ID: 1079133110

View in Genome Browser
Species Human (GRCh38)
Location 11:17761033-17761055
Sequence ACGTGGACCCCTGCCTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079133110_1079133119 24 Left 1079133110 11:17761033-17761055 CCAAGACAGGCAGGGGTCCACGT 0: 1
1: 0
2: 1
3: 6
4: 152
Right 1079133119 11:17761080-17761102 AGGAAGTCCCCCTCACCTCGAGG 0: 1
1: 0
2: 0
3: 7
4: 90
1079133110_1079133114 -2 Left 1079133110 11:17761033-17761055 CCAAGACAGGCAGGGGTCCACGT 0: 1
1: 0
2: 1
3: 6
4: 152
Right 1079133114 11:17761054-17761076 GTGGAAAACCCTGCAAGCATGGG 0: 1
1: 0
2: 0
3: 16
4: 115
1079133110_1079133113 -3 Left 1079133110 11:17761033-17761055 CCAAGACAGGCAGGGGTCCACGT 0: 1
1: 0
2: 1
3: 6
4: 152
Right 1079133113 11:17761053-17761075 CGTGGAAAACCCTGCAAGCATGG 0: 1
1: 0
2: 0
3: 6
4: 72
1079133110_1079133115 -1 Left 1079133110 11:17761033-17761055 CCAAGACAGGCAGGGGTCCACGT 0: 1
1: 0
2: 1
3: 6
4: 152
Right 1079133115 11:17761055-17761077 TGGAAAACCCTGCAAGCATGGGG 0: 1
1: 0
2: 1
3: 16
4: 160
1079133110_1079133116 4 Left 1079133110 11:17761033-17761055 CCAAGACAGGCAGGGGTCCACGT 0: 1
1: 0
2: 1
3: 6
4: 152
Right 1079133116 11:17761060-17761082 AACCCTGCAAGCATGGGGACAGG 0: 1
1: 0
2: 0
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079133110 Original CRISPR ACGTGGACCCCTGCCTGTCT TGG (reversed) Intronic
900017670 1:164356-164378 ACGTGAACCCATGCCTGGCCAGG - Intergenic
900035910 1:408438-408460 ACATGGAGCTCTGCCTGTCATGG - Intergenic
900047929 1:522952-522974 ACGTGAACCCATGCCTGGCCAGG - Intergenic
900070147 1:764816-764838 ACGTGAACCCATGCCTGGCCAGG - Intergenic
900586226 1:3433512-3433534 ACGCGCTCACCTGCCTGTCTGGG + Intronic
900586237 1:3433551-3433573 ACGCGCTCACCTGCCTGTCTGGG + Intronic
900586248 1:3433590-3433612 ACGCGCTCACCTGCCTGTCTGGG + Intronic
901871451 1:12141196-12141218 GCAGGGACCCCTGCCTTTCTGGG - Intronic
904505900 1:30953712-30953734 ACCTGGACCCATGCTGGTCTTGG + Exonic
904997855 1:34645108-34645130 ATGGGGACCCCTGCCTCCCTGGG + Intergenic
913955250 1:143284678-143284700 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
913982185 1:143530766-143530788 AATTGGATCCCTGCCTTTCTGGG - Intergenic
920652132 1:207845662-207845684 ACCTGGAGCAGTGCCTGTCTTGG - Intergenic
922105517 1:222510262-222510284 ACGTGAACCCATGCCTGGCCAGG - Intergenic
922265852 1:223982851-223982873 ACGTGAACCCATGCCTGGCCAGG - Intergenic
922801627 1:228367253-228367275 ACGGTGTCCCCTGCCTGGCTGGG + Intronic
923624565 1:235603491-235603513 ACGTAGAGCCCTGGGTGTCTGGG - Intronic
924347692 1:243087803-243087825 ACGTGAACCCATGCCTGGCCAGG - Intergenic
924941208 1:248813301-248813323 CCGTGTTCCCCTGCGTGTCTCGG - Intronic
1066779482 10:38928048-38928070 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1068330684 10:55563031-55563053 ACGTGCACAGCTCCCTGTCTTGG - Intronic
1068437296 10:57009281-57009303 ACATGGCACCCTGCCTTTCTGGG + Intergenic
1076560723 10:131361600-131361622 GTCTGGACCCCTGCCTTTCTTGG + Intergenic
1076675767 10:132146881-132146903 ACGTGGATCTCTGCCTGTGCCGG - Intronic
1076974267 11:159548-159570 ACGTGAACCCATGCCTGGCCAGG - Intergenic
1077322740 11:1949590-1949612 ACGCTGGCCTCTGCCTGTCTAGG - Intronic
1079130872 11:17746240-17746262 AGGTGGGCCCCTGCCTGGATTGG - Intronic
1079133110 11:17761033-17761055 ACGTGGACCCCTGCCTGTCTTGG - Intronic
1082789067 11:57335120-57335142 ATGTCGACCCCTGCCTGTGGTGG + Exonic
