ID: 1079134595

View in Genome Browser
Species Human (GRCh38)
Location 11:17769281-17769303
Sequence CCTTGTGAGGAATGGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079134585_1079134595 30 Left 1079134585 11:17769228-17769250 CCCTGAGGCTGGAATGAGGCCTT 0: 1
1: 1
2: 1
3: 20
4: 229
Right 1079134595 11:17769281-17769303 CCTTGTGAGGAATGGATGGATGG 0: 1
1: 0
2: 1
3: 38
4: 295
1079134590_1079134595 -6 Left 1079134590 11:17769264-17769286 CCAGGCAGAACTTGGTGCCTTGT 0: 1
1: 0
2: 1
3: 15
4: 154
Right 1079134595 11:17769281-17769303 CCTTGTGAGGAATGGATGGATGG 0: 1
1: 0
2: 1
3: 38
4: 295
1079134586_1079134595 29 Left 1079134586 11:17769229-17769251 CCTGAGGCTGGAATGAGGCCTTA 0: 1
1: 0
2: 0
3: 12
4: 186
Right 1079134595 11:17769281-17769303 CCTTGTGAGGAATGGATGGATGG 0: 1
1: 0
2: 1
3: 38
4: 295
1079134588_1079134595 11 Left 1079134588 11:17769247-17769269 CCTTATTCAACTCTGTGCCAGGC 0: 1
1: 1
2: 0
3: 11
4: 157
Right 1079134595 11:17769281-17769303 CCTTGTGAGGAATGGATGGATGG 0: 1
1: 0
2: 1
3: 38
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079134595 Original CRISPR CCTTGTGAGGAATGGATGGA TGG Intronic
903267331 1:22165672-22165694 TATTATGAAGAATGGATGGAGGG + Intergenic
904563869 1:31415570-31415592 CTTTGTGAGGATTAAATGGAAGG - Intronic
906256024 1:44351000-44351022 CATTGTGAAAAATGGATTGAAGG - Intronic
906651222 1:47514317-47514339 CCTTGTTGGGGATGGCTGGAAGG - Intergenic
906800793 1:48735364-48735386 CCTGGCAAAGAATGGATGGATGG + Intronic
908010916 1:59776790-59776812 CCAGGTGAGCAATGGATGTAAGG + Intergenic
910482531 1:87674226-87674248 CCTTGGGAGGAGTAGATGAAAGG + Intergenic
911203280 1:95068081-95068103 TCTAGTGAGGCATGGATAGAGGG - Intronic
912719640 1:112008928-112008950 TCTTGTGAGGCATAGAAGGAAGG - Intergenic
913240717 1:116827000-116827022 CATGGTGGGGAATGGAGGGAAGG - Intergenic
913491554 1:119384622-119384644 CCTTGTAAGAAAGGGATGGAAGG - Intronic
916515197 1:165510201-165510223 ACTTGTGGGGAAGGGTTGGAGGG - Intergenic
918525384 1:185458815-185458837 TCTTCTGAGGAATGGAGGGAAGG - Intergenic
919008215 1:191927357-191927379 CCTTGAGAGGACTGCATAGAAGG + Intergenic
919965253 1:202516764-202516786 CCTTGTTAAGAATAGATGGCAGG + Intronic
920035118 1:203060521-203060543 CTTTGTGAGGATGGGAAGGAAGG - Intronic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920865798 1:209752515-209752537 CCTTGTCAGGAGTGTAGGGAAGG + Intergenic
921106008 1:211979267-211979289 CATTGTGAAGGATGGATTGAAGG - Intronic
922483487 1:225955767-225955789 CCTTGTGGGGAATGGAGGAAAGG + Intergenic
922818067 1:228465080-228465102 TCTTTGGAGGAATGGAGGGAAGG - Intergenic
922846415 1:228688510-228688532 ACATGGGAGGAATGGAAGGAGGG - Intergenic
923618444 1:235557295-235557317 CCTCGTGTGCACTGGATGGATGG - Intronic
924665229 1:246064201-246064223 GCCTGTGGAGAATGGATGGAAGG - Intronic
1062925493 10:1313069-1313091 CTTGTTGAGGAATGGATGAACGG - Intronic
1062928337 10:1335193-1335215 CTGTGAGATGAATGGATGGATGG + Intronic
1063236235 10:4119296-4119318 CCTTAGGAGGAAGCGATGGATGG - Intergenic
1064691797 10:17926327-17926349 CATTGTGGGGAATGACTGGAGGG - Intergenic
