ID: 1079134977

View in Genome Browser
Species Human (GRCh38)
Location 11:17771331-17771353
Sequence CTCAGGTAACAGTTCAATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079134971_1079134977 18 Left 1079134971 11:17771290-17771312 CCAAATCACAGTGACTGAACACA 0: 1
1: 0
2: 7
3: 59
4: 396
Right 1079134977 11:17771331-17771353 CTCAGGTAACAGTTCAATGTGGG 0: 1
1: 0
2: 3
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079134977 Original CRISPR CTCAGGTAACAGTTCAATGT GGG Intronic
903042766 1:20543597-20543619 CTCAGGAAGCAGATCAATGCAGG + Intergenic
907044993 1:51295114-51295136 CTCAGGGAACAGCTGGATGTGGG + Intronic
908341789 1:63188518-63188540 CTCACGTAACAGTCCAGTGAAGG + Intergenic
909539660 1:76776970-76776992 CTCAGTTAAAAGTTTAATGTAGG + Intergenic
913453746 1:119010021-119010043 CTCATGTTACAGTTCAGTGGGGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
915830723 1:159127367-159127389 GTCAAGTAACAGATCAGTGTCGG + Intronic
916696870 1:167246805-167246827 CTCATTTAACAGTTCCATTTAGG - Intronic
918489768 1:185069051-185069073 CTCTGGTAAGAGTACAATTTAGG + Intronic
919688981 1:200511612-200511634 CTCATGTCACATTTTAATGTGGG - Intergenic
920751283 1:208679830-208679852 CTCAGAGAACAGTTCTATGTTGG + Intergenic
921098424 1:211907392-211907414 CTCACATATCAGTTCAAGGTGGG + Intergenic
923452658 1:234134534-234134556 TTCAGGTAACAGTACAATAAAGG + Intronic
1065045564 10:21745299-21745321 CTTAGGTCACAGTTCAAGTTTGG + Intergenic
1071235972 10:83648873-83648895 CTCAGTTATCAGATCAATGGTGG - Intergenic
1074396150 10:113099559-113099581 CTTAGGGAAAAGTACAATGTAGG + Intronic
1075368146 10:121911720-121911742 CTCACATAACAGTTCAGTGTGGG - Intronic
1079134977 11:17771331-17771353 CTCAGGTAACAGTTCAATGTGGG + Intronic
1079421339 11:20292350-20292372 CTCGGATAACAGTTCCAAGTGGG + Intergenic
1079432897 11:20413117-20413139 CTGAAGAAACAGTACAATGTTGG - Intronic
1081203818 11:40250927-40250949 CTCAGGAAATAGATAAATGTAGG - Intronic
1089152866 11:116377638-116377660 CTCATGTCACAGTCCAATGCAGG - Intergenic
1089553856 11:119303827-119303849 CTCAGGAAAAAGTTCAAGGAAGG - Exonic
1093634578 12:21449687-21449709 CTCAGGTAACATTTTAAGGTTGG + Exonic
1093845791 12:23969816-23969838 ATCAGGTACCAGTTCAAAGATGG + Intergenic
1096715345 12:53487685-53487707 CTCAGGTAACAGCCCCACGTGGG + Intronic
1098792731 12:74846138-74846160 CCCAAATAACAGTTAAATGTGGG + Intergenic
1101316599 12:103634698-103634720 CTCATGTAACAGTCCAATGTGGG + Intronic
1101690734 12:107077891-107077913 TTGAGATAACACTTCAATGTAGG - Intronic
1107186307 13:37525342-37525364 ATGAGGTTACAGTTCAATATTGG + Intergenic
1112691962 13:101906573-101906595 CTCAGGAAACTCTTCAATGATGG - Intronic
1120494177 14:85213395-85213417 CTAATGTTACAGTCCAATGTAGG - Intergenic
1121862153 14:97328744-97328766 TTCATTTCACAGTTCAATGTAGG + Intergenic
1125110370 15:36025529-36025551 CTCAGGTAACAATTCAGAGATGG + Intergenic
1127098460 15:55536817-55536839 CCCAGGTATCAGTTGAAGGTAGG + Intergenic
1130359958 15:83174274-83174296 TTCAGGGAACAGCTGAATGTGGG - Intronic
1139364519 16:66425735-66425757 CTCTGGTAACTGTTCATTCTGGG - Intergenic
1142595113 17:1026160-1026182 CTCTGGTATCAGCTCAATGAAGG - Intronic
1146607577 17:34274205-34274227 CTCATGTCACAGTTCAAGGTAGG - Intergenic
