCAACCCCTGCAGTCAGG - Intronic
1112783315 13:102925816-102925838 CAGCCCCAGCAGCTGCTGTAGGG - Intergenic
1114472671 14:22974554-22974576 CAGCCCCTACATCTGCAGTCTGG + Intronic
1118972547 14:70649368-70649390 CAGCCCCCAAGCCTGGAGTCTGG - Intronic
1119423113 14:74519703-74519725 CAGCCCCAGCAGCTGGGGAACGG - Intronic
1124496036 15:30187720-30187742 CAGCCTCAACAGCGGGAGCAGGG + Intergenic
1124747538 15:32350927-32350949 CAGCCTCAACAGCGGGAGCAGGG - Intergenic
1125089503 15:35773638-35773660 CTGCCCCAGGACATGGAGTAAGG - Intergenic
1125560655 15:40630456-40630478 CATCCCCAACCCCTGGGGTTAGG + Intronic
1126791881 15:52229194-52229216 CAACTCCAACACCTGGTGGAGGG - Exonic
1127857223 15:62962621-62962643 GGGCCCCAACTCCTGGAGAAGGG - Intergenic
1129602550 15:77008795-77008817 CAGCCCCCAGGCCTGGGGTAGGG + Intronic
1130273484 15:82464480-82464502 CAACCTCAACATCTGCAGTAGGG + Intergenic
1130465835 15:84191851-84191873 CAACCTCAACATCTGCAGTAGGG + Intergenic
1130498430 15:84481685-84481707 CAACCTCAACATCTGCAGTAGGG - Intergenic
1130588124 15:85196447-85196469 CAACCTCAACATCTGCAGTAGGG + Intergenic
1130783496 15:87070153-87070175 CAGGCCCAACACCAGATGTAGGG + Intergenic
1130928288 15:88401474-88401496 AAGCCCCAGCCCCTGGAGAAGGG + Intergenic
1130957967 15:88640328-88640350 CATCCCCAGCACCTGGAGCCTGG - Intronic
1134847132 16:17449427-17449449 CAGGCCCAGCACCTGGAAGAGGG + Intronic
1135083074 16:19452764-19452786 CTGCCCCAAACCCTGGAGGAAGG - Intronic
1135109333 16:19678446-19678468 CAGTGCCAACAGCTGAAGTAAGG - Intronic
1137549203 16:49425328-49425350 CAGAACCAACACCTGGCTTAAGG + Intergenic
1141477555 16:84283967-84283989 CAGCCCCTGCAGCTGGAGTGGGG + Intergenic
1143503264 17:7351026-7351048 CAGGCCCAACACCTGAACTCTGG + Intronic
1143508750 17:7383959-7383981 CAGCTCCATCACCTGCAGGAGGG - Exonic
1143593027 17:7897140-7897162 GAGCCCCCACCCCTGGACTATGG + Exonic
1145904918 17:28511018-28511040 TAGCCCCAGCACCTGGAGGAAGG + Intronic
1147949169 17:44097455-44097477 CTGCCCCAGCACCAGGAGAAAGG + Intronic
1148210897 17:45807914-45807936 CAGCCCAAACACCTAGATTTGGG - Intronic
1148476038 17:47929296-47929318 CCTCCCCAACCCCTGGAGGAAGG + Intergenic
1148834407 17:50458243-50458265 CAACCCCAGAACCTGGAGTTTGG + Intronic
1150265583 17:63830562-63830584 CCTCCCCAACCCCTGCAGTAGGG - Intronic
1152252466 17:79219114-79219136 CAGCCCCATCACCAGGAGAAGGG - Intronic
1152595376 17:81235343-81235365 CACACCCACCACCTGGAGCAGGG + Intronic
1154021300 18:10666166-10666188 CTGCCCCTGCACATGGAGTAAGG + Intergenic
1155909130 18:31488151-31488173 CAGCACCAACATTTGGAGTCAGG - Intergenic
1156222252 18:35064401-35064423 CAGCCCCCTCCCCTGAAGTATGG + Intronic
1156510234 18:37630245-37630267 CAGCCCCAACACCCCCATTATGG - Intergenic
1157097915 18:44703468-44703490 CAGCCACAACACCCGGTATAAGG - Intronic
1157514634 18:48302115-48302137 CAGCGTCAACTCCTGGAGAAGGG - Intronic
1164087842 19:21920074-21920096 TAGGCCCAACACCTAGGGTATGG + Intergenic
1164108603 19:22133635-22133657 TAGGCCCAACACCTAGGGTATGG + Intergenic
1165480336 19:36059818-36059840 CAGCGTAAACACCTGGAGGAGGG + Intronic