1066305893 10:34140605-34140627 ACTTATGAGGAATGGAGGAAGGG + Intronic
1067288773 10:44926690-44926712 TTTTCTGAGCAATGGATGGAGGG - Intronic
1068145767 10:53068335-53068357 CCTTGTAAAGAAAGGATGAAGGG - Intergenic
1069020629 10:63484183-63484205 CCTTGGGATGGATGGATGGATGG + Intergenic
1070266232 10:74905864-74905886 CATTGCAAGGCATGGATGGAAGG - Intronic
1070634491 10:78113547-78113569 GCGAGTGAGGAAGGGATGGAGGG - Intergenic
1071706598 10:88006229-88006251 CTTTGTGAGGAATGGGAGGTTGG + Intergenic
1072203047 10:93178128-93178150 CATTGTGCAGAGTGGATGGAAGG + Intergenic
1072905990 10:99454350-99454372 CCTTGTAATTAATGGAAGGAGGG + Intergenic
1073139483 10:101237964-101237986 CATGGTGAGGATTGGAGGGAAGG - Intergenic
1074009700 10:109465385-109465407 CAGTGTGAGGAATGGATTGGAGG + Intergenic
1074177020 10:111017979-111018001 CCTTGAGAAGAATAGATTGAAGG + Intergenic
1074421696 10:113314873-113314895 CCCAGCAAGGAATGGATGGATGG - Intergenic
1075913038 10:126142368-126142390 CCTTATGGGAAATGAATGGATGG + Intronic
1076203946 10:128580156-128580178 GCTGGTGAGGAATTGAAGGATGG - Intergenic
1076589096 10:131570901-131570923 CCCAGTCAGGAATTGATGGAGGG + Intergenic
1078729228 11:13960924-13960946 CTTTGTCATGAATGAATGGATGG + Intergenic
1079134595 11:17769281-17769303 CCTTGTGAGGAATGGATGGATGG + Intronic
1082215935 11:49569437-49569459 CCCAAGGAGGAATGGATGGAGGG + Intergenic
1082717091 11:56627374-56627396 CCATGTGAAGAATGTATGGAAGG - Intergenic
1083278306 11:61610063-61610085 CCTTTTGAGGAAGCCATGGACGG + Intergenic
1084699577 11:70777535-70777557 ACTTCTGATGGATGGATGGATGG - Intronic
1085411479 11:76293352-76293374 CCTTGACAGGAAAGGAAGGAGGG - Intergenic
1085770611 11:79322245-79322267 CCCTATGAGGAATGGATTCAGGG + Intronic
1086633645 11:89055037-89055059 CCCAAGGAGGAATGGATGGAAGG - Intronic
1087270867 11:96110166-96110188 TGTTTTGAGGAGTGGATGGAAGG + Intronic
1088231391 11:107676943-107676965 CCTCTTGAAGAATGGTTGGAAGG + Intergenic
1088940751 11:114453454-114453476 CCTCCTGAGGAGTGGTTGGAAGG - Intergenic
1089120698 11:116132630-116132652 CAAAGTGAGGAGTGGATGGAAGG - Intergenic
1089830851 11:121326593-121326615 CTCAGAGAGGAATGGATGGAAGG - Intergenic
1090476885 11:127030962-127030984 TCTTGTGACCAATGGATGGAAGG - Intergenic
1092574962 12:9772019-9772041 CCATGTGAGGAAAAGAAGGAAGG - Intergenic
1096530405 12:52239039-52239061 GCCTGTGAGGAACGGAGGGAGGG - Intronic
1097227030 12:57483428-57483450 CTGTGTCAGGAATGGTTGGAAGG - Intronic
1097467426 12:59944868-59944890 CCTTATAGGTAATGGATGGAGGG + Intergenic
1098769108 12:74530339-74530361 CTTTTTGTGGAATGGATGGTTGG + Intergenic
1100967010 12:100023774-100023796 ACTTGGGGGGAATGGATGGGAGG + Intergenic
1101012012 12:100460584-100460606 CCTTGTCAGCAATGGATGTGGGG + Intergenic
1101259471 12:103013632-103013654 GCCAGTGAAGAATGGATGGATGG + Intergenic
1102188962 12:110971444-110971466 CCTTGCTAGGGATGGCTGGAAGG + Intergenic
1102650499 12:114439030-114439052 AGTTGTGAGGGAGGGATGGAGGG + Intergenic
1102763336 12:115408697-115408719 CCTTGACAGGGATGGCTGGAAGG + Intergenic
1103860997 12:124013802-124013824 CCTTATGAGAAGTGGATGGTAGG + Exonic