1146821726 17:35988490-35988512 CTCATGTTACAGTCCAGTGTGGG + Intronic
1148593877 17:48837281-48837303 CACAGGTAACAGTTTATTATAGG + Intronic
1150457948 17:65323004-65323026 TTCACGTAACAGTTCAATGAGGG + Intergenic
1151897499 17:76990192-76990214 CTCAGGAAACTATTCAATTTAGG + Intergenic
1152919366 17:83058221-83058243 CTCAGTCAGCAGTGCAATGTGGG - Intergenic
1160600443 18:80008607-80008629 CTCAGGTAAAAGTACAAAGAGGG - Intronic
1167411756 19:49348195-49348217 TGCATGTAACATTTCAATGTAGG - Intronic
1168560670 19:57380153-57380175 CGCATGTAACAGTTCACAGTAGG + Intronic
925579561 2:5396880-5396902 CTCACGAAAGAGTTCAAGGTTGG - Intergenic
926865496 2:17353029-17353051 CTCCGGCTACAGTTGAATGTTGG - Intergenic
926963809 2:18387796-18387818 CTAAGGTGACTGTGCAATGTGGG - Intergenic
933523529 2:83405723-83405745 CAAAGGTATCAGATCAATGTGGG + Intergenic
935978660 2:108605086-108605108 CTCAGGTCACAGTCCAATACAGG - Intronic
937256450 2:120559334-120559356 CTCAGGAAACAGTGCAGGGTTGG + Intergenic
941383343 2:164822645-164822667 CTCAGGGAAAATTTCAATATGGG + Intronic
942512198 2:176714685-176714707 ATCATGTAACAGTACAAGGTAGG - Intergenic
945133141 2:206596527-206596549 CTCTGGTTACTTTTCAATGTTGG + Intronic
945333368 2:208563846-208563868 CTCAGGAAACAGTAAGATGTAGG - Intronic
948462158 2:238134992-238135014 CTCATTTAAAAATTCAATGTCGG + Intergenic
1168813830 20:723212-723234 CTCAGGAAGCAGCTCAATGCAGG + Intergenic
1168960637 20:1866999-1867021 CTCAGGTCACAGTCCAGTGTAGG - Intergenic
1169650227 20:7858786-7858808 CTTAGGTTACAGTTTAATGATGG - Intergenic
1170057326 20:12220871-12220893 CCCATGTTATAGTTCAATGTGGG - Intergenic
1170412526 20:16106772-16106794 CTCAGGTTAGAGTACAATGCAGG - Intergenic
1175905802 20:62378749-62378771 CTCAGGTCACAGTTCACAGGTGG + Intergenic
1182019505 22:27069129-27069151 CTCATGGCACAGTCCAATGTGGG - Intergenic
949686806 3:6583258-6583280 CTAATGTAACAGGTTAATGTGGG + Intergenic
950616174 3:14160335-14160357 CTCAGTTAAAGATTCAATGTGGG - Intronic
953517635 3:43611320-43611342 CTCATGTAACTGTTCAAGGCAGG - Intronic
960736144 3:120782810-120782832 CTCAGGAAACAGTTTATTTTGGG + Exonic
961242258 3:125421432-125421454 CTCATGTAAAAGTTCAATCCAGG - Intergenic
962060247 3:131918991-131919013 CCCAGGAAACAGTGCAGTGTAGG + Intronic
962141112 3:132791851-132791873 CTCAAGTAAGAGTCCAATGCAGG + Intergenic
963574369 3:147041353-147041375 CTCAGGTACCAGTTGAACCTGGG + Intergenic
964914729 3:161826668-161826690 CTCAGGTCTCAGTTCAAAGAAGG + Intergenic
965617938 3:170613733-170613755 CTCACATAACAGTTCAAAGCAGG - Intronic
966023336 3:175243442-175243464 CTCAGGAAACAGTGCCCTGTTGG + Intronic
967738479 3:192979747-192979769 CTCATGTAACAGTCCAACATGGG - Intergenic
971449924 4:26790339-26790361 CTCAAGTAACAGTTCAGTGGAGG - Intergenic
974050343 4:56936279-56936301 CTGAGGTAACAGTCCAGTATGGG + Intergenic
974338108 4:60577831-60577853 CTCAGGAAATAGTACAACGTGGG + Intergenic
975612281 4:76214312-76214334 CCCAGGCCCCAGTTCAATGTGGG - Intronic
978073362 4:104498061-104498083 CTCATGTAACAGTCCAGGGTGGG + Intergenic
981400081 4:144303510-144303532 CTCAGTTAGCACTTCAATGGAGG - Intergenic
982070948 4:151693804-151693826 CTCAGGCACCAGTTCCATTTAGG + Intronic
983565177 4:169143050-169143072 CTCAGGTAACAGCTCCATTAAGG + Intronic