1165741560 19:38207884-38207906 CACCCCCAACACCAAGAGTGAGG + Exonic
1166993027 19:46704590-46704612 CATCCCCAACAACTGTAGTGGGG - Exonic
1167610691 19:50506533-50506555 CAGCCCCAGTACCTGGGGCAGGG + Exonic
1168347629 19:55658754-55658776 CAGCCCCACCATCAGGACTAGGG - Intronic
1168712646 19:58510829-58510851 GAGCCCCCACCCCTGGTGTAGGG + Exonic
927700487 2:25265238-25265260 CAGCCCCAACAACTGCAGGCCGG + Intronic
929888813 2:45902706-45902728 CAGCCCCCAGACCTAAAGTAGGG + Intronic
931883090 2:66587440-66587462 TAGTCCCAACCCCTGGAGTCTGG - Intergenic
933740517 2:85530509-85530531 CAGCCCAATCACCTGAGGTAAGG + Intergenic
934176199 2:89582117-89582139 CATGCCCAACACATGGAGTGTGG + Intergenic
934286509 2:91656478-91656500 CATGCCCAACACATGGAGTGTGG + Intergenic
934516096 2:94987676-94987698 CAGCACCACCTCCTGGACTATGG + Intergenic
938379200 2:130827182-130827204 CTGCCCCAGCTCCTGGAGCAGGG - Intergenic
940678679 2:156756364-156756386 CAGCACCAACAACTGGAAAATGG - Intergenic
940899774 2:159115907-159115929 CAGCACCTACACCTGTGGTAGGG - Intronic
941694723 2:168538693-168538715 CATCCCCAACACCTAGAGCAGGG + Intronic
945514587 2:210747242-210747264 CACCCCCATCACCTGGTGTTGGG + Intergenic
945852277 2:215023253-215023275 CATCCCCAGCACCTGGCATAGGG - Intronic
947293422 2:228603177-228603199 CATACCCCACTCCTGGAGTAGGG + Intergenic
1171291263 20:23984338-23984360 CAGTTCCAACACCTGGGGCAGGG - Intergenic
1171323327 20:24266509-24266531 CAGCCCCCACACAAGGAGTAGGG + Intergenic
1174190987 20:48740311-48740333 CACTCCCAGCACCTGGGGTAAGG - Intronic
1175121086 20:56716878-56716900 GAGCCCCCACCCCTGGAGGAGGG - Intergenic
1175961831 20:62641335-62641357 GAGCCCCAAGCCCTGGAGGAAGG + Exonic
1176035023 20:63031965-63031987 CAGCCCCATCAGAGGGAGTAGGG - Intergenic
1176172990 20:63704580-63704602 CAGCCCCAAGACCAGCAGCAAGG + Intronic
1176295474 21:5069850-5069872 CAGCCCCAGCCCCTGGGGTCTGG + Intergenic
1176296611 21:5076575-5076597 AAGCCCCCACACCTGGGGTCTGG + Intergenic
1176379486 21:6104900-6104922 CAGCCCCAGCCCCTGCAGTGTGG - Intergenic
1178668023 21:34565941-34565963 CAGCCCCGACACCTGGTAGATGG - Intronic
1179589592 21:42397769-42397791 CAGCTCCAAAGCCTGGAATAGGG + Intergenic
1179743987 21:43433337-43433359 CAGCCCCAGCCCCTGCAGTGTGG + Intergenic
1179860438 21:44185546-44185568 AAGCCCCCACACCTGGGGTCTGG - Intergenic
1179861576 21:44192274-44192296 CAGCCCCAGCCCCTGGGGTCTGG - Intergenic
1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG + Intergenic
1180780173 22:18515622-18515644 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1180812889 22:18772943-18772965 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1181028061 22:20137097-20137119 CCTCCCCAACCCCTGGATTAGGG + Intronic
1181199067 22:21207259-21207281 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1181400697 22:22648597-22648619 CAGTTCCAACACCTGGGGCAGGG + Intergenic
1181702677 22:24629695-24629717 CAGTTCCAACACCTGGGGCAGGG + Intergenic
1181783781 22:25211111-25211133 CAGCCCCAGGATCTGGAGTTGGG + Intergenic