1103896438 12:124276378-124276400 GCTAGGGAGGGATGGATGGATGG + Intronic
1104326928 12:127808012-127808034 CCTTGCGAGGAGCAGATGGAAGG - Intergenic
1104381180 12:128309142-128309164 CCTGGTGAGGCAGGGGTGGATGG + Intronic
1104460508 12:128952138-128952160 CCTTGTGAGGGACGGAAAGAAGG + Intronic
1104728887 12:131094363-131094385 CCTTATGAAGAGTGAATGGAAGG - Intronic
1105498601 13:20952232-20952254 ACTTCTGAGGGATGGATGGATGG + Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105959468 13:25317197-25317219 CCTTTTGAGGAAATGATAGAAGG + Intronic
1106171611 13:27293433-27293455 CCTTCCGATGAAAGGATGGAGGG - Intergenic
1106405612 13:29470464-29470486 CATGGGGAGGAATGGATTGATGG - Intronic
1107112663 13:36714787-36714809 CCTTGAGAGGAGGAGATGGAAGG + Intergenic
1107386277 13:39913361-39913383 CCTTCTGAGGAATGGAAGGGAGG + Intergenic
1107687552 13:42918921-42918943 CCTAGTGAGGAAGGGAAGAAGGG + Intronic
1107833196 13:44392535-44392557 GCTTCTGAGGAATGGAAAGAAGG + Intronic
1109569444 13:64167068-64167090 GCATCTGAGGAATGGATGGATGG + Intergenic
1110594003 13:77297940-77297962 CTATGTGAAGAATGGATTGAAGG - Intronic
1111953123 13:94726527-94726549 CCTTGGCAGGAATGGCTAGAAGG - Intergenic
1112217341 13:97446742-97446764 CGTTGGTAGGAATGGCTGGAAGG - Intronic
1112379230 13:98872909-98872931 CCATGTGAGGCATGGAGGCACGG - Intronic
1113663071 13:112120215-112120237 ACGTGGGAGGAATGGAGGGAGGG + Intergenic
1113990455 14:16023992-16024014 CCTTGGAAGGGATGGAGGGAGGG - Intergenic
1114773570 14:25455993-25456015 CCTGGGGAGGAAAGGAAGGAAGG - Intergenic
1115787878 14:36846715-36846737 ACTTTTGTTGAATGGATGGATGG - Intronic
1119956900 14:78808556-78808578 CCTGGTGAGGACTGGAAGGAGGG - Intronic
1121411971 14:93754481-93754503 CCTAGGGAGGGATGGATAGAGGG - Intronic
1121546185 14:94765423-94765445 CCGTGTTAGGAAGGGCTGGATGG - Intergenic
1121565879 14:94908752-94908774 CCTTGTGAGGAAGGGACCCAGGG - Intergenic
1121745311 14:96284899-96284921 GCTTGTTAGGAATGTGTGGAAGG - Exonic
1121826921 14:97017735-97017757 CCTTGGCAGGGATGGCTGGAAGG - Intergenic
1121871364 14:97410937-97410959 CCTTTGCAGGAATGGGTGGATGG + Intergenic
1121889345 14:97574447-97574469 CCTTGTGAGGAAGGTGGGGAAGG + Intergenic
1125123593 15:36194167-36194189 CCTTTTGAGGTATGGATTCAGGG + Intergenic
1125686144 15:41564505-41564527 CCTTGGGAGGGAGGGAAGGAGGG + Intronic
1127265673 15:57359534-57359556 CCAGATGAGGAATGGGTGGATGG + Intergenic
1127774124 15:62252393-62252415 GCTTGGGAGGAAGGGATGGTGGG - Intergenic
1128049843 15:64654542-64654564 CTTTGGGAGGAAGAGATGGAAGG - Intronic
1129755335 15:78094637-78094659 CCTTTGGAGGAATGCCTGGAAGG + Intronic
1130892076 15:88141850-88141872 CCCTGGGGGGAAAGGATGGAAGG - Intronic
1131388871 15:92031010-92031032 CCCTGTGAGGGAGGGAGGGAGGG + Intronic
1132909598 16:2302066-2302088 CCTTAAGGGAAATGGATGGATGG - Intronic
1133745983 16:8687085-8687107 CCTTGAGAGGAAGAGATGGTGGG + Intronic
1133844344 16:9440117-9440139 GCTTGTGAGGAATGGATCTGGGG - Intergenic
1137466486 16:48714504-48714526 CCTTGAGAAGAAAGGATGGAGGG - Intergenic
1137493143 16:48949829-48949851 CCTGGGGAGGAATGGAGGGCAGG - Intergenic