1087179796 11:95130459-95130481 ACGTGTATCCCTGCCTGACAAGG + Exonic
1089075072 11:115731839-115731861 ACGGGGACCCCTGCATGTCTAGG + Intergenic
1090574591 11:128086951-128086973 AGGTAGACACCAGCCTGTCTGGG - Intergenic
1202805758 11_KI270721v1_random:4903-4925 ACGCTGGCCTCTGCCTGTCTAGG - Intergenic
1092467042 12:8742369-8742391 ACATGGACCCCTCCCTCTCTAGG - Intronic
1099517874 12:83621303-83621325 ATTTGGACCACTGCCTGTTTTGG - Intergenic
1102540977 12:113619120-113619142 ACGTGGACCCCAGGCTGGCTTGG + Intergenic
1103624442 12:122207258-122207280 CCTTAGACCCCTGCCTGTATAGG + Exonic
1104138035 12:125959052-125959074 ACGTGGACACCTGAGAGTCTGGG + Intergenic
1105233549 13:18523464-18523486 AATTGGAGCCCTGCCTTTCTTGG - Intergenic
1105787468 13:23763700-23763722 AGGCAGACCCCTGGCTGTCTAGG - Intronic
1106421538 13:29589764-29589786 ACCTGGACTCCAGCCTGTCTCGG - Intronic
1108159258 13:47620808-47620830 ACTTGGATCCCTGCCTCTCAGGG - Intergenic
1108324247 13:49314296-49314318 AAAAGGACCTCTGCCTGTCTGGG + Intronic
1109496106 13:63174203-63174225 ATCTGGCCCACTGCCTGTCTTGG - Intergenic
1113730361 13:112637145-112637167 ACCTCGAGCCCTGCCTGTCGTGG - Intergenic
1120188237 14:81416596-81416618 AGGTGGCAACCTGCCTGTCTGGG + Intronic
1121558745 14:94858432-94858454 ACGTCAACTCCTGCCTGCCTAGG + Intergenic
1122135088 14:99628150-99628172 ACCTGGGCTCCTGCCTGCCTGGG - Intergenic
1123010931 14:105349178-105349200 GCGGGGACACCTCCCTGTCTGGG - Intronic
1202937781 14_KI270725v1_random:108205-108227 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
1123395430 15:19929682-19929704 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1128495617 15:68196831-68196853 ACCAGGAACCCTGCCTGTCTCGG + Intronic
1132213936 15:100048856-100048878 ACTTGCACCCCTGCCAGTCACGG - Exonic
1136766140 16:32779346-32779368 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
1136801958 16:33091032-33091054 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1136900768 16:34034965-34034987 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1136939985 16:34514780-34514802 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
1136945776 16:34649008-34649030 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1136959835 16:34833786-34833808 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1136968012 16:34938158-34938180 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1137088508 16:36158873-36158895 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1137093022 16:36218111-36218133 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1137220172 16:46441458-46441480 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
1137561566 16:49505748-49505770 CCATGGAGCCCTGCCTTTCTGGG - Intronic
1141897110 16:86965125-86965147 CTGTGGAGCCCTGCCTGTCCTGG - Intergenic
1142445993 16:90138101-90138123 ACGTGAACCCATGCCTGGCCAGG + Intergenic
1203068527 16_KI270728v1_random:1041592-1041614 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
1142461515 17:97362-97384 ACGTGAACCCATGCCTGGCCAGG - Intergenic
1143334881 17:6164829-6164851 ACGTGGAATCCATCCTGTCTTGG - Intergenic
1145692055 17:26752104-26752126 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1145708788 17:26948717-26948739 AACTGGAGCCCTGCCTTTCTGGG - Intergenic