1182183714 22:28378564-28378586 CAGCCCCAACCTCTGGGGTCAGG - Intronic
1182278776 22:29206308-29206330 CAGCTCCGACACATGGAGTAGGG - Intronic
1182332567 22:29561420-29561442 CTGCCCCAACACCTAGACTGGGG - Intronic
1185125198 22:49006717-49006739 CGGCCCCAAGCCCTGGAGCAGGG - Intergenic
1185333851 22:50262921-50262943 GAGCCCCACCACGGGGAGTAAGG - Intergenic
1203227758 22_KI270731v1_random:87647-87669 CAGTTCCAACACCTGGAGCAGGG + Intergenic
949179256 3:1107641-1107663 TAGCCACCACACCTGGAGCATGG - Intronic
949448099 3:4156691-4156713 CCTGCCCAATACCTGGAGTAAGG + Intronic
949905363 3:8854306-8854328 CAGGCCCAACACCAGAAGTAAGG - Intronic
951372037 3:21861234-21861256 CAGCCAAAACACCTGGACTATGG - Intronic
952884138 3:38002467-38002489 CAGCCACAACACCAGGACCATGG + Exonic
954616486 3:51971355-51971377 CCGCCCCCACCCCTGGAGTGGGG + Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
963762465 3:149297615-149297637 AAGCCCCAACTCCTGCAGTTAGG + Intergenic
964848801 3:161071735-161071757 CATCCCCAACAGCTGGAAAAGGG - Exonic
965155567 3:165048842-165048864 CAGGCACAACACCTGAAGTCAGG - Intronic
967270478 3:187728564-187728586 CAGCCTCAGCACCTGGGGCAGGG + Intronic
967683259 3:192390289-192390311 CAGCCCCCACACTCTGAGTATGG - Intronic
968966595 4:3772086-3772108 CAGCCCCCACCCCCGGAGTCGGG - Intergenic
969244282 4:5922474-5922496 TAGCCCCAACACCTGATGCAGGG - Intronic
969592126 4:8127889-8127911 CTGCCCCTACACATGGAGGAAGG - Intronic
972183934 4:36504931-36504953 CAAGCCCAGCACCTGGATTATGG - Intergenic
972697488 4:41462152-41462174 CAGCCCCAGCATCTGGTGTGGGG + Intronic
973619272 4:52711503-52711525 CACCCCCAACACCTGGGGAAAGG + Intergenic
974551469 4:63380148-63380170 GAGCCCCAGCATCTGAAGTAGGG - Intergenic
974692155 4:65309999-65310021 CAGCCTCCTCACCTGCAGTATGG - Intergenic
976021858 4:80639119-80639141 CAGCCCTAACTCCTGATGTATGG - Intronic
976095378 4:81502837-81502859 CATCCCCAACACCTAGAATAAGG + Intronic
982257801 4:153466895-153466917 CAGCCCGAGCATCTGGAGTGTGG - Intronic
982293166 4:153799850-153799872 GAGCCACAACATCTGGAGTCTGG + Intergenic
983850067 4:172569636-172569658 CAACCCCAACCCCTGAAATAAGG + Intronic
985042354 4:185904362-185904384 CATCCACTACCCCTGGAGTAAGG - Intronic
990182581 5:53178580-53178602 CAACCTCATCACCTGGGGTAGGG + Intergenic
991995486 5:72382373-72382395 AAGCCCCAGCACCTGGACTAAGG + Intergenic
992769294 5:80032534-80032556 GAGTCCCAACACCTCAAGTAGGG + Intronic
995684521 5:114757602-114757624 CTACCCCAACAAATGGAGTACGG + Intergenic
996118863 5:119648666-119648688 CACCCCCAAGACCTGGTGTTGGG - Intergenic
1000459690 5:161499183-161499205 CAGCCCCAACACCTGGCAGTGGG - Intronic
1000648168 5:163783418-163783440 AATCCCCAACTCCTGGAATAGGG + Intergenic
1000961917 5:167610385-167610407 CACCCCCAACCCCTGGAGAGAGG - Intronic
1001119685 5:168969751-168969773 CAGCCCCAGCTCCTGGAGAGCGG + Intronic
1003349041 6:5298363-5298385 CACCCCCAACCCCAGGAGTGGGG - Intronic
1004916844 6:20340390-20340412 CAGCCCCCAGCCCTGGAGAAAGG + Intergenic
1005642195 6:27807124-27807146 CAGACCCACCACCTGGAGCCTGG + Intergenic