1137826959 16:51506397-51506419 CAGTGTGAAGAAAGGATGGAAGG - Intergenic
1137902338 16:52282290-52282312 CTGTGTGATGGATGGATGGATGG - Intergenic
1138848893 16:60603019-60603041 CTTTGGGAGGACTGGGTGGAAGG + Intergenic
1141800842 16:86308145-86308167 GCTTGTGAGCAGTGGATGGAGGG + Intergenic
1141862615 16:86728281-86728303 CCCTGTGCTGATTGGATGGAAGG + Intergenic
1144345564 17:14346177-14346199 CCATGTGCTGAATGGAGGGAGGG - Exonic
1144547781 17:16214409-16214431 CCTGGTGAGGCAGTGATGGAAGG - Intronic
1145281284 17:21468711-21468733 CCTTATGAGAAATGAAGGGATGG - Intergenic
1146381718 17:32334682-32334704 GCTGGTGGGGAAGGGATGGAAGG + Intronic
1146907005 17:36624295-36624317 ACTTCTGAGGAAGGGGTGGATGG - Intergenic
1147844444 17:43394941-43394963 ACTAGTGAGGAATGGAAGGATGG + Intergenic
1148155649 17:45424103-45424125 CCCTGTGAGGCATGAAAGGAGGG - Intronic
1148199656 17:45741383-45741405 CCCAGGGAGGAAGGGATGGATGG + Intergenic
1148674880 17:49439356-49439378 CCTTGTAGGGACTGAATGGAGGG - Intronic
1148751490 17:49948036-49948058 CCTAGAGAGGAATGGACGAAGGG - Intergenic
1150708981 17:67513912-67513934 CCTTTTGAGAAATGGATGGTCGG + Intronic
1151388833 17:73772018-73772040 CCTTTTGAGTGATGGGTGGAGGG + Intergenic
1153173003 18:2337725-2337747 CCATGTGGTGGATGGATGGATGG - Intergenic
1154254662 18:12772001-12772023 CCTTGTGCTGGATGGATGGATGG + Intergenic
1155894066 18:31301336-31301358 CCTGGTGAGGAAATGCTGGAGGG + Intergenic
1156249946 18:35343745-35343767 GCTTGTGGGAAATGGAGGGAAGG + Intronic
1157499536 18:48179981-48180003 CCTTGTAAGGAAGGAAGGGAGGG - Intronic
1157954409 18:52081198-52081220 CCTTGGGAGGGAAGGATTGATGG - Intergenic
1159006930 18:63021629-63021651 GGTTGTGATAAATGGATGGATGG - Intergenic
1159219093 18:65436710-65436732 CTTTGTGAGGTATGGATGGGAGG - Intergenic
1159573932 18:70152829-70152851 CATTGTGGGGAATGGATTGTAGG - Intronic
1160767901 19:816554-816576 CTGGGTGATGAATGGATGGATGG - Intronic
1163182273 19:15613069-15613091 CCTAGTGAGTATTGGAGGGAGGG - Intergenic
1164031627 19:21412227-21412249 CCTTATGGGAAATGGAGGGATGG + Intronic
1164322123 19:24158494-24158516 CCTTATGAGAAATGAAGGGATGG + Intergenic
1165621744 19:37253869-37253891 CCATCTGAGTAATGGATTGAGGG - Intergenic
1166537274 19:43582181-43582203 CCTTTTGAGGAAGAGAGGGAAGG + Intronic
1167642557 19:50689526-50689548 CCTGGTGCTGAATGGATGGGTGG - Intronic
925167107 2:1722904-1722926 AGTAGTGAGGGATGGATGGATGG + Intronic
925234451 2:2265863-2265885 CCTAAGGAGGCATGGATGGAGGG + Intronic
925827666 2:7865378-7865400 CAGAGTGATGAATGGATGGATGG + Intergenic
927309175 2:21609266-21609288 CTTTGTGTGGATTGGATGGCTGG - Intergenic
928564558 2:32531402-32531424 CCAGGTGATGAATGCATGGATGG + Exonic
929286270 2:40138813-40138835 GCTTGTAAGGAATGCATGAAGGG + Intronic
929539977 2:42811589-42811611 CGTTCAGAGAAATGGATGGAGGG + Intergenic
929896568 2:45966072-45966094 CCTTGGGAGGCGTGGATGGCTGG + Intronic
930422761 2:51175134-51175156 ACTGGTGGGGAAGGGATGGATGG - Intergenic
931206289 2:60149064-60149086 CCTGGTGAGGGATGGAGGGTGGG - Intergenic
932326320 2:70864347-70864369 CTGTGTGAGGAGTGGATGGAAGG - Intergenic