1148782049 17:50128027-50128049 ACGTGGACCCTTTCTTCTCTGGG - Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1152111902 17:78361191-78361213 ATGTGACCCCCTGCCTCTCTTGG + Intergenic
1154519477 18:15211989-15212011 AATTGGAGCCCTGCCTTTCTCGG + Intergenic
1156362036 18:36391823-36391845 ATGTGGCCCCCTGACTGTGTTGG + Intronic
1157811994 18:50703929-50703951 ACTTGACCACCTGCCTGTCTGGG - Intronic
1160651217 19:229729-229751 ACGTGAACCCATGCCTGGCCAGG - Intergenic
1160859784 19:1232933-1232955 CCGAGGCCCTCTGCCTGTCTGGG - Intronic
1165066827 19:33234410-33234432 AAATGGAACCCTCCCTGTCTCGG + Intergenic
1165159420 19:33807080-33807102 AAGTGGACCCCTGGTTGTCATGG + Intronic
1202671696 1_KI270709v1_random:60187-60209 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1202682040 1_KI270712v1_random:14959-14981 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
925069685 2:956452-956474 ACGTGGAGCGCTGCCTGCCCTGG + Intronic
925308307 2:2865399-2865421 GTGGGGTCCCCTGCCTGTCTGGG + Intergenic
925308404 2:2865687-2865709 GTGGGGTCCCCTGCCTGTCTGGG + Intergenic
925541677 2:4974254-4974276 ACAGTGACCCCTCCCTGTCTGGG + Intergenic
926249593 2:11146771-11146793 ACCAGGACCCCTGGCTGTCCTGG - Intronic
927177713 2:20422118-20422140 TCGTGGACCCCTGCCAGTGCTGG - Intergenic
932494594 2:72140150-72140172 CCTTGGACCCCTCCCTGCCTTGG + Intronic
932506067 2:72233389-72233411 AGCTGGGCCCCAGCCTGTCTGGG + Intronic
934249732 2:90340134-90340156 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
934259842 2:91463312-91463334 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
934303146 2:91795241-91795263 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
934330113 2:92057515-92057537 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
934468338 2:94287424-94287446 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
936020057 2:108988098-108988120 GCGTGTACCCCTGGCTGTGTGGG + Intronic
937276012 2:120684885-120684907 ACTTGGACCCCAGCGTGGCTTGG - Intergenic
938519456 2:132052617-132052639 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
946038485 2:216763845-216763867 CCGTGTACCCCAGCCTGTCTGGG - Intergenic
1172525936 20:35600718-35600740 ACGTGGACCCCTGCTGGGCCTGG + Intergenic
1176585548 21:8580927-8580949 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1176777533 21:13151747-13151769 AATTGGAGCCCTGCCTTTCTTGG - Intergenic
1180268356 22:10557826-10557848 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1181283470 22:21735974-21735996 ACGTGGGCTCCTGCCCGTCCCGG - Intergenic
1203237409 22_KI270732v1_random:18275-18297 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1203290388 22_KI270735v1_random:31798-31820 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
1203323238 22_KI270737v1_random:89819-89841 AATTGGAGCCCTGCCTTTCTAGG + Intergenic
950275403 3:11656363-11656385 CCGTGGATCCCTCCCTGTGTTGG - Intronic
956030244 3:65029359-65029381 ATGTGGATCCCTGCCCATCTTGG + Intergenic
956462939 3:69490036-69490058 ACGTGGACGAATGGCTGTCTAGG + Intronic
963010813 3:140768643-140768665 AAGTTGAGCCCTGGCTGTCTGGG + Intergenic
966883306 3:184361725-184361747 GCGCGGACCCCAGCCTGGCTGGG - Intronic
967443050 3:189531215-189531237 CCATGGACCCCTGCCTTGCTTGG - Intergenic
968366615 3:198190251-198190273 ACGTGAACCCATGCCTGGCCAGG + Intergenic
969674770 4:8608494-8608516 ACCTGGGCCCCTCCCTGTCCTGG + Intronic