1009824152 6:68845358-68845380 CAGCCCCAGAACCTGGAGAGAGG + Intronic
1009892684 6:69706971-69706993 CAGGCCCAAAACCAAGAGTAGGG + Intronic
1011752541 6:90467997-90468019 CAGAACCAATACCTGGGGTAGGG + Intergenic
1014169834 6:118266704-118266726 CTGCCCCAGCACCTGGAGGCAGG + Intronic
1018478408 6:164166529-164166551 AAGCCCCAACACCGGGTGGAGGG - Intergenic
1020049626 7:5072911-5072933 CAGCCCCGACTCCTGGGGAAGGG - Exonic
1022453395 7:30536531-30536553 CACCCCCAAGACCTGGTGTTGGG + Intronic
1022589865 7:31651303-31651325 CAGCCCACACACCTGGAGCAAGG + Intronic
1024092814 7:45960618-45960640 CAGCCATATCACCTGAAGTAAGG - Intergenic
1024845269 7:53635108-53635130 CAGCCACATCACCTGAGGTAAGG + Intergenic
1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG + Intergenic
1029542313 7:101191073-101191095 CTGCCCCATCCCCTGGAGGAAGG - Intergenic
1031111203 7:117611061-117611083 CAGCTCCAACACATGAAGAAAGG - Intronic
1034372817 7:150615191-150615213 CACCCCCACCACCTGGTGTTGGG - Intergenic
1034453140 7:151148602-151148624 CAGCACCAACAAATGGAGCAGGG - Exonic
1035135919 7:156703231-156703253 CAGCACCAACCACTGGAGTTAGG + Intronic
1039119043 8:34125365-34125387 CTGGCCAAACACCTGGAGAAAGG - Intergenic
1041007455 8:53509046-53509068 CAGCACCAACACCTGCAGCTTGG - Intergenic
1045691592 8:104764907-104764929 GAGCCCCAACATCTGGACTTGGG + Intronic
1046695981 8:117340188-117340210 GAGCCCCATCAACTGGAGTTAGG + Intergenic
1046891232 8:119423086-119423108 CAGCTCCAGCTCCTGGAGGAAGG - Exonic
1047582123 8:126227358-126227380 CAGTCCCAAAACATGGAGCAGGG + Intergenic
1050520932 9:6498871-6498893 CAGCCCCTACACATGCAGTGTGG - Intronic
1051828936 9:21254454-21254476 CATCCCCAATATCTGAAGTACGG - Intergenic
1052370617 9:27660246-27660268 TCTCCCCAGCACCTGGAGTAAGG + Intergenic
1052820562 9:33135208-33135230 CAGCGCCAGCAGCTGGACTATGG - Exonic
1054953091 9:70875240-70875262 CAGCCCCAATTCCTAGAGTTAGG + Intronic
1055583854 9:77735662-77735684 CCGCCCCAACAACAGGAGTTTGG - Intronic
1056691671 9:88813354-88813376 CAGCCCCTTCACCTGCAGTCGGG + Intergenic
1056716494 9:89035221-89035243 CAGCCCCACGACCTGGCGTTGGG + Intronic
1056923842 9:90815390-90815412 CTGCCCCAGCGCCTGGAGTGAGG - Intronic
1057482504 9:95456402-95456424 CAGGACCATCACCTGGAGCAGGG + Exonic
1057854273 9:98590639-98590661 CAGCCCCCACCCCCGGAGAAGGG - Intronic
1059356408 9:113702639-113702661 CAGCCCCAACACCTGAGATTTGG + Intergenic
1059779788 9:117514357-117514379 CTGGCCCAACAACTGGAGTTTGG + Intergenic
1060811023 9:126611597-126611619 CACCCCCAACTCCTGGCGCAAGG - Intergenic
1060980521 9:127788973-127788995 CACCCACATCACCTGGAATATGG - Intronic
1186409613 X:9335309-9335331 CACCCCCAACACCAGGTTTATGG + Intergenic
1189293343 X:39901375-39901397 CAGCCTCAAGACCTGGAGGATGG + Intergenic
1189381174 X:40503373-40503395 CAGCCCAAAGACATGGAGTTGGG - Intergenic
1190556061 X:51637030-51637052 CAGCCTCAACACCACCAGTAGGG - Intergenic
1198035403 X:132796755-132796777 CAGCCCCAATCCATGGAGCAAGG + Intronic
1199890205 X:152071514-152071536 CACCCCCACCTCCTGGACTAAGG - Intergenic