933041377 2:77471427-77471449 CTTTGTGAAGAATAGATGGAAGG - Intronic
935640116 2:105282214-105282236 GCATCTGAGCAATGGATGGAAGG - Intronic
935856645 2:107281958-107281980 CAGTGTGAGGAATGCAGGGATGG - Intergenic
937316827 2:120937035-120937057 CCTTGGAAGGAGGGGATGGAGGG - Intronic
937885685 2:126898657-126898679 CCTTGTGAGGATCAGAAGGATGG - Intergenic
938241298 2:129744378-129744400 TCAGGTGAGGAATGGATGGGAGG - Intergenic
938872410 2:135494053-135494075 CCATCTGAAGGATGGATGGATGG + Intronic
939186413 2:138866325-138866347 CCTTGAAAGGAATGGCTAGAGGG - Intergenic
939999736 2:148955094-148955116 GCTTGTGAGGGAAGGAGGGAGGG - Intronic
943342476 2:186696985-186697007 CCATTTGTTGAATGGATGGACGG + Intronic
945040664 2:205741365-205741387 CCTGGTGAAGAAGGGAGGGAAGG + Intronic
945794772 2:214348648-214348670 CCTTGTTGGGGATGGCTGGAAGG - Intronic
947659929 2:231859034-231859056 CCTTGTGAGAGCTGGAGGGAAGG + Intergenic
947922924 2:233893883-233893905 TCTGGTAGGGAATGGATGGATGG + Intergenic
1168810394 20:701053-701075 CCATGTGAAGAAGGAATGGAAGG + Intergenic
1168919750 20:1521465-1521487 TTTTGTGAGGAATGAATGGGAGG + Intergenic
1170735585 20:19011438-19011460 CCTTGGCAGGGATGGCTGGAAGG + Intergenic
1171171296 20:23017701-23017723 CCTTCTGAGCGAAGGATGGAGGG - Intergenic
1171905078 20:30893804-30893826 CCTTGGAAGGGATGGAGGGAGGG - Intergenic
1172108156 20:32528758-32528780 CCTTGTGAGGACTGCCTGCACGG - Intronic
1172122334 20:32605862-32605884 CCCTGTGGGGAGTGGATTGAAGG - Intronic
1172964495 20:38824783-38824805 CTTTGTGAGGCAAAGATGGATGG + Intronic
1173044013 20:39492198-39492220 CCTGGTGAGAAATGGAGTGAAGG + Intergenic
1173338184 20:42130285-42130307 CCTTGGGCTGAAGGGATGGAGGG + Intronic
1173385536 20:42584024-42584046 CCTTGGCAGGGATGGCTGGAGGG - Intronic
1173942724 20:46925506-46925528 CCATTAGAGAAATGGATGGAAGG + Intronic
1174120786 20:48263760-48263782 CCATGTGGGGAATGGATGGTAGG - Intergenic
1174266084 20:49333194-49333216 CCTTGTGAAGGATGGATTGTGGG + Intergenic
1174289490 20:49497635-49497657 CCTTGGTAGGTATGGCTGGAAGG - Intergenic
1174452285 20:50627902-50627924 CCTTGTGTGGTCTGGAAGGAGGG - Intronic
1175494700 20:59405439-59405461 CCGTTTGAGGAATGGCAGGAAGG + Intergenic
1177004749 21:15657612-15657634 GCTTGGGGGGAATGGATGGAAGG - Intergenic
1177071980 21:16521625-16521647 ACTTGACAGGGATGGATGGAGGG - Intergenic
1178638055 21:34322533-34322555 CCTTCTGAGGCTTGGAAGGAGGG - Intergenic
1180316816 22:11283534-11283556 CCTTGGAAGGGATGGAGGGAGGG + Intergenic
1180338505 22:11599984-11600006 CCTTGGAAGGGATGGAGGGAGGG - Intergenic
1181750630 22:24986723-24986745 GCTTGTGATGGATGGATGGATGG - Intronic
1182441254 22:30365655-30365677 CTTTGGGAGGAAAGGATGGTAGG + Intronic
1182760885 22:32721438-32721460 CCTTGGGATGGATGGATGGATGG - Intronic
1182969621 22:34561207-34561229 CCCTGTGAAGAATGCATGGAAGG + Intergenic
1183106556 22:35619068-35619090 CTGTGAGAGGGATGGATGGATGG - Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
949465020 3:4335192-4335214 CATTGTGAGGAATGGGTGGGAGG - Intronic
950120967 3:10482447-10482469 CCAGGTGAGGCATGGAGGGATGG - Intronic