978994339 4:115131324-115131346 AAGTGGACTCCTGCCTGCCCAGG + Intergenic
980013576 4:127623194-127623216 GCGTGCTCCCCTGCCGGTCTCGG - Intergenic
982317183 4:154043762-154043784 ACGATGACCCCTGACTGTTTGGG + Intergenic
985624690 5:979047-979069 TCGTGGACACCTGGCTGTCGGGG - Intergenic
996190231 5:120531408-120531430 ACAATGACCCCTGGCTGTCTGGG - Intronic
1002725838 5:181295458-181295480 ACGTGAACCCATGCCTGGCCAGG + Intergenic
1002737911 5:181410426-181410448 ACATGGAGCTCTGCCTGTCATGG + Intergenic
1006375095 6:33667664-33667686 TCCTGGACCTCTGCCTTTCTAGG + Intronic
1008012867 6:46487698-46487720 AAGGGGAACCCTGCCTGCCTGGG - Intronic
1016272196 6:142301988-142302010 ACGCGCACCCCTGCCTGGCCCGG + Exonic
1016419564 6:143870288-143870310 AAGTGGACAGCTGCCTTTCTAGG - Intronic
1019951783 7:4378970-4378992 ACATGTACCCCTTCCAGTCTGGG - Intergenic
1024026368 7:45413240-45413262 ATGTGGACACCAGCCTGTCCTGG - Intergenic
1024805578 7:53135705-53135727 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
1025321319 7:58096725-58096747 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1025474338 7:60900704-60900726 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1025512665 7:61589170-61589192 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
1025551475 7:62255490-62255512 AGTTGGAGCCCTGCCTTTCTGGG + Intergenic
1025837608 7:65109389-65109411 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1025885465 7:65586609-65586631 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
1028751307 7:94386060-94386082 ACGTCTCCCCTTGCCTGTCTAGG - Intergenic
1035313885 7:157986402-157986424 ACGGGGTGCCCTGCCTCTCTGGG - Intronic
1037910623 8:22741713-22741735 AGGAGGAACCCTGACTGTCTTGG + Intronic
1038199254 8:25396373-25396395 TCTAGGACCCCTGCCTGACTTGG + Intronic
1046379531 8:113434209-113434231 ACGTGGAAAACTGCCTGCCTCGG + Intronic
1049588026 8:143440879-143440901 GGGTGGCCCCCTCCCTGTCTGGG - Intronic
1049593263 8:143472112-143472134 CCCTGGACCCCTGCCTGCCCTGG + Intronic
1049655826 8:143796792-143796814 GCCAGGACCCCTGCCTCTCTTGG - Intronic
1051154928 9:14131895-14131917 ACCTTAACACCTGCCTGTCTGGG + Intronic
1053698741 9:40665449-40665471 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
1053944746 9:43295681-43295703 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
1054310030 9:63464850-63464872 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
1054408818 9:64789002-64789024 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
1054441976 9:65272816-65272838 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
1054488307 9:65748681-65748703 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1056848512 9:90060526-90060548 ACGTGGATCCATGCCTGGATGGG - Intergenic
1061867239 9:133499166-133499188 AGCTGGACCCCTGCCACTCTGGG + Intergenic
1062167328 9:135114522-135114544 GAGTGGACACCTGCCTGCCTGGG + Intronic
1062750974 9:138253102-138253124 ACGTGAACCCATGCCTGGCCAGG + Intergenic
1202781107 9_KI270717v1_random:38656-38678 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
1203581434 Un_KI270746v1:9431-9453 ACTTGGAGCCCTGCCTTTCTGGG - Intergenic
1203587881 Un_KI270747v1:24259-24281 AATTGGAGCCCTGCCTTTCTGGG + Intergenic
1203615449 Un_KI270749v1:58445-58467 AATTGGAGCCCTGCCTTTCTGGG - Intergenic
1186066539 X:5772202-5772224 ACTTGGTCTCCTGCCTCTCTGGG + Intergenic