985848547 5:2371852-2371874 CTCACGAAACAGCTCAGTGTGGG - Intergenic
987577533 5:19750623-19750645 CTCAGTAACCAGTTAAATGTAGG + Intronic
988340982 5:29971258-29971280 CTCTGGTTACATTTCATTGTGGG + Intergenic
990246402 5:53867522-53867544 CAGAGGTAAGAGTTCAATTTAGG + Intergenic
990999330 5:61767141-61767163 TTCATGTAACAGTTCAGTGCAGG - Intergenic
992602504 5:78416993-78417015 ATCAGGTAAAAGTCAAATGTAGG - Intronic
996537133 5:124589925-124589947 CTCAGGTCAGATTACAATGTTGG - Intergenic
999009930 5:148024986-148025008 CTCAAGTAACACATCAATTTGGG + Intergenic
1002713068 5:181206589-181206611 TTCAGGTCACAGTTCATTTTTGG + Intergenic
1002858967 6:1062978-1063000 CTCAGGTCACAGTTGAATGTGGG + Intergenic
1004822019 6:19377427-19377449 CTCATCTAACAGTACACTGTGGG + Intergenic
1009528641 6:64780913-64780935 CTCAAATAACAGTCTAATGTGGG + Intronic
1009981525 6:70731520-70731542 ATCAGGGAAAAGTTCACTGTGGG - Intronic
1011572040 6:88748112-88748134 GTCAGGAAAGAGTTCATTGTAGG - Intronic
1012227963 6:96726529-96726551 CTCATGTAACAGTGCAGTGAGGG + Intergenic
1015043490 6:128749830-128749852 CTCAAGTAATAGTTTAATATAGG + Intergenic
1016122000 6:140355398-140355420 CACAGGAAACATTACAATGTGGG + Intergenic
1016704591 6:147091901-147091923 CTCAATTAATAGTTAAATGTAGG + Intergenic
1020021899 7:4874166-4874188 CGCAGGGAACAGTTCCAAGTGGG + Intronic
1021930032 7:25571134-25571156 CTCAGGATACAGTTCGAGGTGGG - Intergenic
1027834156 7:83219336-83219358 CTCAGGCAACAGTTCGCTGCAGG + Intergenic
1028491565 7:91418034-91418056 CTCATATAATTGTTCAATGTGGG - Intergenic
1028618330 7:92795948-92795970 CTCAAATAACACTTAAATGTAGG - Intronic
1030209675 7:106983851-106983873 ATCAGGTAAGAGTTCTATTTGGG + Intergenic
1031027832 7:116699782-116699804 CTCAGGTAAAACATCAATGTAGG - Exonic
1031283200 7:119832234-119832256 TACAGGTAATAGTTGAATGTTGG - Intergenic
1032847803 7:135766793-135766815 TTCAGGTAACAGCACAATTTGGG + Intergenic
1037641914 8:20752484-20752506 CTTATTTTACAGTTCAATGTTGG - Intergenic
1041752771 8:61278975-61278997 CTCTGGTAACGGTTCTATGCAGG - Intronic
1043888367 8:85628812-85628834 CTCACTTAACAGTCCAATGAAGG + Intergenic
1044811116 8:96063155-96063177 CTCATGTCACAGTCCAATATGGG - Intergenic
1047228598 8:122977054-122977076 CTCAGGCAACAGTCCAGGGTGGG + Intergenic
1047721054 8:127639898-127639920 CTCTAGTATCAGATCAATGTTGG + Intergenic
1050838686 9:10117962-10117984 ATCAGGTAATAGTTCCAGGTTGG - Intronic
1051802403 9:20950964-20950986 AAAAGGTAACAGTTCAATGATGG - Intronic
1055010539 9:71560501-71560523 CTCAGGTAAAAATGCAATGATGG + Intergenic
1060024582 9:120160483-120160505 CCCAGGTAACAGGTCAATGTGGG + Intergenic
1187233213 X:17442233-17442255 CTCATGTTACAGTCCAGTGTGGG + Intronic
1188023405 X:25183649-25183671 CACAGCTAGCACTTCAATGTGGG - Intergenic
1188246976 X:27847885-27847907 CTAAGGTAACCCTTGAATGTTGG + Intergenic
1188661813 X:32769493-32769515 CCCAGGTATAAGTCCAATGTAGG - Intronic
1190247691 X:48701349-48701371 CTCATGGAACAGTCCATTGTGGG + Intronic
1192859292 X:75048531-75048553 CTCAGGTAACACTTGGATGGGGG + Intergenic
1193730078 X:85092333-85092355 CTCAGGTGACAGTCAAATGTTGG + Exonic
1200121364 X:153792510-153792532 CTCAGGTCAGAGTTCAAGGCTGG + Intronic
1201327302 Y:12776183-12776205 CCCAGGTTAGAGTTCAATGGCGG + Intronic