950236756 3:11328716-11328738 CATTGTGAGTAATGGCTGAATGG - Intronic
951804905 3:26633215-26633237 CCTTTGGATGAATGGGTGGATGG - Intronic
952002437 3:28801997-28802019 CTTTGAGAGAAATGGATGGAGGG + Intergenic
953040453 3:39251192-39251214 CCCTGTGTGGAAGAGATGGAAGG - Intergenic
953910953 3:46892807-46892829 CCTTCTGGGGTAGGGATGGAGGG + Intronic
954961254 3:54566949-54566971 CCTGGTGAGGAAGGCATGGAAGG - Intronic
954970954 3:54651503-54651525 CCTGGTGAGGACTGCAAGGAGGG + Intronic
956640820 3:71414011-71414033 CCTAGGAAGGGATGGATGGATGG - Intronic
957493030 3:80954105-80954127 CCTTGTGATGAATACATGAAGGG - Intergenic
958698133 3:97553317-97553339 CCTTGTGAGGACATGAGGGAAGG - Intronic
960247625 3:115416964-115416986 CCTTATGAAGAATGGGTTGATGG + Intergenic
961390337 3:126548814-126548836 CCTTGTGATGAAAAGATTGAAGG - Intronic
961663799 3:128484219-128484241 CCTGGTGAGGATTGGAAGCAGGG - Intronic
962010398 3:131385536-131385558 CCTTTTGAGGAAGGGAGGGTGGG + Intronic
964783901 3:160372513-160372535 CCTTATGAGGAAAGTATAGATGG + Intronic
967321479 3:188199196-188199218 CCTTGAGAGGAAGGGAGAGAGGG + Intronic
969606674 4:8205429-8205451 GGTGGTGAGGGATGGATGGACGG - Intronic
971711473 4:30118768-30118790 CCTTGTCCTGGATGGATGGATGG + Intergenic
972685192 4:41345802-41345824 TCTTGTGAGGTTTGGATTGAAGG + Intergenic
973181898 4:47279073-47279095 CTTTCTTAGGAATGGATGGATGG + Intronic
974108773 4:57501764-57501786 CCTTGTGAGGAATAAATGAGAGG + Intergenic
975446597 4:74472853-74472875 TCTTCTGAGCAATTGATGGATGG + Intergenic
975715732 4:77204007-77204029 CCTTGTGTGGAAGGAATGGAGGG - Intronic
977920977 4:102642200-102642222 CCTTTTTAGGAAAGGATGCATGG - Intronic
978708192 4:111742154-111742176 CATTGAGAGGAATGGATAGGGGG + Intergenic
980002602 4:127508113-127508135 CCGTTTGAGGAATGAATGTATGG - Intergenic
980710346 4:136558005-136558027 CATTGTGAGGAAGGGAGGGAGGG + Intergenic
980998307 4:139802680-139802702 GCCTGTGAGAGATGGATGGATGG + Intronic
981316364 4:143343534-143343556 CCATGTGTGGAATGCAAGGAAGG + Intronic
983554935 4:169051497-169051519 TCTTGTGGGGAATCCATGGAGGG - Intergenic
984324311 4:178231976-178231998 ACTTGTGGGGAAAGGATGGGAGG + Intergenic
984547715 4:181127306-181127328 CTGTGTGGAGAATGGATGGAAGG + Intergenic
984865374 4:184276103-184276125 CTTTGTGATGAATGTGTGGATGG + Intergenic
985298979 4:188467179-188467201 ACTTGGGATGGATGGATGGATGG + Intergenic
986077303 5:4351189-4351211 CCTCGTGAGGAAGGGAATGATGG - Intergenic
987501163 5:18710827-18710849 CCTGGTGAGGCCTGGAGGGAAGG + Intergenic
989263517 5:39446260-39446282 CCAGGTGAGGAAAGGAGGGAGGG - Intronic
991090248 5:62687342-62687364 CCTTGTAATAAATTGATGGATGG - Intergenic
991507237 5:67337997-67338019 CCTTGAGAGGACTGAGTGGAGGG + Intergenic
991531436 5:67619599-67619621 CCATGTGAGAAATGGAAGAAAGG + Intergenic
992161690 5:74010487-74010509 CCTTTGGATGGATGGATGGATGG - Intergenic
995237084 5:109841294-109841316 ACTTGGGAGGAAGGGTTGGAGGG - Intronic
996154231 5:120078136-120078158 CCTTCTGAGGAATAGAGGGAAGG - Intergenic
996950530 5:129120291-129120313 CCTTGGCAGGGATGGCTGGAAGG + Intergenic
997249892 5:132380465-132380487 CCTTGTGAAGAAAGAATTGAAGG + Intronic
997990867 5:138543396-138543418 CCTTGTGAGGTAAGGCTGGGGGG + Intergenic
998211917 5:140206081-140206103 CCTGGTGAGGAAGGGAGGGAAGG - Intronic
999088429 5:148913528-148913550 CCTTGTGAGGAAAGCAAGGCTGG + Intergenic
999845796 5:155478664-155478686 GCTTGTGAGGAAAGGATGGTAGG - Intergenic
1001001424 5:168010952-168010974 CTTTGTGTGAAAAGGATGGATGG + Intronic
1001256547 5:170187721-170187743 ACTTGTGAGGTTTGGAGGGAAGG + Intergenic
1001951912 5:175822255-175822277 ACTTGAGAGAAAAGGATGGAAGG - Intronic
1002925427 6:1603300-1603322 CCTTGTGAGGATTAGGTGAAAGG + Intergenic
1004370568 6:15048800-15048822 CAGTGTGAGGAAAGGATGTATGG + Intergenic
1004511490 6:16287523-16287545 CCTTGTCAGGGAAGGATGCAAGG + Intronic
1005847143 6:29790948-29790970 GCATGAGAGGAATGGAGGGAAGG + Intergenic
1006163634 6:32052149-32052171 TCTTGTTAGAAATGGATGGTCGG + Intronic
1007759343 6:44123980-44124002 ACTTGTGAGGTAGGGATGGGAGG - Intronic
1007817229 6:44533172-44533194 CCCAGTGAGGAATAAATGGAAGG - Intergenic
1015267942 6:131307839-131307861 CCTAGTGAGGACTGAAGGGATGG - Intergenic
1016567334 6:145471375-145471397 CCTTGTGAGGGATGCAGGGATGG - Intergenic
1016872166 6:148829136-148829158 CCCTGGGATGGATGGATGGATGG + Intronic
1017260380 6:152378791-152378813 CCTTGTGATGAATGTCTGCAAGG - Intronic
1019103598 6:169650861-169650883 CTTTTGGAGGGATGGATGGATGG - Intronic
1020460395 7:8423822-8423844 ATTTGTGTTGAATGGATGGATGG + Intergenic
1021283311 7:18747098-18747120 CTTTTTGAGGAAAGGAAGGAAGG + Intronic
1021736778 7:23647322-23647344 CTTTCTGAGGAATCTATGGAGGG + Intergenic
1021993639 7:26159291-26159313 ACTTGAGAGGAATGAAAGGAAGG - Intronic
1022051917 7:26683519-26683541 CTTTATGATGGATGGATGGAAGG + Intronic
1022787257 7:33650826-33650848 CCTTGCTGGGGATGGATGGATGG + Intergenic
1023021880 7:36018367-36018389 CCTTGTGTGTGATGAATGGATGG + Intergenic
1023827170 7:44017385-44017407 TGTTTTGGGGAATGGATGGAAGG - Intergenic
1023960459 7:44922067-44922089 CCTGGTGAGGAAGGGGAGGAGGG - Intergenic
1024102339 7:46044875-46044897 CCTTATGGGGAATGAAGGGATGG + Intergenic
1024507814 7:50177575-50177597 TCTACTGATGAATGGATGGATGG + Intergenic
1025170679 7:56753876-56753898 ACTGGAGAGGAAGGGATGGATGG + Intergenic
1025701205 7:63821823-63821845 ACTGGAGAGGAAGGGATGGATGG - Intergenic
1029605919 7:101599373-101599395 CCTTTTGGGGAATGGATGGAAGG - Intergenic
1029738322 7:102477131-102477153 TGTTTTGGGGAATGGATGGAAGG - Intronic
1029755452 7:102570787-102570809 TGTTTTGGGGAATGGATGGAAGG - Intronic
1029773401 7:102669867-102669889 TGTTTTGGGGAATGGATGGAAGG - Intronic
1031446281 7:121858492-121858514 CCTTGGGAGGAAGGTAGGGAGGG + Intergenic
1032072597 7:128817885-128817907 CCTTCTGAGGGATAGAGGGAGGG + Intronic
1032636987 7:133719892-133719914 ACTTCTCAGGAAAGGATGGATGG + Intronic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1037444776 8:18954545-18954567 TTTTGTGATGGATGGATGGATGG - Intronic
1037886084 8:22597229-22597251 CCTTGTCAGGAGTGCATGGACGG + Intronic
1037901715 8:22692701-22692723 CCTGGTGATGGATGGATGGATGG - Intronic
1038238751 8:25788133-25788155 CTTTGAGGGGATTGGATGGAAGG - Intergenic
1038501458 8:28047773-28047795 CCTTGTTAGGAGTGGACAGATGG - Intronic
1038969420 8:32615832-32615854 TCTTCTGAGGAAAGGAAGGAAGG + Intronic
1040823000 8:51585750-51585772 TCTTTTAATGAATGGATGGAAGG - Intronic
1041700072 8:60778902-60778924 GTTTGTGAGGAAAGGATAGAGGG + Intronic
1043459157 8:80441953-80441975 CATTGTGAAGAATGGATTGGAGG + Intergenic
1045490910 8:102668533-102668555 CCTTGAGAGGCTTGGATGGGAGG + Intergenic
1047424791 8:124735222-124735244 TCTTGTGAGGACTTGATTGAGGG - Intergenic
1047562820 8:126007999-126008021 CCTTGTGGGAAATGAAGGGATGG - Intergenic
1047635460 8:126756823-126756845 CCTTTTGAAGAACTGATGGAAGG - Intergenic
1048593207 8:135840871-135840893 CATGGTGATGGATGGATGGATGG - Intergenic
1048937789 8:139371267-139371289 TAATGTGATGAATGGATGGATGG + Intergenic
1049015414 8:139916503-139916525 CGTTCCGAGGAGTGGATGGAGGG - Intronic
1049034372 8:140062781-140062803 GCTTCTGAGGAAGGAATGGAGGG + Intronic
1049522548 8:143101510-143101532 CCTTGTGGGGTAGGGAGGGAAGG + Intergenic
1049576565 8:143392492-143392514 CCCTTTGGTGAATGGATGGATGG - Intergenic
1049834004 8:144721377-144721399 ACTCATGACGAATGGATGGAGGG - Exonic
1049857396 8:144871328-144871350 CCTTATGAGAAATGAAGGGATGG - Intergenic
1050078875 9:1893891-1893913 CCTTGGCAGGAATGAATGGCTGG - Intergenic
1050714598 9:8508356-8508378 CCTTGTGTATAATGGATAGAGGG - Intronic
1050821382 9:9884226-9884248 CATTGTGAAGAATGGAATGAGGG + Intronic
1055713356 9:79089155-79089177 CTTTTTTAGCAATGGATGGAGGG + Intergenic
1056304660 9:85278020-85278042 TGTTCTGGGGAATGGATGGAAGG - Intergenic
1056425024 9:86467250-86467272 CCTTGTGGAGAGTGGATTGATGG + Intergenic
1056787571 9:89604055-89604077 CCGTGCGAGGAACGGATGGAAGG + Intergenic
1057896782 9:98915591-98915613 CCTTGTGGTGAGTGGAAGGACGG - Intergenic
1058180305 9:101790358-101790380 CAGTGTGAAGAATGGATTGAAGG + Intergenic
1058905683 9:109480885-109480907 CTGTGGGATGAATGGATGGATGG + Intronic
1058922880 9:109634331-109634353 CCTTGTCAGTGTTGGATGGATGG - Intergenic
1059224468 9:112659184-112659206 CCTGGTGAGGATTAGAAGGAAGG + Intronic
1059875871 9:118634155-118634177 CCTTATGGGAAATGAATGGATGG + Intergenic
1060946894 9:127574984-127575006 CCCAGTGAGGAATGCATGGGGGG - Intronic
1061260753 9:129479716-129479738 CCTTGTGGGCAGTGGAAGGAAGG + Intergenic
1062166935 9:135112633-135112655 CCCTGTGCGGACTGGGTGGACGG - Intronic
1062652539 9:137585607-137585629 CCCAGTGAGGAAGGGATGGGGGG + Intronic
1062712371 9:137983469-137983491 CTATCTGAGGAATGGCTGGAAGG + Intronic
1203365122 Un_KI270442v1:249469-249491 CCTTGGAAGGGATGGAGGGAGGG + Intergenic
1185749331 X:2598137-2598159 CCTTGAAAGGAAAGGATGGATGG + Intergenic
1190888236 X:54547789-54547811 CTGTGTGAGGAATTGAGGGAGGG + Intronic
1192257242 X:69472161-69472183 CTGTGTGGGGAATGGATGGTAGG - Intergenic
1195803945 X:108742031-108742053 CCATGTGAGGAGTGGAGAGAGGG - Intergenic
1199058594 X:143327486-143327508 CCTTGTGGGGAGTTGATGAATGG - Intergenic
1199593095 X:149486276-149486298 CCTTGTGACGAATGGTTGAAGGG + Intronic
1201887726 Y:18904162-18904184 ACTTTTGATGAATGGAGGGAGGG + Intergenic